NL2034227B1

NL2034227B1 - Method for efficiently enriching chromatin open region binding proteins and application thereof

Info

Publication number: NL2034227B1
Application number: NL2034227A
Authority: NL
Inventors: Zhang Yan; Shen Wenlong; Zhao Zhihu; Shi Shu; Li Ping; Ye Bingyu
Original assignee: Acad Of Military Medical Sciences
Priority date: 2022-10-26
Filing date: 2023-02-27
Publication date: 2024-05-14
Also published as: CN116041473A

Abstract

The present invention provides a method for efficiently enriching chromatin open region binding proteins and an application thereof, and relates to the technical field of molecular biology. The present invention provides a method for efficiently enriching chromatin open region binding proteins. The Hethod is based on formaldehyde assisted isolation and high—throughput determination of regulatory elements, takes biotin—labeled formaldehyde assisted isolation of regulatory elements (FAIRE) deoxyribonucleic acid (DNA) as a probe, and traps a FAIRE DNA binding protein through a DNA pull—down method. Based on whole genome open element FAIRE, the present invention achieves an objective of efficiently trapping all regulatory element binding proteins and has low background noise, and 80 percent or more of trapped proteins are chromatin binding proteins. The method, has advantages of high enrichment efficiency, high reliability, short time, low cost, easy operation, etc.

Description

METHOD FOR EFFICIENTLY ENRICHING CHROMATIN OPEN REGION BINDING

PROTEINS AND APPLICATION THEREOF

TECHNICAL FIELD

The present invention relates to the technical field of mo- lecular biology, and particularly relates to a method for effi- ciently enriching chromatin open region binding proteins and an application thereof.

BACKGROUND ART

For a long time, there is still a lack of effective methods for identifying open chromatin deoxyribonucleic acid (DNA) binding regulatory proteins in a nucleus. For example, by artificially de- signing and synthetizing regulatory sequences to trap regulatory proteins, a concatenated tandem array of transcription factor re- sponse elements (catTFRE) or hormone response elements (HREs) can only trap known limited proteins, but cannot obtain all open ele- ment binding proteins in real time. Although there have been re- cent reports indicating that technologies such as multiclassifier combinatorial proteomics (MCCP) and density-based enrichment for mass spectrometry analysis of chromatin (DEMAC) can effectively enrich all chromatin binding proteins, it is still unknown which are regulatory element binding proteins. Recently, it has been re- ported that the assay for transposase accessible chromatin with high-throughput (ATAC)-mass spectrum (MS) can trap all chromatin regulatory proteins, but most of the proteins trapped through the method are cytoplasmic proteins while chromatin open element bind- ing proteins account for less than 10%.

SUMMARY

In view of this, an objective of the present invention is to provide a method for efficiently enriching chromatin open region binding proteins, which may achieve efficient trapping of regula- tory element binding proteins.

To solve the above technical problems, the present invention provides the technical solution as follows:

The present invention provides a method for efficiently en- riching chromatin open region binding proteins. The method in- cludes the following steps: conducting biotin modification and homologous arm addition on a regulatory element formaldehyde assisted isolation of regulatory elements (FAIRE) deoxyribonucleic acid (DNA), so as to obtain a

FAIRE DNA probe; and incubating the FAIRE DNA probe and a protein in vitro, and then conducting DNA pull-down, so as to enrich and obtain the chromatin open region binding proteins.

Preferably, the regulatory element FAIRE DNA is isolated through the following method: adding formaldehyde into a cell synchronized to mitosis for cross-linking, and conducting cell lysis, ultrasonic interruption and phenol/chloroform extraction on a cross-linked product, so as to obtain the regulatory element FAIRE DNA.

More preferably, the cell synchronized to the mitosis is ob- tained by conducting subculture and Nocodazole treatment on a hu- man A549 cell line.

More preferably, the ultrasonic interruption includes condi- tions that 2 s of ultrasonic treatment and 1 s of stopping form a cycle, ultrasonic treatment is conducted for 6 cycles, and an in- terval between every two cycles is 1 min-3 min.

Preferably, before biotin modification and homologous arm ad- dition, library construction, high-throughput sequencing and bio- informatics analysis are conducted on the regulatory element FAIRE

DNA.

Preferably, the biotin modification and homologous arm addi- tion include DNA end filling, addition of “A”, ligation with pMD- 19T, Plasmid-Safe ATP-Dependent DNase treatment, and polymerase chain reaction (PCR) amplification of a target probe.

More preferably, the PCR amplification of a target probe is to use universal primers M13F(-47) and M13R{-48) of a pMD-19T car- rier to conduct amplification, where a 5’ end of the universal primer M13F is modified by biotin.

Preferably, the protein is a human A549 nuclear extract or a whole cell extract.

Preferably, the FAIRE DNA probe and Dynabeads M-280 Streptav- idin are incubated, and then DNA pull-down is conducted.

The present invention further provides an application of the above method in obtaining specific open element binding regulatory proteins.

The present invention provides the method for efficiently en- riching chromatin open region binding proteins. The method is based on formaldehyde assisted isolation and high-throughput de- termination of regulatory elements, takes the FAIRE DNA as the probe, labels the FAIRE DNA with the biotin, and then traps the

FAIRE DNA binding protein through the DNA pull-down method. Based on whole genome open element FAIRE, the present invention achieves an objective of efficiently trapping all regulatory element bind- ing proteins and has low background noise, and 80% or more of trapped proteins are chromatin binding proteins. Tests prove that the method of the present invention has advantages of high enrich- ment efficiency, high reliability, short time, low cost, easy op- eration, etc., and may provide an effective identification means for finding specific open element binding regulatory proteins un- der different treatment conditions.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows measurement results of synchronization efficien- cy of an A549 cell, where A is a mitosis index result and B is a fluorescence activated cell sorting measurement result.

FIG. 2 shows quality evaluations of a formaldehyde assisted isolation of regulatory elements (FAIRE) deoxyribonucleic acid (DNA) library, where A is a quality evaluation of a sample library in interphases (Il, I2), and B is a quality evaluation of a sample library in mitosis (Ml, M2), an abscissa indicating a fragment size, and an ordinate indicating a fluorescence intensity.

FIG. 3 shows a bioinformatics analysis process of FAIRE-seq.

FIG. 4 shows peak output and gene element distribution of the

FAIRE-seq in the interphases and mitosis, where A indicates the interphases (Il, I2) and B indicates the mitosis (M1, M2).

FIG. 5 shows correlation analysis results of FAIRE DNA in the interphases and mitosis, where A is correlation analysis of bio- logical replicate in the mitosis interphases I1 and I2, and B is correlation analysis of biological replicate in the mitosis M1 and

M2.

