CN113957035A

CN113957035A - Method for separating and culturing duck embryo primary hepatocytes

Info

Publication number: CN113957035A
Application number: CN202111018025.0A
Authority: CN
Inventors: 闻治国; 赵璐璐; 杨培龙; 蔡红英; 刘婧; 吴永保; 王帮磊
Original assignee: Feed Research Institute of Chinese Academy of Agricultural Sciences
Current assignee: Feed Research Institute of Chinese Academy of Agricultural Sciences
Priority date: 2021-08-02
Filing date: 2021-09-01
Publication date: 2022-01-21
Anticipated expiration: 2041-09-01
Also published as: CN113957035B

Abstract

The invention relates to the field of cell culture, in particular to a duck embryo primary hepatocyte isolation culture method. The method comprises the following steps: sterilizing the shell of the duck embryo, and taking the duck embryo with thirteen-fifteen days old under the aseptic condition; separating duck embryo liver, removing gallbladder, and soaking and washing the obtained liver in D-Hank's buffer solution; removing loose connective tissues and liver capsule adhered around the liver, and soaking the obtained small pieces of liver tissues in D-Hank's buffer solution drops for washing; multi-step digestion; resuspend the cells obtained, screen through a 70 μm cell screen, and inoculate the cells to a culture flask for culture. The invention establishes a simple, economic and rapid method for separating duck embryo primary hepatocytes from selection of the day age of duck embryos, combination of a mechanical method and an enzyme digestion method on tissues and the like.

Description

Method for separating and culturing duck embryo primary hepatocytes

Technical Field

The invention relates to the field of cell culture, in particular to a duck embryo primary hepatocyte isolation culture method.

Background

The liver is an important internal organ of animal organism metabolism, is a main place of carbohydrate, fat and protein metabolism, and has important functions of controlling organism metabolism and maintaining organism metabolic balance. Poultry animals such as meat ducks and the like are different from mammals, the fat cell of the poultry animals has limited fat synthesis capacity, and fat is mainly synthesized by liver and absorbed by intestines, so that the liver of the meat ducks plays an extremely important role in lipid metabolism regulation and control, and the separation and culture of duck liver cells provide a good basis for exploring the lipid metabolism and regulation and control mechanism of the meat ducks.

Liver cells are divided into parenchymal liver cells and non-parenchymal liver cells, wherein the parenchymal liver cells are the main cell group for performing liver functions, and the non-parenchymal liver cells such as hepatic stellate cells and kupffer cells mainly assist the parenchymal liver cells to complete normal liver functions. It has been shown that during the in vitro culture of parenchymal hepatocytes, nonparenchymal hepatocytes are beneficial to the growth of parenchymal hepatocytes, and therefore, in the culture of hepatocytes, a coculture method of hepatocytes and nonparenchymal hepatocytes is often selected in order to maximize the morphological characteristics and physiological functions of primary hepatocytes. In addition, the liver primary cells can well simulate the liver state of a host body, and are an ideal model for researching the metabolic mechanism of the liver of an animal. The duck embryo liver cells are separated and subjected to primary culture, so that the research on the liver metabolic mechanism and the regulation and control function of the meat duck can be realized in the state closest to the in vivo state.

In 1953, Anderson firstly separates liver cells from liver by shearing method, and then separation method is improved for many times in practical application, mainly divided into mechanical method and enzyme digestion method, because the mechanical method has great damage to cells, the two-step collagenase perfusion method is always the classic method for separating liver cells, and is still adopted by most laboratories so far. The method has the advantages of good effect, high cell yield, high purity and good activity, but the operation is complicated, the perfusion technical requirement is high, the intubation is easy to fail, special devices such as a constant flow pump are needed, the consumption of collagenase is high, and the development in a common laboratory is difficult. In recent years, many laboratories have been optimizing and improving the process. In addition, no matter what method is adopted to separate the hepatocytes, the method has the problem of hepatocyte purification, and the main purpose is to remove fibroblasts, the method comprises a differential adherence method, a differential centrifugation technology and a Percoll separation technology, the latter separation technology has relatively high cost, and the former two methods are mostly adopted in application for separation and purification.

