CN114107181B - Sturgeon embryo cell line, culture medium and preparation method thereof - Google Patents
Sturgeon embryo cell line, culture medium and preparation method thereof Download PDFInfo
- Publication number
- CN114107181B CN114107181B CN202111399035.3A CN202111399035A CN114107181B CN 114107181 B CN114107181 B CN 114107181B CN 202111399035 A CN202111399035 A CN 202111399035A CN 114107181 B CN114107181 B CN 114107181B
- Authority
- CN
- China
- Prior art keywords
- sturgeon
- embryo
- cells
- cell line
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0603—Embryonic cells ; Embryoid bodies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/30—Organic components
- C12N2500/44—Thiols, e.g. mercaptoethanol
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/70—Undefined extracts
- C12N2500/80—Undefined extracts from animals
- C12N2500/84—Undefined extracts from animals from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/11—Epidermal growth factor [EGF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/115—Basic fibroblast growth factor (bFGF, FGF-2)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Developmental Biology & Embryology (AREA)
- Reproductive Health (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Gynecology & Obstetrics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a sturgeon embryo cell line, a culture medium and a preparation method thereof, which belong to the technical field of cell biology, wherein the sturgeon embryo cell line ADec strain is preserved to China general microbiological culture collection center (China center for type culture collection) at 7 and 28 days in 2021 with the preservation number: CGMCC No.22360. The invention also provides a sturgeon embryo cell line culture medium, and the key step of preparing the sturgeon embryo cell line by using the culture medium is to adopt horizontal shaking to separate embryo bodies and yolk and collect pure and complete sturgeon embryo cells. The method successfully obtains the sturgeon embryo cell line, the morphological characteristics of primary cells are maintained after continuous passage for 20 generations, and the cells can still maintain high activity after cryopreservation and recovery.
Description
Technical Field
The invention belongs to the technical field of cell biology, and particularly relates to a sturgeon embryo cell line, a sturgeon embryo culture medium and a preparation method of the sturgeon embryo cell line.
Background
The Yangtze river sturgeon (Acipenser dabryanus) is also called Acipenser dabryanus, belongs to sturgeon of sturgeon family, is mainly distributed on the upstream of the Yangtze river, is another sturgeon except Acipenser sinensis in the Yangtze river in China, is a special migration fish in the Yangtze river in China, and is an international natural protection alliance extremely dangerous species. In recent years, the survival of sturgeons in Yangtze river, which is affected by environmental changes and human activities, is severely challenged, and natural populations severely decline. Although the related departments adopt modes of on-site protection, site-moving protection and the like for the protection of genetic resources, the problems of domestication, inbreeding, reduced individual adaptability, infectious diseases and the like exist due to limited conditions, the germplasm resources and genetic diversity cannot be protected to the maximum extent, and the danger of species extinction is faced.
The establishment of a cell line can preserve fish germplasm resources, and fish embryonic stem cells have totipotency or multipotency, so that the preservation of the embryonic stem cells means that the gene resources of the species are preserved. In combination with cell transplantation or nuclear transfer techniques, it is possible to restore an endangered fish species by cryopreserved embryonic stem cells.
Since the 60 s of the 20 th century, wolf et al established the first fish cell line in the world, RTG-2, 783 fish cell lines had been established worldwide by 2020. A total of 26 sturgeon cell lines were reported to be established worldwide between 2010 and 2020, but the sturgeon embryo cell lines have not been established successfully so far. Typical primary cell culture nutrients are 4 steps: obtaining a sample; isolating the tissue; dissecting or dissociating tissue; inoculating in a culture vessel for culture. Compared with most fish, sturgeon roe has a larger diameter of more than 2mm, contains rich yolk, has no clear boundary with embryo, and is difficult to separate complete and pure embryo cells and establish cell lines in experiments. Referring to other preparation methods of fish embryo cells, after embryo membranes of hybrid sturgeons are removed by a mechanical method, the embryo membranes are torn by forceps to release embryos and yolk, the embryos are moved to another culture dish in an ultra-clean workbench, sheared, and then subjected to subsequent treatment by a trypsin digestion method. In experiments, we found that the yolk and embryo were tightly connected, it was extremely difficult to distinguish between embryo bodies and yolk, and embryo bodies were very fragile and the embryo could not be transferred with tools. Thus, sturgeon embryo cell lines are difficult to establish.