FIG. 6 shows correlation analysis results of three times of biological replicate of FAIRE DNA binding proteins (FAIRE-mass spectrum (MS)) in the interphases and mitosis, where A is thermal map analysis of the three times of biological replicate in the mi- tosis and mitosis interphases, B shows binding proteins specifi- cally enriched in the mitosis interphases, and C shows binding proteins specifically enriched in the mitosis.

FIG. 7 shows analysis results of proteins (immuno (IM)) shared in the mitosis and mitosis interphases and their gene on- tology (GO) function annotations, where A shows binding proteins enriched by the IM, and B shows function annotations of the bind- ing proteins enriched by the IM.

FIG. 8 shows immunoblotting and immunofluorescence verifica- tion results, where A shows immunoblotting results of three pro- teins MAX, HMGB3 and hnRNP A2/Bl in the mitosis and mitosis inter- phases, and B shows immunofluorescence results of the three pro- teins MAX, HMGB3 and hnRNP A2/Bl in the mitosis and mitosis inter- phases.

DETAILED DESCRIPTION OF THE EMBODIMENTS

The present invention provides a method for efficiently en- riching chromatin open region binding proteins. The method includ- ed the following steps that

Biotin modification and homologous arm addition were conduct- ed on a regulatory element formaldehyde assisted isolation of reg- ulatory elements (FAIRE) deoxyribonucleic acid (DNA), so as to ob- tain a FAIRE DNA probe; and the FAIRE DNA probe and a protein were incubated in vitro, and then DNA pull-down was conducted, so as to enrich and obtain the chromatin open region binding proteins.

In the present invention, the regulatory element FAIRE DNA was preferably isolated through the following method that formal- dehyde was added into a cell synchronized to mitosis for cross-

linking, and cell lysis, ultrasonic interruption and phe- nol/chloroform extraction were conducted on a cross-linked prod- uct, so as to obtain the regulatory element FAIRE DNA. In the pre- sent invention, the cell synchronized to the mitosis was prefera- 5 bly obtained by conducting subculture and Nocodazole treatment on a human A549 cell line. In the present invention, the ultrasonic interruption preferably included conditions that 2 s of ultrasonic treatment and 1 s of stopping formed a cycle, ultrasonic treatment was conducted for 6 cycles, and an interval between every two cy- cles was 1 min-3 min. In the present invention, under the ultra- sonic conditions, high-purity mitotic cells may be obtained, so as to facilitate subsequent obtaining of high-quality FAIRE DNA.

In the present invention, before biotin modification and ho- mologous arm addition, library construction, high-throughput se- quencing and bioinformatics analysis were preferably conducted on the regulatory element FAIRE DNA. In the present invention, a li- brary construction method was preferably based on a library con- struction method of the Illumina Company. A sequencing platform was preferably Hi-seq 2500, and a sequencing mode was preferably a single-end 50 mode.

In the present invention, the biotin modification and homolo- gous arm addition included DNA end filling, addition of “A”, liga- tion with pMD-19T, Plasmid-Safe ATP-Dependent DNase treatment, and polymerase chain reaction (PCR) amplification of a target probe.

In the present invention, the PCR amplification of a target probe was to use universal primers M13F{(-47) and M13R(-48) of a pMD-19T carrier to conduct amplification, and a 5’ end of the universal primer M13F{-47) was preferably modified by biotin; a nucleotide sequence of the universal primer M13F(-47) was CGC CAG GGT TTT CCC

AGT CAC GAC(SEQ ID NO.1l); a nucleotide sequence of the universal primer M13R(-48) was AGC GGA TAA CAA TTT CAC ACA GGA(SEQ ID NO.2).

In the present invention, the target probe was the FAIRE DNA probe, two ends of the FAIRE DNA probe were provided with the uni- versal primers, and the middle of the probe was provided with the

FAIRE DNA. In the present invention, the FAIRE DNA probe had enough space to be combined with beads, such that combination ef- ficiency of the probe and the beads and reliability of pull-down experiment trapping may be improved.

In the present invention, the protein was human A549 nuclear extract (NE) or whole cell extract (WCE). The present invention did not particularly limit a method for extracting the NE and WCE, such that conventional protein extraction methods in the field may be used. In the present invention, the FAIRE DNA probe and Dyna- beads M-280 Streptavidin were incubated, and then DNA pull-down was conducted.

To make the objectives, technical solutions and advantages of the present invention more obvious, the present invention will be described in detail below in conjunction with the examples, but the examples are not to be construed as limiting the scope of pro- tection of the present invention.

Unless otherwise specified, the following examples are con- ventional methods.

Unless otherwise specified, materials, reagents, etc. used in the following examples can be obtained from commercial sources.

Example 1 (I) Separation of FAIRE elements

Frozen human A549 cells were melted in a water bath at 37°C, then 1000 g of the cells were centrifuged at a room temperature for 5 min, were gently blown with a DMEM/F12 culture medium con- taining 10% of fetal bovine serum so as to achieve uniform suspen- sion, and then were added into a 15 cm cell culture dish, culture was conducted in a 5% CO; incubator at 37°C, liquid was changed 2 times-3 times during a week, and when the cells in the culture dish grew to a density of 80%-90%, the cells were subcultured ac- cording to a ratio of 1:3.

When the cells grew to 60%-70% of the whole culture dish, the culture medium was change to a fresh culture medium, and Noco- dazole having a final concentration of 50 ng/ml was added to con- duct treatment for 10 h-12 h. In this case, it may be found by an electron microscope that after Nocodazole treatment, about 40%-50% of the cells changed from adherent to suspended, and the part was synchronized to the mitotic cells.

The obtained A549 mitotic cells were subjected to mitosis in- dex (MI) and fluorescence activated cell sorting (FACS) measure- ment, and results were shown in FIG. 1.

It may be seen that the mitotic cells account for 95% or more of the total number of cells in the whole field of vision. Through quantitative measurement by a flow cell sorter, it may be found that 97.42% of the cells were mitotic cells. The results showed that the high-purity A549 mitotic cells were obtained, which pro- vided a reliable guarantee for subsequent isolation and identifi- cation of mitotic regulatory elements.

