CN105505755A - Space transcriptome database building and sequencing method and device adopted for same - Google Patents

Abstract

The invention discloses a space transcriptome sequencing technology device based on tissue and chip space position information. The device comprises a cover slip and a silicon-based oligonucleotide chip, wherein an anchoring probe is arranged on the silicon-based oligonucleotide chip; a gap between the cover slip and the silicon-based oligonucleotide chip is used for accommodating a tissue freezing section with the thickness of 10-50 um. Meanwhile, the invention further provides a space transcriptome sequencing technology method adopting the device. According to the device and the method, sufficient RNA (ribonucleic acid) samples can be effectively acquired from a small quantity of cells, uniform or overall characterization of a sequencing result is avoided, further, difference of different phenotypes of cell transcript information in tissue can be distinguished according to cell heterogeneity, and transcript information with low abundance is mined, so that that more accurate transcript information with high specificity is provided for fields of biology, medicine and agriculture.

Description

Space is transcribed and is set up storehouse sequence measurement and equipment therefor

Technical field

The present invention relates to the fields such as biology, medical science, agronomy, especially a kind of space utilizing chip probe to obtain histocyte spatial positional information is transcribed and is set up storehouse sequencing technologies.This technology can according to the position of cell, classification and status information are carried out accurately cell, are repeatably marked and classify, RNA can be isolated from the viable cell natural fabric microenvironment what retain the position distribution in cell tissue, by the flow process such as high-flux sequence and analysis of biological information, the histiocytic complete express spectra of disposable quantitative acquisition different spatial.

Background technology

Transcript profile is the set of all RNA that particular organization or cell transcribe out under a certain etap or functional status.The transcript profile all mRNA that namely can transcribe out under a certain functional status to specific cells that check order check order.By high-flux sequence of new generation, transcript profile order-checking can obtain a certain species particular organization or the nearly all transcript sequence information of organ under a certain state comprehensively rapidly, has been widely used in the fields such as fundamental research, clinical diagnosis and medicament research and development.Cell is the basic function unit of vital movement, and is identical without any two cells in vivo.Traditional transcript profile research, is all carry out for a large amount of cells of mixing in most cases, cannot observes fine distinction between individual cells, masks specificity and Cell differentials in the behavior of independent individual sample and biological phenomena.And for the research of individual cells, be the ultimate limit state that cell life analytical technology is pursued, be the ultimate challenge to conventional art development.We are stepping into unicellular transcription group epoch at present, and this research direction can produce deep effect to biology and medical science.But unicellular genome and the order-checking sample size required for transcript profile order-checking exceed a lot of order of magnitude, so this is also a test to nucleic acid amplification technologies (amplificationtechnology) than contained genome itself and transcript profile molecule in unicellular.And in the unicellular sequencing technologies adopted at present, most method all needs specific pretreatment process, preparation " sequencing library ".In the face of so micro-molecule, any degraded, sample loss or pollution all can bring very serious impact to sequencing quality.And multiplex amplification easily brings testing error again, such as genome or transcript profile cover that heterogeneity, misoperation rate are high, poor repeatability, ground unrest and the problem such as quantitatively inaccurate all cause unicellular order-checking to be difficult to widespread use and popularization.

Summary of the invention

The technical problem to be solved in the present invention be to provide a kind of based on tissue and chip space positional information, easy and simple to handle, advantage of lower cost, high specificity, resolving power are high, be convenient to detect the space of particular organization specific cells gene transcript expression information transcribes establishment storehouse sequencing technologies.

In order to solve the problems of the technologies described above, the invention provides a kind of based on tissue and the space transcript profile sequencing technologies device of chip space positional information: comprise cover glass and silica-based oligonucleotide chip, silica-based oligonucleotide chip is provided with anchor probe;

Described cover glass is positioned at the top of silica-based oligonucleotide chip, the area of cover glass is greater than (slightly larger than) area of silica-based oligonucleotide chip; For placing the tissue cryo-sections that thickness is 10 ~ 50um (be such as 45 ~ 55 μm, that is, thickness is about 50 μm) between cover glass and silica-based oligonucleotide chip, the area of described tissue cryo-sections is less than the area of cover glass; And the area that on the area of tissue cryo-sections≤(that is, be slightly less than or equal) silica-based oligonucleotide chip, all probes cover.

As the improvement of space transcript profile sequencing technologies device based on tissue and chip space positional information of the present invention: the anchor probe of described silica-based oligonucleotide chip is 5'-GGNNNNNNNCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACC.