Disclosure of Invention

The invention is provided and completed in order to solve the problems of complex operation, high cost, low survival rate and purity of extracted cells and the like in the prior art.

The duck embryo primary hepatocyte isolation culture method comprises the following steps

S1: sterilizing the shell of the duck embryo, and taking the duck embryo with thirteen-fifteen days old under the aseptic condition;

s2: separating duck embryo liver, removing gallbladder, and soaking the obtained liver in buffer solution for washing;

s3: removing loose connective tissues and liver capsule adhered around liver, and soaking the obtained small liver tissue in buffer solution;

s4: multi-step digestion:

(4-1) soaking the liver tissue blocks in pancreatin-EDTA with the concentration of 0.25% for 15-30 s, transferring the liver tissue blocks into a cell culture solution for washing after the tissues are softened and whitened,

(4-2) sterile cutting of tissue to 1mm³Small pieces, washed with cell culture fluid, the supernatant discarded by self-sedimentation of cells and tissues,

(4-3) Using 10mL of 0.25% pancreatin-EDTA, the tissue mass was blown up to a cell suspension of the tissue mass invisible to the naked eye within 30 seconds, left to stand at room temperature for 30 seconds, and then the pancreatin digestion was stopped with fetal bovine serum,

(4-4) centrifuging to remove the supernatant liquid, and washing the cells with a cell culture solution;

s5: the obtained cells were resuspended in complete medium, sieved through a 70 μm cell sieve, and inoculated into a flask for culture.

The duck embryo primary hepatocyte isolation culture method for specifically discharging water comprises the following steps

s2: separating duck embryo liver, removing gallbladder, and soaking and washing the obtained liver in D-Hank's buffer solution;

s3: removing loose connective tissues and liver capsule adhered around the liver, soaking the obtained small pieces of liver tissues in D-Hank's buffer solution drops, and repeating the soaking and washing process for three times;

s4: multi-step digestion:

(4-1) soaking the liver tissue blocks in pancreatin-EDTA (0.25%) for 15-30 s, transferring the liver tissue blocks into a cell culture solution after the tissues are softened and whitened, washing the liver tissue blocks for three times,

(4-2) sterile cutting of tissue to 1mm³The pellet was washed twice with DMEM, the supernatant was discarded by self-sedimentation of cells and tissues,

(4-3) Using 10mL of pancreatin-EDTA (0.25%), within 30s, the tissue mass was blown up to a cell suspension of the tissue mass invisible to the naked eye, left to stand at room temperature for 30s, and then the trypsinization was stopped with fetal calf serum,

(4-4) centrifuging to remove the supernatant, washing the cells with DMEM, and repeating the process twice;

According to the duck embryo primary hepatocyte isolation culture method, the cell culture solution is DMEM.

According to the duck embryo primary hepatocyte isolation culture method, the formula of the complete culture medium comprises a high-sugar medium DMEM rich in 10% fetal calf serum and penicillin 10⁵U·L^－1Streptomycin 100 mg.L^－1。

The invention establishes a simple, economic and rapid method for separating duck embryo primary hepatocytes from selection of the day age of duck embryos, combination of a mechanical method and an enzyme digestion method on tissues and the like.

The invention has the advantages that:

1. the conventional duck embryo primary hepatocyte separation and culture method is a perfusion method, the method is only suitable for adult ducks, complex devices such as a large amount of collagenase and peristaltic pumps are needed for treatment, the intubation failure and the external environment pollution challenge are also needed, and the technical and environmental requirements are strict.

2. The existing pancreatin enzymolysis method separates liver cells, because the digestion process is not easy to control, the cell damage caused by over-digestion often occurs, and the cell survival rate is reduced.