Disclosure of Invention
In order to solve the defects in the prior art, the invention provides a sturgeon embryo cell line, a culture medium and a preparation method thereof, and solves the existing problems that a sturgeon embryo cell line, a culture medium and a culture method are not available. And pure and complete embryo cells cannot be separated from tightly bound yolk within sturgeon egg shells.
The technical scheme adopted for solving the technical problems is as follows: provides a sturgeon embryo cell line and a method for horizontally shaking and separating embryo bodies and yolk and collecting pure and complete sturgeon embryo cells. Provides a culture medium formula for sturgeon embryo cell culture and a sturgeon embryo cell culture method. The specific contents are as follows:
the invention provides an ADec strain of sturgeon embryo cell line, which is preserved to China general microbiological culture Collection center (China center for type culture collection) at the date of 28, 7 in 2021, with the preservation number: CGMCC No.22360.
The invention provides a preparation method of sturgeon embryo cells, which is characterized by comprising the following steps: in the process of separating sturgeon embryo and yolk, the embryo and yolk are separated by a horizontal shaking method.
The invention provides a sturgeon embryo cell culture method, which is characterized by comprising the following steps of: the cell culture temperature is 24 ℃, the cell passage mode is trypsin digestion, the cell passage interval time is 2-6 days, and the passage ratio is 1:2-1:5.
As a further technical scheme of the invention:
a method for preparing sturgeon embryo cell line, which is characterized in that: the horizontal oscillation method comprises the following steps: adding PBS (phosphate buffered saline) lotion containing antibiotics into a container containing embryo bodies and yolk, setting the rotating speed to be 30-70 r/min through a horizontal shaking table, shaking for 3-10 min, gradually diluting the yolk into the lotion, enabling the embryo bodies to be in a sticky block shape, and sucking the PBS lotion containing the yolk.
Further:
a method for preparing sturgeon embryo cell line, which is characterized in that: the horizontal shaking method needs to be repeated for 2-5 times, and then the embryoid body tissue mass is collected into a sterile container.
A culture medium for sturgeon embryo cells is based on L-15 culture medium, and is added with nutrients including bFGF, EGF, beta-mercaptoethanol, fetal calf serum and antibiotics.
Further, a culture medium formula for sturgeon embryo cells is based on an L-15 culture medium, and the following components and final concentrations are added: the final concentration of bFGF is 5ng/ml, the final concentration of EGF is 5ng/ml, the final concentration of beta-mercaptoethanol is 50mM, the final concentration of penicillin is 100u/ml, the final concentration of streptomycin is 100ug/ml, the final concentration of amphotericin B is 0.25ug/ml, and the serum addition ratio of fetal bovine is 20%.