The present invention also provides the space utilizing any one device above-mentioned to carry out transcript profile sequencing technologies method simultaneously, comprises the following steps:

1), first add first paragraph primer (20nmol), the sequence of first paragraph primer is 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT, and annealing temperature is 75 degree/70 degree;

And then adding second segment primer (total amount of about 2ug), 0.1 μM of Polyd (T) Primer5'PHO-GNNNNNNNCCT (13-18) VN, annealing temperature drops to 15 degree from 70;

Add T4 ligase enzyme (2ul) again, for connecting first paragraph and second segment primer, holding temperature 15 degree, reaction (rapid reaction) 20min, siphons away surplus liquid after having reacted;

2), by tissue slice be positioned over cover glass surface (being added with the cover glass surface of position mark), the thickness of tissue slice is 10 ~ 50um (principle is as the criterion to be less than or to approximate cell thickness), and size is no more than 1.5 × 1.5cm; Sample cover glass is upward positioned over the histiocytic position of basis of microscopic observation, and takes pictures for follow-up location;

Complete after taking pictures, add lysate (10ul) at chip surface, thus make lysate be paved with Probe chip probe surface; Covered by cover glass on chip, tissue sample directly contacts with chip probe downwards;

Cover glass size is corresponding with the size of chip probe part, for the position of corresponding position tissue;

Hatch, 75 DEG C---3min---65 DEG C-0.1 DEG C/s-(37 ~ 45) DEG C---as follows to take out chip;

Noting, 75 DEG C---3min opens the secondary structure of TotalRNA, prepares and primer combination; It is more accurate that 0.1 DEG C/s annealing makes primer be combined with masterplate; Be generally 40 DEG C according to calmodulin binding domain CaM length setting, length changes needs adjustment, and when oligoT number changes between 13-18, outlet temperature scope, 37-40 DEG C of change, improves temperature (such as to 45 DEG C) when OligoT increases;

Take cover glass away and cover the tissue sample of chip surface, and siphon away all liquid, use RNasefree water softly to wash once;

3), in above-mentioned steps 2) complete after, chip completes the first chain reverse transcription, then digests RNA;

That is, 1ulRNaseA (10mg/ml) (decomposing free RNA) is digested;

Specific as follows: degrade remaining RNA, then 95 DEG C of hatching 10min, draw all liquid, transfer to centrifuge tube.Chip uses RNasefree water washing 2 times, and dries and can reuse.The reaction carried out in PCR pipe: add 0.5ul enzyme RNaseH (60U/ μ l) (decomposing the RNA chain in RNA/DNA hybridization system), 37 DEG C of reaction 5min;

Remarks: the single stranded RNA that first RNaseA digestion is free, 95 DEG C of high temperature make hybridizing rna unwind simultaneously, and heat interrupts RNA; Then annealed combination is returned the small fragment RNA degraded of reverse transcription first chain by RNaseH;

4), above-mentioned 3) step terminate after digestion system in, carry out the combination of the second strand primer;

That is, add 1 μM of SecondPrimer and 1 μM SecondREVPrimer from 98 DEG C---1min---80 DEG C-0.2 DEG C/s-25 DEG C---30min, adopt gradient hatching mode association reaction;

5), by above-mentioned steps 4) hatching after reaction solution in, then carry out the second chain extension;

That is, 9.5 μ lddH are added respectively ₂o, 4 μ l10 × NEBuffer, 2 μ l10mMdNTP and 2 μ lKlenow (3 '-5 ' exo-), be predisposed to extension in 25 DEG C of PCR instrument (PCR instrument ambient temperature is set to <25 DEG C, and the primer that the too high meeting of temperature makes the 5th step combine comes off);

6), by above-mentioned steps 5) reacted after, magnetic beads for purifying (first preparing 80% dehydrated alcohol, cumulative volume=0.4* (n+1) ml, n=sample number) is carried out to product;

Concrete steps can be as follows:

1. add water polishing to 80 μ l, adds 80 μ lBECKBeads (1x);

2. fully mixing rear (inhale and beat at least 10 times), leaves standstill 5min;

3. slightly centrifugal, as on magnetic bead plate;

4. leave standstill 5min or see that liquid is clarified, slowly drawing 155 μ l supernatants, abandon;

5. add 80% dehydrated alcohol that 200 μ l now join, leave standstill 30s;

6. slowly inhale after making a call to 2 times, draw 198 μ l supernatants, abandon;

7. add 80% dehydrated alcohol that 200 μ l now join, leave standstill 30s;

8. slowly inhale after making a call to 2 times, draw 198 μ l supernatants, abandon;

9. change 10 μ l rifles and suck residual alcohol, dry;

(note: step 4-9, pipe all will be placed on magnetic frame)

10. after crackle appears in magnetic bead, above-mentioned 8 pipe magnetic beads, 26 μ lddH2O are mixed, fully inhale after playing mixing and (inhale and beat at least 10 times);

(remarks: magnetic bead drying can affect DNA yield too for a long time);

11. leave standstill 2min, slightly centrifugal, are placed in 2min on magnetic frame, draw whole supernatant in new pipe;

12. new pipes are placed in 5min on magnetic frame again, slowly draw 23 μ l supernatants and are used for subsequent experimental;

13. residue supernatants inhale 2 μ l, Qubit measured value, record.