Example 2

FAIRE experiment 1, Reagent:

Lysis buffer A: 10 mM Tris-Cl (pH8.0), 2% (v/v)Triton X-100, 1% sodium dodecyl sulfate (SDS), 100 mM NaCl, and 1 mM ethylene diamine tetraacetic acid (EDTA). 2, Experimental process: 1) Cells synchronized to mitosis were counted, and 1x10’ cells were used in one FAIRE experiment. 2) 37% of a formaldehyde solution was added to make a final concentration 1%. 3) Uniform mixing was conducted at a room temperature, and cross-linking and fixing were conducted for 5 min. 4) 2.5 M glycine was added to make a final concentration 125 mM, so as to stop formaldehyde cross-linking. 5) Uniform mixing was conducted at a room temperature, and stopping was conducted for 5 min. 6) The cells were collected into a 50 mL Corning centrifuge tube. 7) 300 g-500 g of cells were centrifuged at 4°C for 5 min to collect fixed cells, and supernatant was carefully poured. 8) Cell precipitate was washed with sterile 1xPBS 3 times. 9) The cells were collected into a 1.5 mL sterile eppendorf (EP) tube. 10) The following operations were continued, and alternative- ly, the cells were frozen at -80°C.

11) 1 mL of lysis buffer A and a 50x protease inhibitor (hav- ing a total concentration 1x) were added into the EP tube, and ly- sis was conducted for 10 min on ice. 12) A lysed sample was placed on ice, and ultrasonic treat- ment was conducted under an ultrasonic instrument. 13) a parameter of the ultrasonic instrument to was set as 35% power, and ultrasonic treatment was conducted for 1 min-3 min according to a rule of 30 s (2 s, 1 s). 3, Purification and evaluation of control internal reference

DNA: 1) 100 pL of each of products under different ultrasonic time was taken (the product was the control internal reference DNA). 2) 15000 g-20000 g of products were centrifuged at 4°C for 5 min so as to precipitate cell fragments. 3) Supernatant was transferred to a new 1.5 mL centrifuge tube. 4) 1 pL of DNase-free RNase A(10 mg/mL) was added, and incu- bation was conducted at 37°C for 30 min-45 min. 5) 1 pL of protease K (20 mg/mL) was added, incubation was conducted at 55°C for 1 h, and then the liquid was transferred to be subjected to de-cross-linking at 65°C overnight. 6) A product de-cross-linked overnight was centrifuged at a room temperature for a short time, and then 200 pL of 10 mM Tris-

Cl (pH 7.4) was added to make the total volume 300 pL, si as to ensure full suspension of the de-cross-linked product. 7) 300 pL of a phenol/chloroform/iscamyl alcohol (25:24:1) solution was added. 8) After up-down reversal and mixing, 12000 g of the liquid was centrifuged at a room temperature for 5 min. 9) A water phase was transferred to a new 1.5 mL centrifuge tube. 10) the equal volume of chloroform was added. 11) After up-down reversal and mixing, 12000 g of the liquid was centrifuged at a room temperature for 5 min. 12) A water phase was transferred to a new 1.5 mL centrifuge tube. 13) A 1/10 volume of 3M NaAc (pH 5.2) and 1-1.2 times volume of isopropanol and 1 pL of 20 mg/mL glycogen were added into a new 1.5 mL centrifuge tube. 14) Settlement was conducted at -80°C for 30 min or over- night. 15) 12000 g of the liquid was centrifuged at 4°C for 20 min to precipitate a DNA product. 16) 500 pL of 70% precooled ethanol was added into DNA pre- cipitate, and precipitate was washed. 17) 12000 g of the liquid was centrifuged at 4°C for 5 min. 18) Supernatant was discarded carefully, and a DNA precipi- tate product was retained. 19) A cover of an EP tube was opened, air-drying was conduct- ed at a room temperature for 10 min-20 min, and then 20 pL of

Tris-Cl (pH 7.4) was added to dissolve the DNA precipitate. 20) 1 pL of each product was taken for quantification under

NanoDrop. 21) 1.0% agarose gel was prepared, 500 ng of DNA products were added, and FAIRE DNA samples were prepared under the condi- tion that 2 s of ultrasonic treatment and 1 s of stopping formed a cycle, each cycle included 1 min of ultrasonic treatment, ultra- sonic treatment was conducted for 6 cycles for 6 min, and an in- terval between every two cycles was 1 min. 3, Preparation of FAIRE DNA 1) An ultrasonic lysed product after ultrasonic time in 21) of Step 2 was distributed into a 1.5 mL centrifuge tube, with each centrifuge tube containing liquid of 500 pL or below. 2) 15000 g-20000 g of products were centrifuged at 4°C for 5 min so as to precipitate cell fragments. 3) Supernatant was transferred to a new 1.5 mL centrifuge tube. 4) The equal volume of phenol/chloroform/isoamyl alcohol (25:24:1) solution was added. 5) After up-down reversal and mixing, 12000 g of the liquid was centrifuged at a room temperature for 5 min. 6) A water phase was transferred to a new 1.5 mL centrifuge tube. 7) the equal volume of chloroform was added.

8) After up-down reversal and mixing, 12000 g of the liquid was centrifuged at a room temperature for 5 min. 9) A water phase was transferred to a new 1.5 mL centrifuge tube. 10) A 1/10 volume of 3M NaAc (pH 5.2) and 1-1.2 times volume of isopropanol and 1 uL of 20 mg/mL glycogen were added into a new 1.5 mL centrifuge tube. 11) Settlement was conducted at -80°C for 30 min or over- night. 12) 12000 g of the liquid was centrifuged at 4°C for 20 min to precipitate a DNA product. 13) 500 pL of 70% precooled ethanol was added into DNA pre- cipitate, and precipitate was washed. 14) 12000 g of the liquid was centrifuged at 4°C for 5 min. 15) Supernatant was discarded carefully, and a DNA precipi- tate product was retained. 16) A cover of an EP tube was opened, air-drying was conduct- ed at a room temperature for 10 min-20 min, and then 50 pL of

Tris-Cl (pH 7.4) was added to dissolve the DNA precipitate. 17) 1 pL of DNase-free RNase A (10 mg/mL) was added into the

EP tube, and incubation was conducted at 37°C for 30 min-45 min. 18) 1 pL of protease K (20 mg/mL) was added, incubation was conducted at 55°C for 1 h, and then the liquid was transferred to be subjected to de-cross-linking at 65°C overnight. 19) The de-cross-linked product was purified by means of a

QIAgquick PCR purification kit. 20) 20 pL-30 pL of Tris-Cl (pH 7.4) eluent was added. 21) 1 pL of each product was taken for quantification under

NanoDrop. 22) A yield of the FAIRE DNA was computed according to the

FAIRE DNA and the control internal reference DNA. An ideal yield of the FAIRE DNA was 1%-3%. If the yield was about 5%, it indicat- ed that formaldehyde cross-linking was insufficient, and cross- linking time needs to be determined again. 4, Preparation of a FAIRE DNA high-throughput sequencing 1li- brary

End filling of FAIRE DNA

1) Large-fragment Klenow polymerase was diluted to 1 p/uL (1:5). 2) An end filling system (50 pL} was involved.