Furthermore, further:
a method for preparing a sturgeon embryo cell line, which is characterized by comprising the following steps:
(1) Removing egg membranes and egg shells: collecting fertilized eggs of sturgeon in hatching, adding PBS for cleaning, transferring to a cell culture dish, peeling off an outer egg membrane, cleaning egg shells containing contents with 75% alcohol for 3-5 times, and cleaning with sterile PBS for 3-5 times; transferring sturgeon eggs without adventitia into a new sterile container, peeling off egg shells, and releasing contents;
(2) Separating embryo bodies and yolk: adding PBS (phosphate buffered saline) lotion containing antibiotics into the sterile container containing the embryo body and the yolk in the step (1), setting the rotating speed to be 30-70 r/min through a horizontal shaking table, shaking for 3-10 minutes, gradually diluting the yolk in the lotion, allowing the embryo body to take the shape of a sticky block, sucking the PBS lotion containing the yolk, repeating for 2-5 times, and then collecting the embryo tissue blocks into the sterile container;
(3) Enzymatic digestion to dissociate cells: adding trypsin solution into a sterile container containing tissue blocks, digesting for 5 minutes at room temperature, adding 3ml of fetal bovine serum to stop digestion, and filtering the digested embryo cells by using a cell screen;
(4) Low-speed centrifugation of cells: collecting the embryo cell suspension digested in the step (3) into a centrifuge tube, wherein the cell suspension still contains part of yolk; adding PBS lotion containing antibiotics into the cell suspension, centrifuging at 300rpm for 3-5 minutes, and carefully sucking the PBS lotion containing yolk; obtaining pure and complete sturgeon embryo cells;
(5) Cell culture: sucking sturgeon embryo cells into a cell culture bottle, using an L-15 complete culture medium, and placing the sturgeon embryo cells in a 24 ℃ incubator for culture;
(6) Cell passage: after the cells in the adherence culture grow into monolayer cells, discarding the culture solution, carrying out digestion treatment by using pancreatin, after the cells are shed, adding sturgeon embryo cells, gently sucking and beating the sturgeon embryo cells by using a culture medium, uniformly mixing the sturgeon embryo cells, and carrying out subculture in separate bottles.
Preferably:
the PBS washing liquid containing the antibiotics in the step (2) at least contains 100u/ml penicillin and 0.1mg/ml streptomycin.
The trypsin content of the trypsin solution in the step (3) and the step (5) is 0.5 mg/ml-5 mg/ml.
The cell screen in the step (3) is provided with a pore diameter of 30-100 um.
The L-15 complete medium in the step (5) is an L-15 medium containing 20% of fetal bovine serum and cell growth factors.
The fertilized eggs of the sturgeons in the hatching are fertilized eggs of the sturgeons from 24-96 hours of hatching.
Compared with the prior art, the invention has the beneficial effects that:
(1) Establishing and providing an ADec strain of sturgeon embryo cell line; (2) Provides a method for separating sturgeon embryo and yolk by using an oscillation method to obtain pure embryo cells, providing a sturgeon cell culture medium formula and finally establishing a sturgeon embryo cell line; (3) The method for establishing the sturgeon embryo cell line can successfully obtain the sturgeon embryo cell line. Convenient operation, less limitation and high success rate. The most common culture medium and reagent are used for cell culture in the establishment process, the operation is simple and convenient, and expensive instruments and equipment are not needed. Experiments prove that the obtained Yangtze sturgeon embryo cell line has good growth and division state and vigorous in vitro proliferation, and can be stably passaged for more than 20 generations. Meanwhile, the invention also verifies that the embryonic cell line of the Yangtze sturgeon can still keep high activity after freezing and recovering, so that the cell line can be used for preserving the germplasm of the Yangtze sturgeon; (4) The invention provides a method for establishing a sturgeon embryo cell line by removing egg membranes and egg shells, separating embryo bodies and egg yolk, dissociating cells by an enzyme digestion method, centrifuging and separating cells at a low speed and culturing the cells. The sturgeon embryo cell line establishment method and the sturgeon embryo cell line established by the method are the sturgeon embryo cell line established successfully for the first time worldwide, and fill the blank that no sturgeon embryo cell line and sturgeon embryo cell line establishment technology exist at present.
Drawings
FIG. 1 is a diagram of primary cell morphology under a 100-fold microscope;
FIG. 2 is a diagram of the morphology of the 17 th generation cells under a 100-fold microscope;
FIG. 3 shows the sequence of mitochondrial COI gene amplified using cDNA of ADec cells as a template. Lanes are DL2000 MARKERs in order from left to right; ADec cells and blank control;
FIG. 4 shows the Blast results in NCBI database of the sequencing results of mitochondrial COI gene sequences amplified using cDNA of ADec cells as a template.
Detailed Description
The technical scheme of the present invention is further explained by examples below, but the scope of the present invention is not limited in any way by the examples.