7), pcr amplification is carried out;

Specific as follows:

Reaction system:

Use following pcr amplification program:

98℃30s

98℃10s

65℃30s12-23Cycle

72 DEG C of 30s (PCR output is relevant to initial mRNA)

72℃5min

4 DEG C of preservations;

8) magnetic beads for purifying (first preparing 80% dehydrated alcohol, cumulative volume=0.4* (n+1) ml, n=sample number), to PCR primer is carried out again;

Concrete non-productive operation step is as follows:

1. add water polishing to 80 μ l, adds 80 μ lBECKBeads (1x);

2. fully mixing rear (inhale and beat at least 10 times), leaves standstill 5min;

3. slightly centrifugal, as on magnetic bead plate;

4. leave standstill 5min or see that liquid is clarified, slowly drawing 155 μ l supernatants, abandon;

5. add 80% dehydrated alcohol that 200 μ l now join, leave standstill 30s;

6. slowly inhale after making a call to 2 times, draw 198 μ l supernatants, abandon;

7. add 80% dehydrated alcohol that 200 μ l now join, leave standstill 30s;

8. slowly inhale after making a call to 2 times, draw 198 μ l supernatants, abandon;

9. change 10 μ l rifles and suck residual alcohol, dry;

(step 4-9, pipe all will be placed on magnetic frame);

10. after crackle appears in magnetic bead, the 8th pipe magnetic bead 13 μ lddH2O are mixed, fully inhale after playing mixing and (inhale and beat at least 10 times);

(magnetic bead drying can affect DNA yield too for a long time);

11. leave standstill 2min, slightly centrifugal, are placed in 2min on magnetic frame, draw whole supernatant in new pipe;

12. new pipes are placed in 5min on magnetic frame again, slowly draw 10 μ l supernatants and are used for subsequent experimental;

13. residue supernatants inhale 2 μ l, Qubit measured value, record;

Remarks annotate: experimental product and Polyd (T) and SecondPrimer be combined with each other clip size difference not quite, and magnetic bead can not separate; Suggestion rubber tapping is reclaimed, and avoids producing gibberish; If it is more compared to object product certainly to connect fragment products, primer can be reduced be combined with each other by increasing initial TotalRNA amount;

9), by above-mentioned steps 8) library that completes carries out fluorescent quantitation and upper machine order-checking;

Sequenator is applicable to all sequenators of Illumina, joint barcode due to both-end is positioned at the side of oligoT, so both-end must be adopted to check order, side is for obtaining high-quality sequence for calculating the expression amount of gene, and side is for obtaining barcode information; If read the long position that can also be used for determining 3 ' Transcription Termination more than the sequence of 50bp, barcode side;

10), by above-mentioned steps 9) data analysis that obtains.

Due to the biased sample that sequencing data is all barcode information, first need to process and cutting raw data.

12000 barcode sequences are divided into 12000 independent sequential files by auxiliary annotation: according to the barcode sequence designed before and positional information.

Read preface part to opposite side, need the sequence of excising front 15 bases, because use random primer to combine, may there is larger sequence errors in sequencing data in these bases.

Prepare, with reference to aligned sequences, to obtain and analyze each gene cdna sequence of species and sequence construct file of downstream 1kb.

Joint and also point one-sided sequence of good barcode and the reference sequences comparison of above-mentioned structure of inferior quality sequence will have been cleared up, the high through-put sequence comparison software that comparison software can adopt Tophat, Hisat, bowtie2 etc. common, or use the aligned sequences such as blast.Sequence only retains optimum matching.

Because sequencing sequence is identical with RNA direction, filter the sequence that all comparison directions are reverse, and calculate the reads number on each gene in comparison, total be finally multiplied by divided by the order-checking number of each barcode the expression amount that 100 ten thousand are exactly each gene.