FAIRE DNA 10 nL{100 ng) 10xT4 DNA ligase buffer 5 pL mM of dNTP 2 pL

T4 DNA polymerase 1 pL

Klenow polymerase 1 pL

T4 polynucleotide kinase 1 pL 10 ddH:0 30 pL 3) Reaction was conducted at 20°C for 30 min. 4) Purification was conducted by means of a QIAGEN QIAquick

PCR purification kit, and an elution volume was 34 pL.

End filling of FAIRE DNA and “A” addition 1) An “A” addition system (50 uL) was involved.

FAIRE DNA 34 pL 10x NEB2 buffer 5 pL dATP (1 mM) 10 pL

Klenow fragment (3'-5'" exo-) 1 pL 2) Reaction was conducted at 37°C for 30 min. 3) Purification was conducted by means of a QIAGEN MinElute

PCR purification kit, and an elution volume was 9 pL.

Ligation between adaptor and a dA- end 1) A ligation system (25 pL) was involved.

FATRE DNA 9 pL 2x fast ligase buffer 12.5 pL

Adaptor mixture (diluted according to 1:20) 1 pL

DNA fast ligase 2.5 pL 2) Reaction was conducted at 22°C for 15 min. 3) Purification was conducted by means of a QIAGEN MinElute

PCR purification kit, and an elution volume was 10 pL.

Cutting and recovery of FAIRE DNA added with adaptor 1) 10 pL of FAIRE DNA added with adaptor was added into 6xloading buffer, and uniform mixing was conducted. 2) 2% agarose gel was prepared and subjected to electrophore- sis at 100 V for 60 min. 3) FAIRE DNA-adaptor was cut and recovered.

4) Purification and recovery were conducted by means of a QI-

AGEN MinElute gel recovery kit, and an elution volume was 10 pL.

PCR amplification of a FAIRE DNA library 1) A PCR reaction system (50 pL) was involved.

FATRE DNA 10 pL 5x Phusion buffer 10 pL

PCR primer 1 1 pL

PCR primer 2 1 pL

Phusion polymerase 0.5 pL ddH:0 27.5 pL

A sequence of the PCR primer 1 was AATGATACGGCGACCACCGA-

GATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO.3).

A sequence of the PCR primer 2 was CAAGCAGAAGACGGCATACGAGATA-

CATCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO.4). 2) Amplification conditions included: 98°C, 30 s; 18 cycles (98°C, 10 s; 65°C, 30 s; 72°C, 30 s); 72°C, 5 min; and heat preservation at 4°C. 3) Purification was conducted by means of a QIAGEN MinElute

PCR purification kit, and an elution volume was 20 pL.

The isolated FAIRE DNA was subjected to library construction and quality control analysis. Through preliminary quality control analysis after library construction, it may be found that a frag- ment size was distributed in a range of 200 bp-500 bp after se- quencing adaptor addition and universal primer amplification.

Then, four samples in two constructed groups were subjected to deep quality evaluation before high-throughput sequencing, and re- sults were shown in FIG. 2.

It may be seen that peak values of fragment sizes of two sam- ples I1 (interphase 1) and I2 {interphase 2) in the interphases and two samples M1 (mitosis 1) and M2 (mitosis 2) in the mitosis are all around 270 bp, with a narrow peak width and a single peak value, which indicated that quality of database construction was ideal.

The FAIRE DNA with the constructed library was transferred to the Suzhou Genewiz Biotechnology Co., Ltd. for high-throughput se- quencing with a Hi-seqg 2500 high-throughput sequencing platform.

The high-throughput sequencing platform was Hi-seq 2500, and a single-end (SE) 50 mode was selected for sequencing. After se- quencing, the four samples Il, I2, Ml and M2 were subjected to quality evaluation, and results were shown in Table 1.

Table 1 FATRE-seq data output result

Sample Yield (Mbases) Reads % of >=Q30 Bases (PF} Mean Quality score {PF}

Interphase 1 3525 59,119,464 96.6 38.01

Interphase_2 3222 63,174,601 96.7 38.05

Mitosis_1 2187 42,868,345 96.6 38.08

Mitosis_2 2176 42,880,033 96.5 38.08

It may be seen that reads numbers of Il and IZ were both more than 60 M, and reads numbers of Ml and M2 were greater than 40 M, and data generated through biological replicate were equivalent.

In the present invention, Q30 of the FAIRE-seq sequencing result may reach 96% or above, which indicated that reliability of base recognition was very high and the sequencing result was reliable. 5, Bioinformatics analysis of FAIRE-seq

As shown in FIG. 3, an analysis process mainly included:

Quality evaluation of sequencing data: base calling was con- ducted on sequencing results, preliminary quality analysis was conducted, and Trimmomatic (v0.3), the second-generation segquenc- ing data guality statistical software, was used to remove low- quality and adaptor sequences. The quality evaluation included the following steps that primer and adaptor seguences were removed; unpaired reads were removed; sites with mass values of a 3' end and a 5’ end smaller than 20 were removed, and reads with reads lengths smaller than 75 bp were removed; and unrecognized fuzzy bases were removed.

A clean sequence was compared with a reference genome, bow- tie? (version 2.1.0) was used to combine paired and unpaired reads, a single mode was used for comparison, and information of a

FAIRE-seq data enriched region was counted. Results were shown in

FIG. 4.

It may be seen that in distribution of open regulatory ele- ments, compared with the interphases, some elements are retained in the mitosis, and a promoter region was significantly reduced; and an intergenic region was retained, especially repetitive ele-

ments increased obviously.

Meanwhile, correlation analysis of Il and I2, and M1 and M2 was conducted, and results were shown in FIG. 5.

It may be seen that correlations between Il and I2 and be- tween M1 and M2 were very ideal, which provided an important guar- antee for the next high-quality probe preparation.

Example 3 1, Preparation of a FAIRE DNA probe

A DNA probe preparation process included: DNA end filling, addition of “A”, ligation with pMD-19T, Plasmid-Safe ATP-Dependent

DNase treatment, and PCR amplification of a target probe. 1.1 End filling of DNA 1) Large-fragment Klenow polymerase was diluted to 1 u/uL (1:5). 2) An end filling system (50 pL) was involved.