The components and final concentrations of the L-15 medium:
the components and final concentrations of the L-15 complete medium:
the culture medium formula for sturgeon embryo cells is based on an L-15 culture medium, and the following components and final concentrations are added: the final concentration of bFGF is 5ng/ml, the final concentration of EGF is 5ng/ml, the final concentration of beta-mercaptoethanol is 50mM, the final concentration of penicillin is 100u/ml, the final concentration of streptomycin is 100ug/ml, the final concentration of amphotericin B is 0.25ug/ml, and the serum addition ratio of fetal bovine is 20%.
Example 1: establishment of Yangtze sturgeon embryo cell line
The method comprises the following steps of establishing a Yangtze sturgeon embryo cell line
(1) Removing egg membranes and egg shells: collecting 15 oosperms of the Yangtze sturgeon hatched for 48-96 hours, adding 20ml of PBS for cleaning for 4 times, transferring into a cell culture dish, peeling off an outer oosperms membrane by using an ophthalmic forceps, cleaning oosperms (containing contents) with 75% alcohol for 4 times, and cleaning with sterile PBS for 4 times. Transferring the adventitieless sturgeon roe to a new sterile culture dish, peeling off the roe shell by using an ophthalmic forceps, and releasing the content;
(2) Separating embryo bodies and yolk: adding 5ml of PBS (phosphate buffered saline) lotion containing antibiotics into a container containing the embryo body and the yolk in the last step, setting the rotating speed to be 50 revolutions per minute by using a horizontal shaking table (or simulating the rotation and shaking of the horizontal shaking table by holding a culture dish), shaking for 5 minutes, gradually diluting the yolk in the lotion, allowing the embryo body to take the shape of a sticky block, sucking the PBS lotion containing the yolk, repeating for 3 times, and then collecting the embryo body tissue blocks into a 5ml sterile centrifuge tube;
(3) Enzymatic digestion to dissociate cells: a solution of 0.5mg/ml trypsin was added to a sterile centrifuge tube containing the tissue pieces and digested for 5 minutes at room temperature. Adding 3ml of fetal bovine serum to stop digestion, and filtering the digested embryo cells by using a 30um cell screen;
(4) Low-speed centrifugation of cells: the embryo cell suspension was collected into a 50ml centrifuge tube, at which point the cell suspension still contained a portion of the yolk. To the cell suspension, 30ml of antibiotic-containing PBS wash (containing 100u/ml penicillin and 0.1mg/ml streptomycin) was added, and centrifuged at 300rpm for 4 minutes, taking care to aspirate the yolk-containing PBS wash. Repeating the steps for three times to obtain pure and complete sturgeon embryo cells;
(5) Cell culture: cells were aspirated into cell culture flasks using L-15 complete medium containing 5ng/ml bFGF,5ng/ml EGF,50mM beta-mercaptoethanol, 100u/ml penicillin, 100ug/ml streptomycin, 0.25ug/ml amphotericin B,20% fetal bovine serum. Placing the mixture in an incubator at 24 ℃ for culturing.
(6) Cell passage: after the cells in the adherence culture grow into monolayer cells, discarding the culture solution, carrying out digestion treatment by using pancreatin, after the cells are shed, adding sturgeon embryo cells, slightly sucking and beating the cells with a culture medium, uniformly mixing the cells, and carrying out sub-culture for 20 generations in a bottle, thereby completing the ADec strain of the Yangtze sturgeon embryo cell line. The cell passage interval was 3 days and the passage ratio was 1:2.
Cell preservation information is as follows:
classification naming: acipenser dabryanus embryo cell line Acipenser dabryanus;
deposit number: CGMCC No.22360
The preservation date: 2021, 7, 28
Preservation unit: china general microbiological culture Collection center (China general microbiological culture collection center)
Address: beijing city, the North Chen Xili No. 1, 3 national academy of sciences of China for microbiology
Implementation 2: morphological observation of Yangtze sturgeon embryo cell line
The morphology of the primary cells and the 17 th generation cells were observed by comparison with an inverted microscope. The cells with the fusion degree of 80-90% are taken for observation, and the primary cells (figure 1) contain cells with various forms, and most of the cells are fibrous and polygonal. The 17 th generation cells (FIG. 2) were the same morphology as the primary ones, and the cells were mainly fibroblasts and polygonal cells.