3. Because the purity of primary hepatocytes obtained by a conventional perfusion method and an enzymolysis method is poor, a differential adherence method, a differential centrifugation technology and a Percoll separation technology are often needed for cell purification, the cost of the latter purification technology is relatively high, the former two methods are mostly adopted for separation and purification in application, the separation cost and the operation complexity are undoubtedly increased, duck embryos with proper age are selected in the method, meanwhile, loose connective tissues and liver envelopes adhered to the periphery of the liver are removed in an anatomical stage, and small liver tissues are respectively obtained, so that the interference of liver parenchymal cells is reduced, and the subsequent high-purity hepatocytes are favorably obtained.

4. After primary hepatocytes are obtained by separation, hormone drugs such as insulin and hydrocortisone sodium succinate are often added into a culture medium to promote the growth of cell adherence and the like.

5. The multi-step trypsin digestion method has the characteristic of small damage, and the survival rate of the obtained cells is up to more than 95%.

Drawings

FIG. 1 shows the isolation of duck embryo primary hepatocytes by a multi-step digestion process;

FIG. 2 shows hepatocytes prepared from duck embryos at different ages of days, wherein A is 11 days old, B is 14 days old, C is 20 days old, and the scale bar is 50 μm;

FIG. 3 shows trypan blue exclusion assay for cell viability;

FIG. 4 shows duck embryo primary hepatocytes at different culture times;

FIG. 5 shows the results of identifying alb and afp at the mRNA level, where alb and afp nucleic acids electrophoresed, B: aligning the sequences of the amplified alb and afp;

fig. 6 shows the results of glycogen staining of duck primary hepatocytes, where a: normal glycogen staining, B: negative control (no oxidant) shown in the figure at a scale bar of 100 μm;

FIG. 7 shows the results of indirect immunofluorescence;

FIG. 8 is a cell growth curve.

Detailed Description

Example 1 isolation and culture of Duck embryo Primary hepatocytes

First, isolation and culture

1. Wiping and disinfecting the duck embryo shell by iodophor, and spraying and disinfecting the duck embryo shell by 75% alcohol;

2. under the aseptic condition, breaking the shell from the air chamber end, opening a duck embryo eggshell membrane by using aseptic tweezers, and taking out the duck embryo;

3. the operation scissors and the forceps cooperate, the duck embryo is dissected, the liver of the duck embryo is separated, the gall bladder is removed, and the obtained liver D-Hank's buffer solution is soaked and washed;

4. the operation knife and the forceps cooperate to remove loose connective tissues and liver capsule adhered around the liver, and the obtained small liver tissues are soaked in D-Hank's buffer solution drops, and the soaking and washing process is repeated three times;

5. multi-step digestion, firstly, soaking a liver tissue block in pancreatin-EDTA (0.25%) for 15-30 s, transferring the liver tissue block into DMEM liquid drops after the tissue is softened and whitened, and washing the liver tissue block for three times;

6. the tissue was transferred to a 15mL sterile centrifuge tube and cut into 1mm pieces with a scalpel³The pellet, washed twice with 5mL DMEM, from which supernatant was discarded by self-sedimentation of cells and tissues;

7. adding 10mL of pancreatin-EDTA (0.25%) into a 15mL sterile centrifuge tube, blowing the tissue blocks to a cell suspension of the tissue blocks invisible to naked eyes within 30s by using a 5mL pipette gun, standing for 30s at room temperature, and adding 1/10 volumes of fetal bovine serum to terminate the pancreatin digestion;

8. centrifuging at a centrifugal force of 500g for 5min at 4 ℃, removing supernatant liquid, washing cells by 10mL of DMEM, and repeating the process twice;

9. resuspending the obtained cells with the culture medium (complete medium: high-sugar medium DMEM rich in 10% fetal bovine serum, penicillin 10)⁵U·L^－1Streptomycin 100 mg.L^－1) The cells were screened through a 70 μm cell sieve (Corning) and counted using a hemocytometer, whereupon the cells were seeded into a culture flask.