FAIRE DNA 10 pL (100 ng) 10xT4 DNA ligase buffer 5 pL 10 mM of dNTP 2 pL

T4 DNA polymerase 1 pL

Klenow polymerase 1 pL

T4 polynucleotide kinase 1 pL ddH:0 30 uL 3) Reaction was conducted at 20°C for 30 min. 4) Purification was conducted by means of a QIAGEN QIAquick

PCR purification kit, and an elution volume was 34 pL. 1.2 End filling of DNA and “A” addition 1) An “A” addition system (50 pL) was involved.

FATRE DNA 34 pL 10xNEBZbuffer 5 pL dATP (1 mM) 10 pL

Klenow fragment (3'-5" exo-) 1 pL 2) Reaction was conducted at 37°C for 30 min. 3) Purification was conducted by means of a QIAGEN MinElute

PCR purification kit, and an elution volume was 10 pL. 1.3 Ligation with pMD-19T 1) A ligation system (50 pL) was involved.

FATRE DNA 10 pL

10xT4 DNA ligase buffer 5 pL pMD-18T 5 pL

T4 DNA ligase 1 pL ddH,0 29 uL 2) Ligation and reaction were conducted at 16°C for 4 h. 3) Purification was conducted by means of a QIAGEN QIAquick

PCR purification kit, and an elution volume was 34 pL. 1.4 Plasmid-Safe ATP-Dependent DNase treatment 1) A treatment system (50 pL) was involved.

PMD/ FAIRE DNA-19T 34 pL 10xPlasmid-Safe DNase buffer 5 pL 25 mM ATP (a final concentration of 1 mM) 2 pL

DNase 2 pL ddH.0 7 nL 2) Reaction was conducted at 37°C for 30 min. 3) Purification was conducted by means of a QIAGEN MinElute

PCR purification kit, and an elution volume was 10 pL. 1.5 PCR amplification of a target probe

After the pMD-19T was ligated with the FAIRE DNA, universal primers M13F(-47) and M13R(-48) on a carrier were used to conduct amplification so as to obtain a DNA probe with universal primers at both ends and FAIRE DNA in the middle, and a 5’ end of the uni- versal primer MI3F(-47) was labeled with biotin. The specific steps were as follows: 1) A PCR amplification system (1 mL) was involved. 10xEx-Taqg buffer 100 HL dNTP (2.5 mM) 80 pL bio-M13F(-47) 20 pL

M13R (-48) 20 uL

PMD/FAIRE DNA-19T 10 pL

Ex-Taq polymerase 5 pL ddH:0 765 pL 2) 98°C, 2 min; 18 cycles (98°C, 30 s; 60°C, 30 s; 72°C, 20 sg); 72°C, 5 min; and heat preservation at 4°C. 3) the 1/10 volume of 3M NaAc (pH5.2), the equal volume of isopropanol and 1 pL of glycogen (20 mg/mL) were added to a PCR product, and precipitation was conducted at -80°C for 30 min or overnight. 4) 12000 g of the liquid was centrifuged at 4°C for 20 min to precipitate a DNA product. 5) 500 pL of 70% precooled ethanol was added into DNA precip- itate, and precipitate was washed. 6) 12000 g of the liquid was centrifuged at 4°C for 5 min. 7) Supernatant was discarded carefully, and a DNA precipitate product was retained. 8) A cover of an EP tube was opened, air-drying was conducted at a room temperature for 10 min-20 min, and then 50 pL of ddH:0 was added to dissolve the DNA precipitate. 9) 6xloading buffer was added into 50 pL of the system. 10) 1% agarose gel was prepared and subjected to electropho- resis at 100 V for 30 min. 11) Cutting was conducted in a fragment range of 250 bp-400 bp. 12) Purification and recovery were conducted by means of a

QIAGEN MinElute gel recovery kit, and an elution volume was 15 pL {ddH;0 dissolution). 13) 1 pL of each product was taken for quantification under

NanoDrop. 2, Extraction of nuclear extract (NE) and whole cell extract (WCE) 2.1 For the extraction of the NE, reference was made to a method for extracting NE from obtained A549 interphase cells by

Liu et al., 2012 as follows:

NE extraction buffer: hypotonic buffer: 10 mM Tris-Cl pH 7.3, 1.5 mM MgCl,, 10 mM

KCl; low salt buffer: 20 mM Tris-Cl pH 7.3, 1.5 mM MgCl:, 20 mM

KCl, 0.2 mM EDTA, 25% glycerol; high salt buffer: 20 mM Tris-Cl pH 7.3, 1.5 mM MgCl:, 1.2 M

KCl, 0.2 mM EDTA, 25% glycerol; and

BC-150: 20 mM Tris-Cl pH 7.3, 150 mM KCl, 0.2 mM EDTA, 20% glycerol.

Before use, a protease inhibitor and 1 mM of PMSF were added into each buffer.

1) The obtained cells were dissolved in a 10x volume of hypo- tonic buffer, and placed on ice for 10 min. 2) 1000 g of liquid was centrifuged at 4°C for 15 min, and cell membrane lysis of cell pellets was accelerated 15 times by means of a dounce homogenizer. 3) 4000 g of liquid was centrifuged at 4°C for 5 min to iso- late cytoplasmic components from nuclear components. 4) Precipitated nuclear components were resuspended in 0.5 time volume of low salt buffer, and nuclear lysis was accelerated 10 times by means of the dounce homogenizer. 5) A general total volume of high salt buffer was added, and uniformly mixed, which was beneficial to release of nuclear pro- teins. 6) A mixer was shaken slowly at 4°C for 30 min, and then 25000 g of product was centrifuged for 20 min. 7) NE was in the supernatant, and dialyzed at 4°C for 1 h, and buffer was replaced with BC-150. 8) NE was packed and frozen at -80°C for later use, so as to avoid repeated freezing and thawing. 2.2 Extraction of WCE

A formula of Western and IP cell lysate refers to the website of Beyotime company. 1) The Western and IP cell lysate was melted and mixed up and down, 1 mL of the liquid was taken, and the protease inhibitor and 1 mM of PMSF were added. 2) 300 g-500 g of A549 cells synchronized to the mitosis were centrifuged at 4°C to remove a culture medium, and washed with 1xPBS 2 times-3 times. 3) 1 mL of lysate prepared in advance was added, and blowing and mixing were conducted with a pipette. In order to prevent in- complete lysis, a sample was mixed with a mixer at 4°C for about 30 min. 4) 20000 g of completely-lysed cell products were centrifuged at 4°C for 15 min to remove cell fragments. 5) WCE was packed and frozen at -80°C for later use, so as to avoid repeated freezing and thawing. 3, In-vitro DNA pull-down experiment