The invention provides a kind of space based on chip and organization space positional information and transcribe establishment storehouse sequencing technologies, to be provided with on anchor probe basis on silica-based oligonucleotide chip, according to chip fixing and clear and definite locus relative to sample tissue, the a certain special time period of quick obtaining, the expressing information of the gene under a certain particular state of particular organization's specific cells.It is advantageous that, can maintainer gene place cell spatial structural form in the tissue, thus reconstruct the most gene express spectra of all sites cell of a section, three-dimensional unicellular scale expression mode spectrum information can be constructed in conjunction with multilayer wall.In addition, this technology is due to less demanding to rna content, by controlling point sample precision and the evitable protoplasma component of mixing flanking cell of cutting process, distinguish by powerful microscope and thinner biopsy tissues and labeled cell source and position and without the need to dyeing, and contribute to understanding the behavior of individual cells in genetic expression better to the Phenotypic Observation before cell sequestration, biomedical research, medical science lesion detection, clinical and drug development and the research of animals and plants developmental biology can be widely used in.

The present invention has following beneficial effect:

1), the present invention is the cell transcription group sequencing technologies based on tissue and chip space positional information, biological micro-deposition techniques is utilized to carry out high precision point sample at the slide glass of aldehyde radical process or by fabricated in situ probe (photoetching or chemosynthesis), make micro-array chip (target spot on substrate in unit surface or print are counted personalized).The process of slide glass aldehyde radical is in conjunction with biological micro-deposition techniques or fabricated in situ probe technique maturation all, and material requested is the common materials in biochemical field, therefore the present invention can realize the expression analysis to all expressing genes of in-house all cells original position when high-density probe, has high-throughput, high precision, realizes features such as the location of space and genetic expression simultaneously.

2), extract that to build storehouse process simple and quick.Technology of the present invention is extracted and is built storehouse process and uses paramagnetic particle method to eliminate traditional RNA leaching process, only need will directly be placed on the micro-array chip for preparing after tissue cryo-sections, avoid tradition extraction RNA process and cross the RNA degraded or pollution that cause, save the operating time, be applicable to multi-field widespread use.It also avoid unicellular leaching process and the pollution of amplification procedure subsequently and complex operations, complete and obtain the expressing information of cell accurately.

3), technology of the present invention passes through the relative tertiary location of observation and tagged tissue and chip probe barcode (bar code), determine that the transcript profile of particular organization or a certain specified phase of cell is movable, all significantly improve compared to traditional RNA order-checking tolerance range and specificity.

4), the chip connector (primer) of technology customization of the present invention and modified can not only ensure to identify the mRNA that cell discharges fast and reverse transcription comprehensively, and primer 5 ｀ end add 5-8 base bar code and two generation high-flux sequence P7 joint, give security in conjunction with high-flux sequence and data analysis for follow-up.

5), after reverse transcription synthesizes the first chain cDNA, only need add RNA enzyme liberating RNA, add random primer subsequently and carry out the second chain cDNA and synthesize, then high temperature unwinds, just to be available on the machine order-checking through pcr amplification after imbitition purifying, whole reaction process only completes on chip, improves working efficiency.

6), by positional information that probe on cell chip is relative with histocyte, the limitation of capturing at random in other similar approach can also be broken away from, realize capturing completely and Phenotypic Observation before reacting, to understand and to verify the heterogeneity of individual cells better extremely a small amount of cell.

In sum, the present invention can not only effectively realize obtaining enough RNA sample in a small amount of cell, " homogeneous " or " entirety " of sequencing result is avoided to characterize, the otherness of not isophenic this information of cell transcription in tissue can be differentiated according to cell heterogeneity, excavate low-abundance transcript information, thus be the transcript information that biological medicine agriculture field provides more accurately and specificity is high.

Inventive point of the present invention (technological improvement point) is mainly (not only as follows):

1. combine planar chip simultaneously and can retain the feature of original RNA source position and the extensive high-throughput advantage of RNA-seq order-checking, realize first building storehouse and order-checking to the RNA of a histological section all cells ultra-high throughput.

2. utilize sequence label, can disposable realization more than the structure in 10,000 2 thousand libraries, and carry out follow-up differentiation by sequence label to sample and reorientate go back to initiating cell position in single plane.

3., because the fabricated in situ direction of DNA chip is 5 ' to 3 ', the reverse transcription making silica-based oligonucleotide chip probe cannot be directly used in RNA extends.For this reason, the chip probe part of the present invention's design is mainly used in the location of specific sequence label, carry out complementation by the sequence label on the follow-up reverse primer that adds and random primer and chip to combine, and be combined with the polyA complementary of RNA again after being connected by ligase enzyme and carry out reverse transcription, after reverse transcription terminates by heating unwind make after add with the fragment of reverse transcription synthesis from wash-out chip.Make the sequence tag probes of former chip to reuse in this way, cost is declined to a great extent.