As shown in FIG. 1, the result of the multi-step digestion method for isolation and culture of duck embryo primary hepatocytes is shown, and the result shows that the simple, economical and rapid duck embryo primary hepatocyte isolation method is established.

Selection of second and fourth ages

The liver of the duck embryo gradually increases along with the increase of the day-old of the duck embryo, but the activity and the adaptability of the duck embryo in an in vitro environment are different. In addition, with the increase of the age in days, the attachments on the surfaces of the duck embryo livers are increased, and the purity of the prepared cells is directly influenced. As shown in figure 2, the duck embryos of eleven, fourteen and twenty days are selected in sequence, and the states of the obtained cells are observed morphologically, so that the state of the 14-day-old duck embryos is found to have obvious advantages compared with the other two groups, the cells are in an epithelial cell shape, the cell nucleuses are positioned in the middle of the cells, and the binuclear liver cells are seen and accord with the typical characteristics of the liver cell morphology. As shown in FIG. 4, thirteen, fourteen, fifteen and sixteen days old duck embryos were selected and cultured for 24h, 48h, 72h and 96h, respectively, and the observation results showed that it was not appropriate to select excessively large day old duck embryos, but rather thirteen to fifteen days old duck embryos were selected in the preparation of duck embryo primary hepatocytes.

Cell viability was identified by trypan blue exclusion (Solebao: C0040). Wherein the content of the first and second substances,

1. mixing the cell suspension with 0.4% trypan blue solution at a ratio of 9:1 (final concentration 0.04%), and staining for 3 min;

2. a small number of stained cells were aspirated and counted on a hemocytometer. Dead cells are blue and swollen, dull; the living cells are not colored and keep normal shape and have luster;

3. cell survival (%). percent total viable cells/(total viable cells + total dead cells) × 100%.

As shown in FIG. 3, the survival rate of the cells isolated according to the method of the present invention is > 95% (upper panel in FIG. 3), higher than that of duck embryo primary hepatocytes isolated by enzymatic methods such as Tan-Chi-Ku-Shi-Chi etc. (lower panel in FIG. 3).

Thirdly, the separated cells are preliminarily identified from the mRNA level

Albumin (Albumin, ALB) is secreted by hepatocytes, Alpha Fetoprotein (AFP) is normally mainly derived from embryonic hepatocytes, according to the characteristics of the hepatocytes, cellular RNA is extracted, cDNA is obtained by reverse transcription, the two genes are amplified by PCR, the amplified gene sequences are sequenced, the ALB and the AFP are obtained by reverse transcription, and the cells obtained by separation are preliminarily identified. ALB is located in the fourth chromosome, genome accession number NC-040049.1, at position 46869333-46879914, gene ID NM-001310394.1, CDs sequence length 1848bp, primer design ALB-F: ATGAAGTGGGTAACATTAATTTC, ALB-R: TTAAGCACCAATTCCTAATGT. AFP is located in the fourth chromosome with genome accession number NC-040049.1, at position 46836428-46864918, gene ID XM-021267672.2, CDs sequence length 1809bp, primer design AFP-F: ACTGTAGTCAAAGCCCTGC, AFP-R: TTGGAATCAATCCTCTTTCACAAA. As shown in FIG. 5, the sequencing results showed that hepatocytes were obtained by the method of the present invention.

Fourth, cell purity and function identification

The morphology of the liver cells is observed, and the functions of the liver cells are also detected. Hepatic glycogen is a stored polysaccharide in the human and animal body, also known as hepatic starch. The energy on which the hepatocyte lives is derived from anaerobic glycolysis in the cell, and glycogen in the hepatocyte can be decomposed into glucose to provide a substrate for the anaerobic glycolysis. The biological energy deficiency of the liver cells is an initiating factor causing a series of pathological changes of the liver, so that a periodic acid-Schiff staining method is selected to evaluate the biological function of the primary liver cells through the condition of glycogen content of the cells. As shown in FIG. 6, microscopic examination showed that glycogen is abundant in the hepatocyte cytoplasm, and the glycogen is stained to be purple red and distributed in a homogeneous or granular shape, indicating that the hepatocyte isolated by the invention has normal functional activity.