3.1 DNA pull-down experiment reagent

NETN buffer: 20 mM Tris-Cl pH8.0, 50 mM NaCl, 1 mM EDTA, 0.5%

NP-40 2xB&W buffer: 10 mM Tris-Cl pH7.5, 1 mM EDTA, 2M Nacl 3.2 DNA pull-down experiment steps: 1) M280 Streptavidin beads were placed on a magnetic frame for 1 min-2 min, and a beads stock solution was removed. 2) Beads were suspended with 1xB&W buffer, and the beads were washed. 3) Step 2 was repeated twice, that is, conducted three times in total. 4) A biotin-labeled probe (dissolved in water) was taken, and 2xB&W buffer was added to adjust a concentration of NaCl to 1 M, that is, 1xB&W buffer. 5) The biotin-probe was added into pre-treated beads, and in- cubation was conducted at a room temperature for 15 min. 6) The beads were put back on the magnetic frame, and the su- pernatant was sucked out. 7) The beads were washed once with the Western and IP cell lysate. 8) Western and IP cells containing 1.0% BSA and 0.5 mg/ml

Sperm DNA were lysed, added into the beads of the EP tube, and sealed overnight at 4°C. 9) WCE was added into the beads, fully mixed with beads, and gently incubated at 4°C for 2 h. 10) The supernatant was taken out, and the beads were washed with NETN twice, and then washed with 1xPBS three times; 11) 20 pl of 1xSDS loading buffer was added into the beads, and treatment was conducted at 95°C for 5 min. 12) Reference: mass spectrometry protein sample treated parts were treated. 4, Mass spectrometry protein sample treatment and data output and analysis

Mass spectrometry protein sample treatment 1) Reduction of disulfide bonds: heating was conducted at 56°C for 30 min at a final concentration of 10 mM DTT, after the sample was cooled, iodoacetamide (IAA) having a final concentra-

tion of 30 mM was added, treatment was conducted in darkness for 30 min, and cysteine in the sample was amidated. 2) Settings of electrophoresis conditions: 12% SDS-PAGE gel was prepared, a treated sample was added into a gel hole, 80 V was initially set for electrophoresis, then the sample entered concen- trated gel, and after the sample entered isolated gel, voltage was adjusted from 80 V to 140 V step by step, with an isolation length between 5 cm and 8 cm. 3) Dyeing was conducted with Coomassie Brilliant Blue for 30 min, decolorizing was conducted with a decolorizing solution until clear spots appeared, and an image was scanned with a scanner. 4) In-gel enzymolysis: according to a molecular weight and abundance of proteins in the sample, the gel was cut and digested, where each group of samples were divided into 5-8 fractions, cut into 1mm3 cube colloidal particles, and shaken and decolorized in the decolorizing solution (50%ACN+50 mM NH4HCO3) until a colorless effect was achieved. Then the colloidal particles were washed with pure acetonitrile, and then dried in a vacuum dryer for about 10 min. The dried colloidal samples were digested in a trypsin enzyme solution having a final concentration of 10 ng/uL at 37°C over- night. The next day, in an extraction solution (5%FA+50%ACN), pep- tide fragments were extracted, and the sample was dried. 5, Data output

The peptide fragments obtained from each group were analyzed on a high-throughput and high-depth proteome sequencing platform.

The platform included nano-UPLC (Waters Acguity)-MS/MS (Thermo

Fisher Scientific, LTQ Orbitrap Velos}, which made full use of isolation capability of ultra-high pressure liquid chromatography and fast scanning capability of high-precision mass spectrometry.

Each group of samples were strictly subjected to parallel tests, and subsequent label-free was used for quantitative comparison.

A peptide sample was dissolved in a dissolving solution (12FA+13CAN), and the same volume of sample was taken for mass spectrometry analysis. A chromatographic column is a 15 cm self- contained capillary column (a C18 column having 360 pm outer diam- eter * 75 pm inner diameter and 3 pm fused-silica as packing), ef- fective analysis time was 60 min-80 min, a liquid phase gradient was from 98%A (2% ACN+4+0.1% FA in water) to 35%B (0.1% FA in ACN), and a flow rate was 300 nL/min. Mass spectrum data was collected in a DDA mode, and a full MS spectrum (m/z = 300-1600) was col- lected in Orbitrap with a resolution of 30000, AGC of 1E6 and MIT of 150 ms; and a second-order spectrum uses a CID fragmentation mode, and the top 20 having highest abundance were selected for second-order fragmentation, with AGC of 1E4 and MIT of 25 ms. The minimal signal threshold was set as 2000, and dynamic exclusion was set as 50 s. The detected parent ion cannot scan the same ion repeatedly within 50 s, so as to increase a sequencing depth. The subsequent MaxQuant was used for data identification and label- free quantification. 6, Proteome data analysis

For mass spectrometry data generated by each group of sam- ples, MaxQuant (1.4.1.2) was used for identification and label- free quantification. Carbamidomethylation of amino acid Cys was set as a fixed modification, a variable modification was acetyla- tion of N-end of a protein, and amino acid Met had an oxidation modification. For trypsin full digestion, a maximum missing re- striction site was set as 2. During first database retrieving, a parent ion error was set as 20 ppm, and during second database re- trieving, a parent ion error was set as 6 ppm. A secondary frag- ment ion error was set as +0.5 Da. Quantitative data was quanti- fied by unique+trazor, with at least two quantitative peptide frag- ments. A label-free quantitative strategy was used, iBAQ was taken as a quantitative basis, matching of each group of samples was conducted through match between runs, and positive identification results and quantitative accuracy were effectively increased. 7, Bioinformatics analysis of proteomics data

According to requirements of the experiment, the following software was mainly used for bioinformatics analysis in the fol- low-up analysis.

Firstly, correlation analysis of three times of biological replicate in the interphases and mitosis was conducted, and re- sults were shown in FIG. 6 below.

It may be seen from the figure that the interphases and mito- sis were highly correlated, and proteins enriched in the inter-

phases and mitosis had characteristics of cell cycles.

A gene ontology (GO) biological process, a molecular function and cell components of an identified protein were annotated by

Blast? GO software (Conesa and Gotz, 2008) or DAVID(Huang et al, 2009). Then, according to a gi or sp number of the protein and a

NCBI website, a sequence of related proteins was retrieved, and a fasta. file was downloaded. At last, MEME Suite (4.10.0) (Timothy et al., 2009) was used to retrieve the same motif of the protein.

Finally, a specific protein function obtained was further ana- lyzed. It may be found that there were 186 proteins retained in the mitosis, and through GO function annotation analysis, it was indicated that most of the proteins were related to nucleic acid binding and were a kind of regulatory proteins, which further con- firmed that the proteins trapped by the FAIRE probe were open chromatin binding proteins. Results were shown in FIG. 7.