Novel technical method of the present invention is compared with traditional standard method, and required RNA amount is few, and consumption can be low to moderate less than 5ng (5/1000000000ths grams), is only 1/1 to 200/100th of conventional sequence measurement.The Method and Technology that the present invention sets up is provided with the anchor probe positional information relative with sample tissue cells by silica-based oligonucleotide chip, more accurately can detect the transcription activity of most gene under the specific developmental condition of the specific cells of any species particular organization, the limitation of capturing at random in other similar approach can also be broken away from, checked order by the transcript profile of multiple cell compared with low depth, can obtain and check order prior cell heterogeneity information than place an order a cell high depth of equal cost.This technology is by optimizing, the transcript profile information of the case section sample in hospital and other medical spaces can be identified fast and efficiently, there is very large application potential, and this technology distinguishing feature is to be prepared into from sample to obtain sequencing result, the required time is less than one day, can be widely used in biomedical research, medical science lesion detection, transmissible disease monitoring, clinical and drug development and the research of animals and plants developmental biology.

Accompanying drawing explanation

Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.

Fig. 1 is space of the present invention transcript profile sequencing technologies route map.

Fig. 2 is space of the present invention transcript profile order-checking gordian technique principle schematic.

Remarks illustrate:

1.VN：

V is non-T base; VN can guarantee that the first chain TailedPolyd (T) 14Primer extended is combined on the 5' head of PolyA, instead of is combined in PolyA tail.

2.NNN：

According to these three bases can judge mRNA number whether cross with PCR increase relevant.

3.NNNNNN：

Make random incorporation on Article 1 reverse transcription chain.The scope of last library length is determined with the ratio of Article 1 reverse transcription chain;

Random primer also can be combined with TailedPolyd (T) 14Primer, if too large in conjunction with ratio, during PCR, a large amount of primer can consume at this, causes library total amount on the low side.

Embodiment

One, chip design and customization

Use OligoArray fabricated in situ mode, also can use the in-situ synthetic method of other companies such as Affimatrix.Oligoarray chip selection 12k density synthesis chip, selects the characteristic sequence of 7 bases to mark as barcode, removes all sequences comprising continuous 4 identical bases when barcode selects.The barcode of adjacent sites at least differs 4 bases in theory, and after synthesis, on chip, the total amount of probe is about 200ng.

The probe sequence of chip synthesis is: chip anchor probe is 5'-GGNNNNNNNCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACC.

Wherein sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCACC is the reverse complementary sequence of the order-checking universal linker sequence P7 of Illumina company.

12000 the barcode sequences of 7 N representatives for distinguishing site information in GGNNNNNNNC; Owing to adopting the mode of fabricated in situ, its 3 ' end is connected on chip substrate.

In order to realize carrying out complementation with the polyA end of target tissue cells mRNA, also need the barcode sequence with positional information in anchor probe sequence simultaneously, devise 2 sections of primer sequences, respectively: first paragraph primer sequence, 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT, with " CAGATCGGAAGAGCACACGTCTGAACTCCAGTCACC " part reverse complemental of above-mentioned silicon base chip oligonucleotide probe; Second segment primer sequence, 5'PHO-GNNNNNNNCCT (13-18) VN, wherein barcode sequence " GGNNNNNNNC " the part reverse complemental of GNNNNNNNCC and above-mentioned silica-based oligonucleotide chip probe; Remainder comprises 13-18 T, and for carrying out complementation with the polyA sequence of target tissue cells mRNA, the VN of end is for mating the end of polyA sequence.

Described technology adopts 2 sections of primers to be because directly use a primer sequence long primer when Annealing complementary combines cannot distinguish by annealing temperature the barcode sequence that difference only has 1-2 base accurately, can cause a large amount of mispairing combinations.Use the mode of 2 sections of primers, first paragraph primer is all identical with all chip probes, and identical annealing temperature can be used to combine.Second segment primer afterwards due to chip probe remainder in conjunction with length only 10 bases, the Gradient annealing temperature contrast wherein between different barcode can from 60-15 DEG C, can realize accurate complementaryly to combine by progressively Gradient annealing.T4 ligase enzyme is finally used to be connected by two sections of primers, for realizing needing when being connected to synthesis second segment primer to carry out phosphorylation modification at 5 ' end.

Therefore, the space transcript profile sequencing technologies device based on tissue and chip space positional information used in the present invention comprises cover glass and silica-based oligonucleotide chip, and silica-based oligonucleotide chip is provided with anchor probe;

Cover glass is positioned at the top of silica-based oligonucleotide chip, the area of cover glass is greater than (slightly larger than) area of silica-based oligonucleotide chip; For placing the tissue cryo-sections that thickness is 45 ~ 55 μm (that is, thickness is about 50 μm) between cover glass and silica-based oligonucleotide chip, the area of tissue cryo-sections is less than the area of cover glass; And the area (such as, 1.8cmx2cm) that the upper all probes of the area of tissue cryo-sections≤(that is, be slightly less than or equal) silica-based oligonucleotide chip (3) cover.