The primary cultured liver cells have the secretion function of AFP, but the concentration of AFP secreted by the liver cells is gradually reduced along with the prolonging of the culture time, and the liver cells basically lose the secretion function of AFP after multiple passages. In addition, albumin is expressed and secreted by hepatic parenchymal cells, the secretion of albumin and alpha fetoprotein is also a common detection index of the functional state of the liver cells, and the functional activity of the liver cells of the separated cells is evaluated by adopting an indirect immunofluorescence method aiming at the albumin. In addition, the cell nucleus was subjected to DAPI staining at the same time, and the purity of the cells was determined. The observation result of a fluorescence microscope shows that the separated cells have the capacity of secreting albumin, and the combined result shows that more than 90 percent of the cells are parenchymal hepatocytes capable of secreting albumin.

Fifth, cell growth curve

The cell growth curve is a common method for measuring the absolute growth number of cells, is also an important index for judging the cell viability, and is one of basic parameters of biological characteristics of cultured cells. As shown in fig. 7, a cell growth curve drawn by the MTT method shows that the isolated cells have typical cell growth characteristics, including a slow growth incubation period, an exponential growth period with a large slope, a plateau-like plateau, and 4 degenerated deaths.

The prior art faces problems such as cell purity, cell viability, etc. in the process of isolating primary cells using duck embryos. In order to improve the purity of cells, those skilled in the art often separate and obtain cells, and then further purify the cells, such as differential adherence, differential centrifugation, Percoll separation, etc., and there are few methods for tissue pretreatment in the literature materials due to the dependence on the above purification techniques. Furthermore, the skilled person generally selects the large day-old duck embryo, the adhesion around the liver and the non-hepatocyte increase in the liver, which increases the difficulty of removal. According to the invention, in the test process, the effect of primary cell culture is influenced by the duck embryos of different ages in days.

In view of the prior art, in order to improve the cell survival rate, those skilled in the art have conventionally determined an appropriate isolation culture method from various complicated conditions such as the type of culture medium, the addition of hormones, the type and concentration of digestive enzymes used, and the like. The multi-step digestion method adopted by the invention indirectly reduces the damage of the pancreatin to the cells while utilizing the advantage of high pancreatin digestion efficiency, thereby improving the cell survival rate.

Sequence listing

<110> institute of feed of Chinese academy of agricultural sciences

<120> duck embryo primary hepatocyte isolation culture method

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

actgtagtca aagccctgc 19

<210> 2

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ttggaatcaa tcctctttca caaa 24

Claims

1. The method for separating and culturing the duck embryo primary hepatocytes is characterized by comprising the following steps

s4: multi-step digestion:

2. The isolated culture method of duck embryo primary hepatocytes as claimed in claim 1, wherein the cell culture solution is a DMEM culture solution.

3. The isolated culture method of duck embryo primary hepatocytes as claimed in claim 1, wherein the buffer solution is D-Hank's buffer solution.

4. The isolated culture method of duck embryo primary hepatocytes as claimed in claim 1, wherein the complete medium is prepared from high-sugar medium DMEM rich in 10% fetal calf serum and containing penicillin 10⁵U·L^－1Streptomycin 100 mg.L^－1。

5. The isolated culture method of duck embryo primary hepatocytes as claimed in claim 1, wherein the small pieces of liver tissue obtained are soaked in a buffer solution, and the soaking and washing process is repeated three times.

6. The isolated culture method of duck embryo primary hepatocytes as claimed in claim 1, wherein in the step (4-4), the supernatant is discarded by centrifugation, and cells are washed with DMEM, and the process is repeated twice.