Example 3 Acipenser sinensis embryo cell line resuscitation Activity verification
(1) Taking out the frozen Yangtze sturgeon embryo cells from liquid nitrogen, rapidly shaking in warm water at 37 ℃ to enable the cells to melt as soon as possible, and taking out the cells from a water bath at 37 ℃ when most of the frozen cells melt and only a small part of ice remains unmelted.
(2) Centrifuge at 1000rpm for 5 minutes. The supernatant was discarded, cells were resuspended in culture medium, and after trypan blue staining, counted using an inverted microscope, where the stained blue was dead cells and unstained as living cells. Cell viability was calculated after counting. The results in Table 1 show that the viability of the cells after resuscitation was above 70%.
TABLE 1 comparison of viability of different Generation cells before cryopreservation and after resuscitation
| Cryopreserved cells for a second time | Vigor before freezing | Vigor after resuscitation |
| P5 | 98％ | 75％ |
| P12 | 97％ | 81％ |
| P15 | 98％ | 77％ |
| P17 | 98％ | 84％ |
Example 4 identification of the cell genus mitochondrial COI Gene
(1) Extracting RNA from ADec cells cultured in a T25 cell bottle by using a Trizol method, obtaining cDNA by reverse transcription, and performing PCR amplification by using a COI gene primer of the mitochondria of the sturgeon, wherein the primer is as follows: the upstream primer ADCOI-F: TCTACTAACCACAAAGATATTG downstream primer ADCOI-R:
GCCAAAGAATCAAAATAGGT。
(2) A band of approximately 650bp in size was obtained by electrophoresis detection (FIG. 3). Sequencing results were as follows: tgctgagcaagcatagtcggcacagccctcagccttctgatccgtgccgaactgagccaacccggtgccttgcttggcgat gaccagatctacaatgttatcgttacagcccacgcctttgtcatgattttctttatagtaatacccatcataattggcggattcggaaactgactggtccccctaataattggagccccagacatggcattccctcgtatgaacaatatgagcttctggctcctacccc catccttcctactccttctggcctcctctggggtagaggccggggccggcacaggatgaactgtttaccccccactggcgggaaacctggcccatgcaggagcctctgtagacctaaccattttctccctccacctggccggggtatcgtccattttaggagc tattaattttatcaccacaattattaacatgaaaccccccgcagtatcccaataccagacacctctatttgtatgatctgtattaatcacggccgtgcttctcctgctgtcactgccagtgctagctgcggggatcacaatacttctaacggatcgaaatttaaacaccaccttctttgacccagccggaggaggagaccccatcctctaccaacacctattttaatttcctttggcaaaa.
(3) The homology of the sequence was found in NCBI database using blast to find that the sequence was more than 96% homologous to the multiple Yangtze sturgeon mitochondrial sequences or mitochondrial COI gene sequences in the database, indicating that the cell line was derived from Yangtze sturgeon, while the COI gene sequence was also a characteristic sequence of the cell line (FIG. 4).
The above examples are provided for illustrating the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements of the present invention should be suggested to those skilled in the art without departing from the spirit of the present invention, which is set forth in the appended claims.