Example 4

The following experiments were used to verify credibility of binding of a FAIRE DNA probe, and specific steps were as follows:

I, Immunoblotting verification step: 1. SDS-PAGE gel was prepared. 2. A PVDF membrane was immersed in methanol for about 10 s, then the membrane was transferred to a membrane transfer solution, and filter paper was put in the membrane transfer solution. 3. Semi-dry transfer was used, and filter paper, a membrane,

PAGE gel, and filter paper were placed in a film transfer instru- ment from bottom to top. 4. 15 V and 70 min were set. 5. After membrane transfer, the membrane was transferred to a prepared milk sealing solution, and sealed for 1 h-2 h, so as to remove nonspecific protein binding. 6. Primary antibodies (diluted with a milk sealing solution) were added at a ratio of 1:500-1:1000, and slow shaking and incu- bation were conducted at 4°C overnight. 7. The membrane was taken out of a primary antibody sealing solution, and washed with 1xTBST 6 times-7 times, each time last- ing 7 min, so as to wash off unbound antibody on the membrane. 8. Second antibodies were diluted according to a ratio of

1:3000-1:5000 (also diluted with a milk sealing solution), and in- cubation was conducted at a room temperature for 1 h-2 h. 9. The membrane was taken out of a second antibody sealing solution, and washed with 1xTBST 6 times-7 times, each time last- ing 7 min, so as to wash off unbound antibody on the membrane. 10. Development was conducted, membrane developing solutions

A and B were prepared according to a ratio of 1:1, and then uni- formly applied onto the membrane, reaction was conducted in dark- ness for about 2 min, and the membrane was put into a WB developer for development. Generally, according to a protein concentration, development was conducted for 1 min-5 min. 11. Experimental results were analyzed.

According to an immunoblotting experiment, three proteins

MAX, HMGB3 and hnRNP A2/Bl were almost completely retained in the mitosis, specifically bound and partially retained in the mitosis, which preliminarily confirmed reliability of mass spectrometry re- sults.

II, Immunofluorescence verification step: 1, A slide with climbed cells was immersed with PBS in a cul- ture plate 3 times, each time lasting 3 min. 2, The slide was fixed with 4% paraformaldehyde for 20 min, and the slide was immersed with PBS 3 times, each time lasting 5 min. 3, 0.5% Triton X-100 (prepared by PBS) was transparent at a room temperature for 20 min. 4, The slide was immersed with PBS 3 times, each time lasting 5 min, PBS was absorbed with absorbent paper, normal goat serum was dripped on the slide, and sealing was conducted at a room tem- perature for 30 min. 5, Sealing liquid was absorbed with absorbent paper, washing was not conducted, a sufficient amount of diluted primary antibod- ies were dripped onto each slide, the slide was put in a wet box, and incubation was conducted at 4°C overnight. 6, Fluorescent second antibodies were added: the slide was immersed with PBST 3 times, each time lasting 5 min, after excess liquid on the slide was absorbed by absorbent paper, diluted fluo- rescent second antibodies were dripped, incubation was conducted in a wet box at 37°C for 1 h, and the slide was immersed with PBST 3 times, each time lasting 5 min. Note: from the time of adding the fluorescent second antibodies, all the subsequent operation steps should be conducted in a dark place as far as possible. 7, A nucleus was redyed: DAPI was dripped, incubation was conducted in darkness for 5 min, a nucleus of a specimen was dyed, and excess DAPI was washed out with PBST 5minx4 times. 8, Liquid on the slide was absorbed with absorbent paper, the slide was sealed with sealing liquid containing anti-fluorescence quencher, and then a collection chart was observed under a fluo- rescence microscope. Results were shown in FIG. 8.

It may be seen that the three proteins MAX, HMGB3 and hnRNP

A2/Bl verified by the present invention are all bound to chromo- somes in the mitosis, which indicates that the proteins are indeed bound to the chromosomes in the mitosis, and at the same time, re- liability and universality of the results of the method are strongly confirmed.

The above descriptions are merely examples of the present in- vention and do not limit the patent scope of the present inven- tion, and equivalent structure or equivalent process change made by using contents of the description in the present invention and used directly or indirectly in other related technical fields shall all fall within the scope of protection of the present in- vention in a similar way.

i “bam varsLon=sl an sncoing="UrNsS8n tn <!DOCTYPE ST26SeguenceListing PUBLIC "-//WIPO//DTD Sequence Listing 1.3//EN" "ST26SequenceListing V1 3.dtd"> 2 <“ST26Sequencelisting JldVearnion=NNi 3 Jil anare="IVNPR0EII0L Td saqiist., mln softwaseMane= "WIRD Sagquanae’ scinpersVoernsion="g 8.0% pocductionlana=rAQa3-02-08" ä <ApplicaentFileRefserence>JYXP20221101374/ApplicantFileReference> <ApplicantNeme Langoegeccie=*en">Academy of Military Medical

Sciences</ApplicantName>

Z <inventleonTitle language lods=Yan®>METHOD FOR EFFICIENTLY ENRICHING CHROMATIN

OPEN REGION BINDING PROTEINS AND APPLICATION THEREOF/InventionTitiex» 3 <SequenceTotaiguantity>4</SeguenceTotalguantity> 2 <Sequencalata sequencernNumber=NLN> & CINIDSeq>

ERS <INSDZeq length>24</INSDSeq lengths

Eh <IMEDZeq moliype>DNA</INSDSeqg moltyper

Ld <INSDSeq division>PAT4/INSDSeg division

LS “INSDSeq fealure-table>

Le LINSDFeature:» ih <INSDFeature key>source</INSDFeature key» id <INSDFeature location»l..24</INSDFeature location»

Lj <INSDFeature guals> ijn <INSDQualifier> 18 <INSDQualifier namermol type</INSDQualifier name> a <INSDOualifier valuerother DNA4/INSDQualilfier value» 2% <SINSDOualifier> ze <INSDQualifler in=Ng3N> 23 <INSDQualifier name>note</INSDQualifier name> 24 <INSDQualifier value>Primer

ML3F(-47) </IN3Doualifier valuer 2% </INSDQualifisan» u 28 <INSDQuaiifler id=vgays a CINMEDOualifier namerorganism</INSDQualifier name wd CINZDQualifiler value>synthetic construct /INSDGuali fier value» </INSDQualifier> u 24 </INSDFeature guals>

Di x“/INSDFeacturex == 32 </INSDSeg feature-tabled> 33 <INSDSeq seguenceregccagggttttcccagtcacgac</INSDSeg sequencer 34 </INSDSeg> u 35 <j Gaemquencebata> 346 <Gequencelala segquenceliNuubsc=tg>