Two, laboratory operating procedures is as follows:

1. first add first paragraph primer, add the 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT of 20nmol amount, annealing temperature is 75 degree/70 degree, and design temperature Gradient Descent is from 95-70 degree, and reduction per second 0.1 degree, makes accurate pairing.And then add second segment primer, the total amount of about 2ug, 0.1 μM of Polyd (T) Primer5'PHO-GNNNNNNNCCT (13-18) VN, annealing temperature drops to 15 degree from 70, reduction per second 0.1 degree, make accurate pairing, add 2ulT4 ligase enzyme again, for connecting first paragraph and second segment primer, holding temperature 15 degree, rapid reaction 20min, siphons away surplus liquid after completing.

2. tissue slice preparation

Tissue slice is positioned over the cover glass surface being added with position mark, tissue slice is different according to histocyte, and thickness 10 ~ 50um (principle is as the criterion to be less than or to approximate cell thickness), size is no more than 1.5 × 1.5cm.Sample cover glass is upward positioned over the histiocytic position of basis of microscopic observation, and takes pictures for follow-up location.

Complete after taking pictures, add 10ul lysate at chip surface, make lysate be paved with Probe chip probe surface.Covered by cover glass on chip, tissue sample directly contacts with chip probe downwards.Cover glass size is corresponding with the size of chip probe part, for the position of corresponding position tissue.

Chip is hatched as follows, 75 DEG C to---3min---65 DEG C-0.1 DEG C/s-40 DEG C---taking-up;

Annotation: 75 DEG C---3min opens the secondary structure of TotalRNA, prepares and primer combination; It is more accurate that 0.1 DEG C/s annealing makes primer be combined with masterplate; 40 DEG C according to calmodulin binding domain CaM length setting, length changes needs adjustment, when oligoT number changes between 13-18, outlet temperature scope 37-40 DEG C of change, raising temperature (such as to 45 DEG C) when OligoT increases.

Then take cover glass away and cover the tissue sample of chip surface, and siphon away all liquid, use RNasefree water softly to wash once.

Three. the first chain reverse transcription

In conjunction with primed RNA (staying the RNA on chip from previous step)

37 DEG C---hatching in 15min minute;

Four. digestion RNA (in the 19ul gains of previous step)

Add 1ul enzyme:

RNaseA(10mg/ml)1μl

Cumulative volume 20 μ l

95 DEG C---hatching in 10min minute;

Draw all liquid, transfer to PCR pipe.Chip uses RNasefree water washing 2 times, and dries and can reuse.The reaction carried out in PCR pipe:

Add 0.5ul enzyme

RNaseH(60U/μl)0.5μl

Cumulative volume 20.5 μ l

37 DEG C---5min minute;

Remarks: the single stranded RNA that first RNaseA digestion is free, 95 DEG C of high temperature make hybridizing rna unwind simultaneously, and heat interrupts RNA; Then annealed combination is returned the small fragment RNA degraded of reverse transcription first chain by RNaseH.

Five. the second strand primer combines

98 DEG C of---1min minute---80 DEG C-0.2 DEG C/s-25 DEG C---hatchings in 30min minute;

Six. the second chain extension

25 DEG C---15min minute;

Remarks: PCR instrument is predisposed to 25 DEG C, or PCR instrument ambient temperature is set to <25 DEG C, the primer that the too high meeting of temperature makes the 5th step combine comes off.

Seven. magnetic beads for purifying (first preparing 80% dehydrated alcohol, cumulative volume=0.4* (n+1) ml, n=sample number, 5,7 steps for this part):

Specific as follows:

1., on the 40ul basis of step 6, add water polishing to 80 μ l, and then add 80 μ l xPbeads (BeckmanCoulter, CAT.NO.A63880) (1x) (from BeckMan);

2. fully mixing rear (inhale and beat at least 10 times), leaves standstill 5min minute;

3. slightly centrifugal, as on magnetic bead plate;

4. leave standstill 5min minute or see that liquid is clarified, slowly drawing supernatant (about 155 μ l), abandon;

5. add 80% dehydrated alcohol that 200 μ l now join, leave standstill 30s;

6. slowly inhale after making a call to 2 times, draw 198 μ l supernatants, abandon;

7. add 80% dehydrated alcohol that 200 μ l now join, leave standstill 30s;