Sequence listing
<110> yellow sea aquatic institute of China aquatic science institute
<120> sturgeon embryo cell line, culture medium and preparation method thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
tctactaacc acaaagatat tg 22
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
gccaaagaat caaaataggt 20
<210> 3
<211> 654
<212> DNA
<213> Yangtze sturgeon (Acipenser dabryanus Dumeril)
<400> 3
tgctgagcaa gcatagtcgg cacagccctc agccttctga tccgtgccga actgagccaa 60
cccggtgcct tgcttggcga tgaccagatc tacaatgtta tcgttacagc ccacgccttt 120
gtcatgattt tctttatagt aatacccatc ataattggcg gattcggaaa ctgactggtc 180
cccctaataa ttggagcccc agacatggca ttccctcgta tgaacaatat gagcttctgg 240
ctcctacccc catccttcct actccttctg gcctcctctg gggtagaggc cggggccggc 300
acaggatgaa ctgtttaccc cccactggcg ggaaacctgg cccatgcagg agcctctgta 360
gacctaacca ttttctccct ccacctggcc ggggtatcgt ccattttagg agctattaat 420
tttatcacca caattattaa catgaaaccc cccgcagtat cccaatacca gacacctcta 480
tttgtatgat ctgtattaat cacggccgtg cttctcctgc tgtcactgcc agtgctagct 540
gcggggatca caatacttct aacggatcga aatttaaaca ccaccttctt tgacccagcc 600
ggaggaggag accccatcct ctaccaacac ctattttaat ttcctttggc aaaa 654
Claims (4)
1. An ADEc strain of sturgeon embryo cell line, wherein the ADEc strain of sturgeon embryo cell line has been deposited in 2021, 7 and 28 days to the China general microbiological culture collection center, with a deposit number of: CGMCC22360.
2. A method for preparing a sturgeon embryo cell line, comprising the steps of:
(1) Removing egg membranes and egg shells: collecting fertilized eggs of sturgeon in hatching, adding PBS for cleaning, transferring to a cell culture dish, peeling off an outer egg membrane, cleaning egg shells containing contents with 75% alcohol for 3-5 times, and cleaning with sterile PBS for 3-5 times; transferring sturgeon eggs without adventitia into a new sterile container, peeling off egg shells, and releasing contents;
(2) Separating embryo bodies and yolk: adding PBS (phosphate buffered saline) lotion containing antibiotics into the sterile container containing the embryo body and the yolk in the step (1), setting the rotating speed to be 30-70 r/min through a horizontal shaking table, shaking for 3-10 minutes, gradually diluting the yolk in the lotion, allowing the embryo body to take the shape of a sticky block, sucking the PBS lotion containing the yolk, repeating for 2-5 times, and then collecting the embryo tissue blocks into the sterile container;
(3) Enzymatic digestion to dissociate cells: adding trypsin solution into a sterile container containing tissue blocks, digesting for 5 minutes at room temperature, adding 3ml of fetal bovine serum to stop digestion, and filtering the digested embryo cells by using a cell screen; the trypsin content of the trypsin solution is 0.5 mg/ml-5 mg/ml; the cell screen is provided with a pore diameter of 30-100 um;
(4) Low-speed centrifugation of cells: collecting the embryo cell suspension digested in the step (3) into a centrifuge tube, wherein the cell suspension still contains part of yolk; adding PBS lotion containing antibiotics into the cell suspension, centrifuging at 300rpm for 3-5 minutes, and carefully sucking the PBS lotion containing yolk; obtaining pure and complete sturgeon embryo cells;
(5) Cell culture: sucking sturgeon embryo cells into a cell culture bottle, using an L-15 complete culture medium, and placing the sturgeon embryo cells in a 24 ℃ incubator for culture; the L-15 complete culture medium is an L-15 culture medium containing 20% of fetal bovine serum and cell growth factors;
(6) Cell passage: after the cells in the adherence culture grow into monolayer cells, discarding the culture solution, carrying out digestion treatment by using pancreatin, after the cells are shed, adding sturgeon embryo cells, gently sucking and beating the sturgeon embryo cells by using a culture medium, uniformly mixing the sturgeon embryo cells, and carrying out subculture in separate bottles.
3. The method according to claim 2, wherein the PBS wash containing the antibiotic in the step (2) contains at least 100u/ml penicillin and 0.1mg/ml streptomycin.