Sj <IiNSsDseqd>

IR <INSDSeq iength>24</INSDSeq length> 23 <INSDSeg moltype>DNA-/INSDSeg moliyper <INSDSeg division>PAT</INSDSeq division» aL <INSDSeq feature-table> 4 <INSDFeature> 43 CINEDFeature keyvsource</INSDFeature key» dil “INSDFeabture locabtion>l..24</INSDFeature location» £8 <INSDIesture guals> zò SINSDOualifier>

Ea <INSDQualifler named>mol type</INSDRualifizp names 44 <INSDQualifier valuerother DNA //INSDGualifler value» </INSDQuali fier!» 54 CINSDQualifler id='g8N2>

LL <INSDOualifier namernotes/INSDQuali fier name>

Dd <INSDQualifier value>Primer

M13R(-48)</INSDGualifier value» 52 </INSDQualifier> u

Bd CINSZDOualifler id="g5r>

BH <INSDGualifier namerorganism</INSDQualifisr name>

SE <INSDQualifier valuersynthetic construct</INSDQualifier value> nT <SINSDOualifier>

Na </INSDFeature duels» 53 </INSDFeature> ohn </INSD8eq featura-tabler

Gi <INSDSeq zeguencs>rageggataacaatttcacacagga/INSDSet sequencer 82 </INSDSeg> Ĳ &3 </SegusncsDara> eh <Segquencebalta seguantaliliicghar=n3ns

£5 CINSDSag» <INSDSeq length»58</INSDSeg length» 7 <INSDSeq moltype>DNA/INSDSeg moliype> an <INSDSeq divislon»>PATC/INSDSeg divisions

Lo <INSDSeq feature-takbled

TO CINSDFeabure>

Th <INEDFeature key>source:/INSDFeature kKey> <INSDFeature Iscation>»l..58</INSDFealure location

Fs CINEDFeature gualse a <INSDQualifler»>

TH <INSDQuelifier name>mol type</INIDQuaiifier name) zò <INSDQualifiler wvaluerother DNA</INSDO0uaelifier value 7 </INSDQualiËier>

Ta <INSDQualifier 1d=vghne id <INSDQualifier namernote</INZDOualifier name> <INSDOualifier valuerPrimer 1</{INSDQualifier values ai </INSUQualifiers> u

SE <INSDQualifler in=Ng8"> 22 <INSDgualifier nemssorganism“/TINSDOQualifier name 2e <INSDQualifier value>synthetic construct /INSDouallfier valuer

BH </INSDQualifisan» sé </INSDFeature quals> 57 </INSDEFeature> as </INSDSeg faature-table> <INSDSeq sequence>aatgatacggcgaccaccgagatctacactetttccctacacgacgetettccgat ct</INSDSöeq sequencer 30 </INSDSea:

JL </SecuenceDala»>

GE <SequenceData zeuvencoseIDNumDer="&rD> 43 <INSDSeq> ed “INSDSeq length>64</INSDSeg Length>

EN <INSDSeq moltype>DNA</INSDSeg moliype> 38 <INSDSeq division»>PAT</INSDSeg divisions 37 <INSDSeq feature-itablel 38 <INSDFeature> ba <INSDFeature key>source</IN3LFealture key> 130 <INSDFearure location>l..64</INSDFeature Lccation»

LL <INSDFearure guals:»

Lon <INSDQualifiers

Lik <INSDOualifisr name>mol type</IN3DQualifier ame»

Lod <INSDQualifier value>other DNA</INSDO0uelifier value» 108 </INSDQualifier> u ijd “INSDoualifier 1d=9gdn»

La CINADGualifler name>note</IN3Doualifier name>» aw <INSDQualifier valuerPrimer 2</INSDGualifier value»

Tow </INSDOualifier:>

IS CINSUDQualifler ia=vqldys

LLL <INSDQUalifiler naemerorganism/INSDOualifier name ilë <INSDQualifier value>synthetic construct“ /INSDGualifier valuer iin </INSDQualiËier> idd </INSDFeature gualss»

TLE </INSDFeature> he </INSDSeg feature-teblex> <INSDSeq sequsncercaagcagaagacggcatacgagatacatcggtgactggagttcagacgtgtgectet tecegatct./INSDSeq sequence iis </INSDSeg> 118 </SecuenceDatas

Lan </ST26SeguencelLiscing>

NT

Claims

CONCLUSIONS

1. Method for efficiently enriching chromatin open region binding proteins, comprising the following steps: performing biotin modification and homologous arm addition to a regulatory element, formaldehyde-assisted isolation of regulatory elements (FAIRE), deoxyribonucleic acid (DNA), to obtain a FAIRE DNA probe; and incubating the FAIRE DNA probe and a protein in vitro, and then performing DNA pull-down, to enrich and obtain the chromatin open region binding proteins.

The method of claim 1, wherein the regulatory element FAIRE DNA is isolated by the following method: adding formaldehyde to a mitosis-synchronized cell for cross-linking, and performing cell lysis, ultrasonic disruption and phenol/ chloroform extraction on a cross-linked product, to obtain the regulatory element FAIRE DNA.

The method of claim 2, wherein the mitosis-synchronized cell is obtained by subculturing and treating with Nocodazole on a human A549 cell line.

The method of claim 2, wherein the ultrasonic interruption comprises conditions where 2 s of ultrasonic treatment and 1 s of stopping constitute a cycle, ultrasonic treatment is performed for 6 cycles, and an interval between each two cycles is 1 min to 3 min.

The method of claim 1, wherein prior to biotin modification and homologous arm addition library construction, high-throughput sequencing and bioinformatics analysis are performed on the regulatory element FAIRE DNA.

The method of claim 1, wherein the biotin modification and homologous arm addition include DNA end-filling, "A" addition,

ligation with pMD-19T, Plasmid-Safe ATP-Dependent DNase treatment, and polymerase chain reaction (PCR) amplification of a target probe.

The method of claim 6, wherein the PCR amplification of a target probe consists of using universal primers M13F{(-47) and M13R(-48) from a pMD-19T carrier to perform amplification, wherein a 5 '-end of the universal primer M13F{-47) is modified by biotin.

The method of claim 1, wherein the protein is a human A549 nuclear extract or a whole cell extract.

The method of claim 1, wherein the FAIRE DNA probe and Dynabeads M-280 Streptavidin are incubated, and then DNA pull-down is performed.

Use of the method according to any one of claims 1 to 9 in obtaining specific open element binding regulatory proteins.