8. slowly inhale after making a call to 2 times, draw 198 μ l supernatants, abandon;

9. change 10 μ l rifles and suck residual alcohol, dry;

(note: step 4-9, pipe all will be placed on magnetic frame)

10. after crackle appears in magnetic bead, in magnetic bead, add 26 μ lddH2O, fully inhale after playing mixing and (inhale and beat at least 10 times);

(remarks: magnetic bead drying can affect DNA yield too for a long time)

11. leave standstill 2min minute, slightly centrifugal, are placed in 2min minute on magnetic frame, draw whole supernatant in new pipe;

12. new pipes are placed in 5min minute on magnetic frame again, slowly draw 23 μ l supernatants and are used for subsequent experimental.

13. residue supernatants inhale 2 μ l, Qubit measured value, record, for assessment of library concentration and yield.

Eight .PCR amplification (importing sequence measuring joints, the effective fragment of enrichment by PCR)

The 23ul magnetic beads for purifying DNA23 μ l that above-mentioned steps seven obtains

IndexPrimer(15μM)1μl

Sequence is as follows:

CAAGCAGAAGACGGCATACGAGATnnnnnnnGTGACTGGAGTTCAGACGTGT, be the P7 joint sequence that Illumina company is proprietary, wherein the part of n is barcode sequence;

UniversalPrimer(15μM)1μl

Sequence is as follows: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC, is the P5 joint sequence that Illumina company is proprietary;

2×PhusionHi-FiPCRMix(NEBm0530)25μl

Cumulative volume: 50 μ l

Use following pcr amplification program:

1、98℃30s

2、98℃10s

3、65℃30s12-23Cycle

4、72℃30s

Amplification program 2-4 step carries out 12-23 circulation, and initial total tissue RNA is lower than 500ng, and cycle number selects more than 20, and total serum IgE amount is more than 1ug, and cycle number is less than 15.

5,72 DEG C of 5min minute

6,4 DEG C of preservations

Nine. magnetic beads for purifying (first preparing 80% dehydrated alcohol, cumulative volume=0.4* (n+1) ml, n=sample number), also can adopt rubber tapping to reclaim herein.

1. add water polishing to 80 μ l, adds 80 μ l xPbeads (BeckmanCoulter, CAT.NO.A63880) (1x);

2. fully mixing rear (inhale and beat at least 10 times), leaves standstill 5min minute;

3. slightly centrifugal, as on magnetic bead plate;

4. leave standstill 5min minute or see that liquid is clarified, slowly drawing 155 μ l supernatants, abandon;

5. add 80% dehydrated alcohol that 200 μ l now join, leave standstill 30s;

6. slowly inhale after making a call to 2 times, draw 198 μ l supernatants, abandon;

7. add 80% dehydrated alcohol that 200 μ l now join, leave standstill 30s;

8. slowly inhale after making a call to 2 times, draw 198 μ l supernatants, abandon;

9. change 10 μ l rifles and suck residual alcohol, dry;

(step 4-9, pipe all will be placed on magnetic frame);

10. after crackle appears in magnetic bead, by the 8th pipe magnetic bead 13 μ lddH ₂o mixes, and fully inhales after playing mixing and (inhales and beat at least 10 times);

(magnetic bead drying can affect DNA yield too for a long time);

11. leave standstill 2min minute, slightly centrifugal, are placed in 2min minute on magnetic frame, draw whole supernatant in new pipe;

12. new pipes are placed in 5min minute on magnetic frame again, slowly draw 10 μ l supernatants and are used for subsequent experimental.

13. residue supernatants inhale 2 μ l, Qubit measured value, record.

Ten. fluorescent quantitation is carried out to the library completed and upper machine order-checking

Sequenator is applicable to all sequenators of Illumina, joint barcode due to both-end is positioned at the side of oligoT, so both-end must be adopted to check order, side is for obtaining high-quality sequence for calculating the expression amount of gene, and side is for obtaining barcode information.If read the long position that can also be used for determining 3 ' Transcription Termination more than the sequence of 50bp, barcode side.11. sequencing data process

Due to the biased sample that sequencing data is all barcode information, first need to process and cutting raw data.

According to the barcode sequence designed before and positional information, 12000 barcode sequences are divided into 12000 independent sequential files.

Read preface part to opposite side, need the sequence of excising front 15 bases, because use random primer to combine, may there is larger sequence errors in sequencing data in these bases.

Prepare, with reference to aligned sequences, to obtain and analyze each gene cdna sequence of species and sequence construct file of downstream 1kb.

Joint and also point one-sided sequence of good barcode and the reference sequences comparison of above-mentioned structure of inferior quality sequence will have been cleared up, the high through-put sequence comparison software that comparison software can adopt Tophat, Hisat, bowtie2 etc. common, or using the aligned sequences such as blast, sequence only retains optimum matching.

Because sequencing sequence is identical with RNA direction, filter the sequence that all comparison directions are reverse, and calculate the reads number on each gene in comparison, total be finally multiplied by divided by the order-checking number of each barcode the expression amount that 100 ten thousand are exactly each gene.

Above analytical procedure ten ~ step 11 belongs to sequencing data routine techniques.

Technological method of the present invention on the one hand can be fast and convenient the full genome of the superfine small org cell of acquisition express, the mutual alignment information of each histocyte in primary object can be retained again, the disposable expression library that simultaneously can build all cells of a histological section.Obtain unicellular rear amplification and build compared with storehouse checks order with being separated by micro-dissections or fluidic cell fluorescence, its advantage is comprehensive and multi-level, realizing high-throughout while, without the need to first carrying out unicellular amplification step, greatly reduces pollution and skewed popularity.The most key is that this method remains cell original position-information in the tissue, has revolutionary meaning mutually for histoorgan growth, physiological change, Tumor Heterogeneity research and microorganism and host do research.

Finally, it is also to be noted that what enumerate above is only several specific embodiments of the present invention.Obviously, the invention is not restricted to above embodiment, many distortion can also be had.Comprise and be not limited to change the point sample of chip probe and fabricated in situ mode, sequence measuring joints and different sequenators and increase or change chip probe density etc.All distortion that those of ordinary skill in the art can directly derive from content disclosed by the invention or associate, all should think protection scope of the present invention.

Claims (4)

1., based on tissue and the space transcript profile sequencing technologies device of chip space positional information, it is characterized in that: comprise cover glass and silica-based oligonucleotide chip, silica-based oligonucleotide chip is provided with anchor probe;

Described cover glass is positioned at the top of silica-based oligonucleotide chip, and the area of cover glass is greater than the area of silica-based oligonucleotide chip; For placing the tissue cryo-sections that thickness is 10 ~ 50um between cover glass and silica-based oligonucleotide chip, the area of described tissue cryo-sections is less than the area of cover glass; And the area that on the area of tissue cryo-sections≤silica-based oligonucleotide chip, all probes cover.

2. according to claim 1 based on tissue and the space transcript profile sequencing technologies device of chip space positional information, it is characterized in that: the anchor probe of described silica-based oligonucleotide chip is 5'-GGNNNNNNNCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACC.

3. according to claim 2 based on tissue and the space transcript profile sequencing technologies device of chip space positional information, it is characterized in that: comprise following 2 sections of primers:

First paragraph primer: 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT;

Second segment primer: 5'PHO-GNNNNNNNCCT (13-18) VN.

4. utilize the space transcript profile sequencing technologies method as any one device in claims 1 to 3 carries out, it is characterized in that comprising the following steps:

1), first add first paragraph primer, first paragraph primer is 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT, and annealing temperature is 75 degree/70 degree;

And then adding second segment primer, second segment primer is 5'PHO-GNNNNNNNCCT (13-18) VN, and annealing temperature drops to 15 degree from 70;

Add T4 ligase enzyme again, for connecting first paragraph and second segment primer, holding temperature 15 degree, reaction 20min, siphons away surplus liquid after having reacted;

2), by tissue slice be positioned over cover glass surface, the thickness of tissue slice is 10 ~ 50um, and size is no more than 1.5 × 1.5cm; Sample cover glass is upward positioned over the histiocytic position of basis of microscopic observation, and takes pictures for follow-up location;

Complete after taking pictures, add lysate at chip surface, thus make lysate be paved with Probe chip probe surface; Covered by cover glass on chip, tissue sample directly contacts with chip probe downwards;

Hatch, 75 DEG C---3min---65 DEG C-0.1 DEG C/s-(37 ~ 45) DEG C---as follows to take out chip;

3), in above-mentioned steps 2) complete after, chip completes the first chain reverse transcription, then digests RNA;

4), above-mentioned 3) step terminate after digestion system in, carry out the combination of the second strand primer;

5), by above-mentioned steps 4) hatching after reaction solution in, then carry out the second chain extension;

6), by above-mentioned steps 5) reacted after, magnetic beads for purifying is carried out to product;

7), pcr amplification is carried out;

8), again magnetic beads for purifying is carried out to PCR primer;

9), by above-mentioned steps 8) library that completes carries out fluorescent quantitation and upper machine order-checking;

10), by above-mentioned steps 9) data analysis that obtains.