4. The method according to claim 2, wherein the fertilized sturgeon eggs in the hatching in the step (1) are fertilized sturgeon eggs derived from 24 to 96 hours of hatching.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111399035.3A CN114107181B (en) | 2021-11-19 | 2021-11-19 | Sturgeon embryo cell line, culture medium and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111399035.3A CN114107181B (en) | 2021-11-19 | 2021-11-19 | Sturgeon embryo cell line, culture medium and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114107181A CN114107181A (en) | 2022-03-01 |
| CN114107181B true CN114107181B (en) | 2023-06-23 |
Family
ID=80440378
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111399035.3A Active CN114107181B (en) | 2021-11-19 | 2021-11-19 | Sturgeon embryo cell line, culture medium and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114107181B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117417882A (en) * | 2023-10-18 | 2024-01-19 | 中国科学院水生生物研究所 | Preparation method and equipment of single cell suspension of zebra fish embryo |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6103523A (en) * | 1996-04-29 | 2000-08-15 | Thromb-X N.V. | Pluripotent rabbit cell lines and method of making |
| US20060168671A1 (en) * | 2005-01-21 | 2006-07-27 | Gavin William G | Injection of caprine sperm factor (cSF), phospholipase C zeta (PLCzeta) and adenophostin A as alternative methods of activation during nuclear transfer in the caprine species |
| CN1321177C (en) * | 2005-09-05 | 2007-06-13 | 中国水产科学研究院黄海水产研究所 | Fish embryo cell separation and culturing method |
| CN104894056B (en) * | 2015-06-19 | 2017-11-24 | 中国长江三峡集团公司中华鲟研究所 | A kind of construction method of acipenser dabryanus spleen tissue cell line |
| CN112877277B (en) * | 2021-03-12 | 2022-09-23 | 集美大学 | Large yellow croaker ovary tissue cell line and application thereof |
| CN113621553B (en) * | 2021-07-06 | 2023-06-30 | 福建农林大学 | Fugu bifidus ovary tissue cell line and application thereof |
-
2021
- 2021-11-19 CN CN202111399035.3A patent/CN114107181B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114107181A (en) | 2022-03-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107299082B (en) | Method for separating placenta mesenchymal cells from tissues and culturing into mesenchymal stem cells | |
| CN110317780B (en) | Preparation method of placenta membrane mesenchymal stem cells | |
| CN114317443B (en) | Breast cancer organoid culture solution, and culture reagent combination and culture method thereof | |
| CN106967674B (en) | Separation culture method of sheep rumen epithelial cells | |
| CN114292816B (en) | Lung cancer organoid culture solution, and culture reagent combination and culture method thereof | |
| CN105543164A (en) | Primary isolated culture method for dairy cow mammary epithelial cells | |
| CN114107181B (en) | Sturgeon embryo cell line, culture medium and preparation method thereof | |
| CN109628373B (en) | Method for harvesting cells on three-dimensional microcarrier | |
| CN110791474A (en) | Method for separating and culturing nucleus pulposus cells in vitro | |
| CN104531608A (en) | Anguilla anguilla liver cell line and construction method and application thereof | |
| CN104726401A (en) | Method for improving success rate of umbilical cord blood mesenchymal stem cell culture by using placental mesenchymal stem cells | |
| CN113717939A (en) | Red porgy brain cell line and its construction method and use | |
| CN112159796A (en) | Primary isolation method and application of human umbilical cord-derived mesenchymal stem cells | |
| CN113293128A (en) | Hexagrammos otakii spermatogonia culture medium and culture method | |
| CN109207422B (en) | European eel kidney cell line EK and application thereof | |
| CN115044532B (en) | Construction and identification method of rapana venosa embryo cell line | |
| CN115141796B (en) | Culture medium for grouper germ stem cells and long-term culture method thereof | |
| CN114874974B (en) | Epinephelus coioides intestinal cell line ECGI-21 and application thereof | |
| CN113186155B (en) | High-efficiency culture method of primary cells of sheep embryonic skeletal muscle | |
| CN110295137B (en) | Channa argus kidney cell line and construction method and application thereof | |
| CN111893088A (en) | Method for in vitro isolated culture of Mongolian horse testis spermatogonium stem cells | |
| CN110622922A (en) | Method for establishing mouse animal model with ascites due to pancreatic cancer | |
| CN114807011B (en) | Fugu obscurus spermary cell line and construction method and application thereof | |
| CN110592005A (en) | Method for separating mesenchymal stem cells | |
| CN110777109B (en) | Method for separating and culturing gonad tissue germ cells of blood clam |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |