CN112877277B - Large yellow croaker ovary tissue cell line and application thereof - Google Patents
Large yellow croaker ovary tissue cell line and application thereof Download PDFInfo
- Publication number
- CN112877277B CN112877277B CN202110272549.6A CN202110272549A CN112877277B CN 112877277 B CN112877277 B CN 112877277B CN 202110272549 A CN202110272549 A CN 202110272549A CN 112877277 B CN112877277 B CN 112877277B
- Authority
- CN
- China
- Prior art keywords
- large yellow
- yellow croaker
- cell line
- cells
- ovary tissue
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0681—Cells of the genital tract; Non-germinal cells from gonads
- C12N5/0682—Cells of the female genital tract, e.g. endometrium; Non-germinal cells from ovaries, e.g. ovarian follicle cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/30—Organic components
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/30—Organic components
- C12N2500/44—Thiols, e.g. mercaptoethanol
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/70—Undefined extracts
- C12N2500/80—Undefined extracts from animals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/70—Undefined extracts
- C12N2500/80—Undefined extracts from animals
- C12N2500/84—Undefined extracts from animals from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/11—Epidermal growth factor [EGF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/115—Basic fibroblast growth factor (bFGF, FGF-2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/12—Hepatocyte growth factor [HGF]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Reproductive Health (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The application discloses a large yellow croaker ovary tissue cell line and application thereof. The large yellow croaker ovary tissue cell line is a large yellow croaker ovary tissue cell line LYCO, and is preserved in China center for type culture Collection with the preservation number of CCTCC NO: C202117. the large yellow croaker ovary tissue cell line has excellent cell characteristics, mainly takes long fibrous cells, is easy to digest, has good adherence rate, is hunger-resistant, and has good stability of the constructed cell line. The invention fills the blank of the research of the ovary tissue cell line of the large yellow croaker and provides a new research tool for the research of the gonad development mechanism of the large yellow croaker.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a large yellow croaker ovary tissue cell line and application thereof.
Background
Large yellow croaker (Larimichthys crocea), class Osteichthyes, order Perciformes, family Shitou, genus Pseudosciaena, inhabits mainly in coastal and middle and lower layers of offshore water areas, is a Chinese offshore economic fish, and is one of the traditional four-large marine products (large yellow croaker, small yellow croaker, hairtail, cuttlefish) in China. At the present stage, the main production areas for large yellow croaker culture are Fujian, Zhejiang and Guangdong. In 2019, the Fujian yield is 186514 tons accounting for 82.7 percent; the yield of Zhejiang is 23932 tons, accounting for 10.6 percent; the yield of the Guangdong is 15103 tons, which accounts for 6.7 percent. However, the further development of large yellow croaker culture is greatly limited by factors such as resource exhaustion, seed quality degradation and frequent disease development of large yellow croakers, so research on disease control, fine seed breeding and the like of large yellow croakers is urgently needed.
The establishment of the fish cell line can provide great convenience for researches on fish virus separation, an antiviral mechanism, vaccine research and development, a transgenic technology, chimera tissue engineering and the like, and the requirements on resources such as facility manpower and the like are low compared with those of a living experiment, the repeatability is good, and the research period is short. The cell culture provides an important in vitro model for carrying out researches on fish toxicology, pathology, genetic analysis and the like.
At present, cell lines separated from large yellow croaker tissues only comprise three cell lines of fins, lip ends and spleens of large yellow croaker adult fishes reported in 2010 by grandsons, muscle, liver and brain cell lines established in 2013 by Zhuanghua and large yellow croaker head-kidney macrophage cell lines established in Aiqinghui and the like in 2019. However, no relevant research and report on cell lines of the ovary tissues of the large yellow croaker exist, and the research on the gonad development mechanism of the large yellow croaker is greatly limited. Therefore, establishing a large yellow croaker ovarian tissue cell line with good stability is a difficult problem to be solved urgently in the field.
Disclosure of Invention
The invention aims to overcome the defects of the prior art, provides a large yellow croaker ovary tissue cell line and application thereof, and solves the problems in the background technology.
In order to achieve the purpose, the invention adopts the following technical scheme:
a large yellow croaker ovary tissue cell line is named LYCO and is preserved in China Center for Type Culture Collection (CCTCC) at 23.1.2021, with the preservation number of CCTCC NO: c202117, address Wuhan, Wuhan university, China.
The large yellow croaker ovarian tissue cell line LYCO provided by the invention is constructed by the following method:
s1, obtaining ovary tissues of large yellow croakers: the method comprises the steps of (1) temporarily culturing 7-month-old and 9-11 cm-long young large yellow croaker in sterilized seawater (penicillin, streptomycin and amphotericin B) containing penicillin, streptomycin and amphotericin B, wherein a 100 x concentrated solution of a three-antibody contains 10000U/mL penicillin, 10000 mu g/mL streptomycin and 10000U/mL amphotericin B, and 1 mL of 100 x concentrated solution of the three-antibody is added into every 100mL of seawater during preparation of seawater for 1-1.5h, and then adding eugenol accounting for 0.005-0.015% of the volume of the sterilized seawater dropwise until the fish turns over, the belly faces upwards and does not react to the stress; wiping mucus on the surface of a fish body by using a sterilized gauze piece, wiping the surface of the fish body by using gauze soaked with alcohol, taking out the ovary tissue of the large yellow croaker, and placing the large yellow croaker into PBS (100 mL of PBS is added into 1 mL of 100 multiplied by concentrated solution of three antibiotics);
s2, primary culture: cutting ovary tissue of large yellow croaker to 1.0 mm 3 The small tissue pieces were rinsed three times with PBS solution. After rinsing, transferring the small tissue blocks into a 15mL centrifuge tube, obtaining single cells by using a 0.25% trypsin digestion method, filtering the digested cells by using a 70-micron cell filter sieve, transferring the cells into the 15mL centrifuge tube, collecting cell precipitates, resuspending the cells by using 5mL of complete culture solution, inoculating the cells into a cell culture bottle, performing constant-temperature culture at 27 ℃ to start primary culture, and replacing the complete culture solution once every 2-3 days;
s3, subculturing: performing primary culture until adherent cells proliferate to at least 80-90% coverage rate, removing old culture solution, and cleaning to remove residual serum and divalent metal ions; then, carrying out passage suspension on the cells by a 0.25% trypsin digestion method, and carrying out passage at a ratio of 1: 2-10; and subculturing once every 2-3 days until 230 days and 60 generations, wherein the large yellow croaker ovarian cell line is successfully established.
The invention also provides application of the large yellow croaker ovary tissue cell line in research on large yellow croaker gonad development related functional genes.
The invention also provides application of the large yellow croaker ovary tissue cell line in pharmacology, gene screening, gene editing and functional analysis.
The invention also provides a large yellow croaker ovarian tissue cell line culture solution, which comprises an L-15 culture solution, fetal bovine serum FBS, beta-mercaptoethanol, N-acetylglucosamine, sodium carboxymethylcellulose, human FGF-basic, human EGF, human HGF, penicillin and streptomycin.
Preferably, the culture solution of the large yellow croaker ovarian tissue cell line takes an L-15 culture solution as a basic culture solution, and the addition amounts of fetal bovine serum, beta-mercaptoethanol, N-acetylglucosamine, sodium carboxymethylcellulose, human FGF-basic, human EGF, human HGF, penicillin, streptomycin, fish serum and fish embryo extract are respectively 5% -20% of the volume fraction of the L-15 culture solution, 0.5 thousandth, 50 mug/mL, 10 mug/L, 5 mug/L, 1 mug/L, 100 IU/mL, 100 mug/mL, 100 IU/mL, 1% and 1%.
The invention has the following technical effects:
1. the invention successfully constructs the first large yellow croaker ovarian cell line, fills the blank of the research on the large yellow croaker ovarian tissue cell line, and provides a new research tool for the research on the large yellow croaker gonad development mechanism.
2. The large yellow croaker ovary cell line has excellent cell characteristics. Mainly long filamentous cells, and a few oval cells are often present in the gaps between the filamentous cells. Vigorous division, short passage time, easy digestion, good adherence rate, hunger resistance and good stability of the constructed cell line.
3. The complete culture solution used by the invention takes the L-15 culture solution as a basic culture solution, and is added with fetal bovine serum FBS, beta-mercaptoethanol, N-acetylglucosamine, sodium carboxymethylcellulose, human FGF-basic, human EGF, human HGF, penicillin and streptomycin. The L-15 culture solution and the fetal bovine serum FBS provide sufficient nutrition for cell growth; the addition of beta-mercaptoethanol, N-acetylglucosamine, sodium carboxymethylcellulose, human FGF-basic, human EGF and human HGF can stimulate cell activity, accelerate cell division and proliferation, provide good buffer environment for in vitro cell culture, and maintain stable pH of cells during long-term culture; the fish serum and the fish embryo extract are beneficial to improving the mitotic activity of cells in fish cell culture and can be one of key additives in the current culture medium; penicillin, streptomycin and amphotericin B increase antibacterial spectrum, and can effectively inhibit bacterial growth and prevent cell contamination, especially in primary culture.
Drawings
FIG. 1 is a photomicrograph of a cell line of large yellow croaker ovary tissue on day 2 of primary culture;
FIG. 2 is a photomicrograph of a cell line of large yellow croaker ovary tissue on day 5 of primary culture;
FIG. 3 is a photomicrograph of the subculture generation 1 of the large yellow croaker ovarian tissue cell line;
FIG. 4 is a photomicrograph of subculture generation 5 of the cell line of large yellow croaker ovary tissue;
FIG. 5 is a photomicrograph of a cell line of large yellow croaker ovary tissue subcultured at passage 10;
FIG. 6 is a photomicrograph of a cell line of a large yellow croaker ovary tissue subculture generation 20;
FIG. 7 is a photomicrograph of a cell line of large yellow croaker ovary tissue subcultured at passage 30;
FIG. 8 is a photomicrograph of a 40 th passage of the cell line of the large yellow croaker ovary tissue;
FIG. 9 is a photomicrograph of a subculture 50 th generation of a large yellow croaker ovarian tissue cell line;
FIG. 10 is a photomicrograph of a 60 th subculture of a large yellow croaker ovarian tissue cell line;
FIG. 11 is a photomicrograph of a cell line of large yellow croaker ovary tissue after thawing for 24 hours after cryopreservation;
FIG. 12 is a photomicrograph of a cell line of large yellow croaker ovary tissue after thawing for 72 hours after cryopreservation;
FIG. 13 is a photomicrograph of a large yellow croaker ovary tissue cell line after cryopreservation and recovery and then subculture;
FIG. 14 is the proliferation curve of large yellow croaker ovary tissue cell line at different passage ratios;
FIG. 15 identification and verification of ovary and testis cells of large yellow croaker;
o: ovarian tissue; LYCO: ovarian tissue cells; t: spermary tissue;
LYCTs: cells of the testis tissue; b: a brain; l: a liver;
s: spleen; k: the head and kidneys; h: heart
FIG. 16 is a chromosome map (100X) of a cell line of large yellow croaker ovary tissue;
FIG. 17 chromosome number distribution of large yellow croaker ovarian tissue cell line;
FIG. 18 status of Large yellow croaker ovarian cells after electrotransfection (in bright field);
FIG. 19 status of ovarian cells of large yellow croaker after electrotransfection (under fluorescence);
FIG. 20 is a photomicrograph of a cell line of large yellow croaker ovary tissue after being starved for 30 days;
FIG. 21 is a photomicrograph of a complete culture solution replaced for 36 hours after starvation treatment of a large yellow croaker ovarian tissue cell line;
FIG. 22 shows the survival number of cells after the treatment of conopeptide with different concentrations for 18 h;
FIG. 23 overexpressionNanogExpression of 48h pluripotency gene of gene;
FIG. 24 interferencefoxl2、cyp19aThe expression of sex-related genes after 48h of gene;
FIG. 25 is a photomicrograph of cultured cells of a rhubarb fish ovary tissue for 48 hours in different culture solutions;
a: cell B using complete broth 4: cells using basal medium 3;
c: cell D using basal medium 1: cells using basal medium 2;
FIG. 26 Effect of different serum concentrations on cell proliferation of large yellow croaker ovarian tissue.
Detailed Description
For better understanding of the present invention, the present invention is further described in detail with reference to the following examples and the accompanying drawings, but those skilled in the art will appreciate that the following examples are not intended to limit the scope of the present invention, and that any changes and modifications based on the present invention are within the scope of the present invention.
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1 establishment of cell line of Large yellow croaker ovary tissue
S1, as the large yellow croaker belongs to the genus Pseudosciaena and the family Caryophyllaceae is extremely sensitive to hypochlorite, the sterilizing seawater containing double antibiotics is adopted to replace hypochlorous acid disinfectant in the body surface sterilizing step. And temporarily culturing 7-month-old and 9-11 cm-long pseudosciaena crocea juvenile fish in sterilized seawater containing double antibiotics for 1-2 h. And 3-4 drops of eugenol are dropped when the fish turns over, the abdomen of the fish is upward, and no stress response is caused to the stimulation. And (4) erasing mucus on the surface of the fish body by using the sterilization gauze blocks. The body surface of the fish was rubbed 2 times with gauze soaked with 75% alcohol. The fish bodies were transferred to a clean bench, the ovarian tissue was removed by a dissector, and rinsed 3-4 times in PBS containing penicillin, streptomycin, and amphotericin B (100 mL of 100 Xconcentrated solution of 1 mL of three antibodies in PBS).
S2, dividing the ovary tissue block into two partsNo. 11 scalpel is cut into pieces of 1 mm in a crossed manner 3 Small tissue blocks of about the size. The cut tissue pieces were rinsed three times with PBS solution containing three antibodies. After rinsing, the small tissue pieces were transferred to a 15mL centrifuge tube, single cells were obtained by 0.25% trypsinization, and the digested cells were filtered through a 70 μm cell filter screen, transferred to a 15mL centrifuge tube, and cell pellets were collected, resuspended in 5mL of complete medium, and inoculated in 25cm of medium 2 In a cell culture flask, primary culture is started by culturing at a constant temperature of 27 ℃ and the complete culture solution is changed once every 2 to 3 days.
As shown in FIGS. 1 to 2, adherent cells adhered to the ovary tissue of large yellow croaker at 3 days after the initiation of primary culture (FIG. 1), and cells expanded to 70-80% by 5 days (FIG. 2).
S3, when the coverage rate of primary culture adherent cells of the large yellow croaker ovarian tissue cell line reaches 80-90% or higher, the primary cells may have obvious contact inhibition, and at the moment, subculture is started by a trypsin digestion method. Using a classical cell digestion procedure: removing the old culture solution in the original culture bottle; adding 5mL of PBS solution, and washing for 1 time to remove serum and divalent metal ions in the original culture solution (the substances greatly influence the digestion effect of trypsin); pouring out the PBS solution, adding 0.5 mL of 0.25% commercialized pancreatin digestive juice containing EDTA, shaking the bottle body to ensure that the pancreatin solution is fully contacted with the cells at the bottom layer, and pouring out the pancreatin digestive juice (the step is carried out quickly, otherwise, the excessive digestion is easily caused; enough solution for keeping the flat bottom wet is remained when removing the pancreatin digestive juice, otherwise, partial area of the bottom of the bottle is easily dried to influence the digestion); moving out the culture bottle, observing under an inverted microscope until most cells become round and release the adherent, immediately moving into a super clean bench, adding 5mL of serum-containing complete culture solution, and stopping digestion; blowing, examining the blowing effect under a microscope, and if the residual cells are too much, repeatedly digesting once; inoculating the cell suspension into a new culture bottle according to the proportion of 1:2-10, supplementing the culture solution to 5mL, placing the culture bottle at the constant temperature of 27 ℃ for culture, and then carrying out subculture once every 2-3 days. As shown in fig. 3 to 10, the large yellow croaker ovarian cell line is mainly long fibrous cells from the 1 st generation to the 60 th generation, and a few oval cells are often accompanied in the gaps between the fibrous cells.
Example 2 cryopreservation and recovery of Large yellow croaker ovarian tissue cell line
S1, freezing and storing: taking a bottle of 75cm 2 The large yellow croaker ovary tissue cell line cells which grow vigorously and are paved at the bottom of a culture bottle are collected by centrifugation by adopting a trypsinization method, 3 mL of prepared cell freezing solution is slowly added, the cells are lightly blown and beaten to be uniformly dispersed in the cell freezing solution, and the solution is transferred into a freezing tube by using a liquid transfer gun. The freezing tube is placed for 1 h at 4 ℃, then placed in a programmed gradient cooling freezing box (the temperature drop speed is 1 ℃/min), the freezing box is placed at-80 ℃ for 1 day, and finally the freezing tube is taken out and immersed in liquid nitrogen, so that the freezing tube can be frozen for a long time.
S2, taking the freezing tube out of the liquid nitrogen, quickly placing the freezing tube in a water bath kettle with the temperature (40 ℃) adjusted, and continuously shaking the freezing tube in the cell thawing process to quickly and uniformly thaw the freezing tube until the freezing tube is completely thawed. Transfer the thawed cell suspension to 25cm 2 In a centrifuge tube of a culture flask, 5mL of complete culture medium was filled in the flask, and 5% CO was added at 27 ℃ 2 And (5) culturing. After 24h, the complete culture medium was replaced with a new one, and the culture was continued.
As shown in FIG. 11, the adherence rate of the cell line of the large yellow croaker ovary tissue recovered for 24 hours after cryopreservation reaches 60-80%, and the cell morphology is not obviously different from that before cryopreservation; after being frozen and restored for 72 hours, the cells can grow to fill the bottom of the culture bottle as shown in FIG. 12; as shown in FIG. 13, the revived large yellow croaker ovary tissue cells can be normally passaged, and the morphology of the revived large yellow croaker ovary tissue cells is not different from that of the cells before cryopreservation and the cells after cryopreservation and revival.
Example 3 proliferation curves of large yellow croaker ovarian tissue cell line at different passage ratios
Selecting cells with good morphology and vigorous proliferation from the large yellow croaker ovary tissue cell line established in example 1, carrying out digestion passage, and respectively carrying out passage at a ratio of 1:2, 1:3, 1:5 and 1:10 to 25cm 2 Cell culture flasks (i.e., 4 flasks were filled with 2.5 mL, 1.6 mL, 1 mL, 0.5 mL of cell suspension, and the total volume of each flask was then made up to 5mL with culture medium). Pictures were taken every 24h from passage 24h,the number of observed cells in a visual field is counted by inverted microscopic shooting of cultured cells by adopting a classical five-point cross sampling method, and the total sum of the number of observed cells of 5 points in each group is used for mapping analysis.
As shown in fig. 14, for the large yellow croaker ovarian tissue cell line, different passage ratios greatly affect the cells, and the proliferation of the rest groups except for the 1:2 and 1:3 passage groups is very slow. The total number of adherent at the end of the first day was proportional to the density of inoculation, after which all but 1:2 groups proliferated at a slower rate.
Example 4 identification and validation of cell line of ovary tissue of large yellow croaker
Using RT-PCR technology to identify the large yellow croaker ovary tissue cell line as shown in FIG. 15;
the COI gene (the upstream primer sequence (5 '-3') is CCTTCTTTCCTACTGCTC, the downstream primer sequence (5 '-3') is TGTATTCAGATTGCGGTCA) is amplified in each tissue, and after tapping and purification, the sequence comparison result of the sequencing sequence and the NCBI large yellow croaker COI gene is more than 98%;
the foxl2 gene (the upstream primer sequence (5 '-3') is TCAGCAAGTTTCCCTTCTATG, the downstream primer sequence (5 '-3') is CGCCGAGTGTTTGGTCTC), has obvious expression in ovary and ovary cells, and the sequencing comparison ratio of PCR products is 99%;
the dmrt1 gene (with the forward primer sequence (5 '-3') being ATGAGCAAGGACAAGCCGAACAAG and the reverse primer sequence (5 '-3') being CAGCGTGGACATCAGAGTT) was not expressed in both ovarian and ovarian cells, indicating that LYCO cells were derived from ovarian cells.
Example 5 chromosome analysis of cell line of ovary tissue of large yellow croaker
Taking ovary tissue cells of large yellow croaker with vigorous division, and inoculating to 75cm 2 And (3) adding colchicine with the final concentration of 20 mu g/mL into the cell culture bottle when the cell growth is in the logarithmic phase, continuously culturing for 6-8 h, and collecting the cells to obtain cell suspension. Transferring the cell suspension to a 15mL centrifuge tube, centrifuging for 10 min at 1000 g, gently sucking out the supernatant, and adding 4 mL of 0.075M KCl for hypotonic for 30 min; adding 0.5 mL of freshly prepared Carnoy's fixative for pre-fixation for 10 min, and centrifuging at 2000 g for 10 min; 0.5 mL of cell pellet was addedCarnot's fixative, resuspending the pellet with pipette; then adding 1 mL of stationary liquid; dropping a 30 cm height drop onto a glass slide (pretreated at-20 ℃), horizontally placing to thoroughly spread it, and drying at 65 ℃; then immersing the glass slide into a dye vat containing Giemsa dye liquor working solution for dyeing for 10 min, flushing with double distilled water to remove dregs on the surface of the glass slide, drying, sealing the glass slide by neutral resin, and observing and counting by 1000X oil lens.
As shown in fig. 16 and 17, 79% of chromosomes of the observed division phase cell number was 48 in the chromosome analysis of the large yellow croaker ovarian tissue cell line;
example 6 transfection of cell line of Large yellow croaker ovarian tissue pEGFP-N1 plasmid
S1, preparing competent bacterial cells: adopts Escherichia coli DH5 alpha strain, adopts classic calcium chloride method to prepare competent cells, and is preserved for a long time at-80 ℃.
S2, plasmid transformation: 1 ng of the DNA solution was placed in an EP tube and placed in an ice bath. 100 μ L of competent bacterial suspension was taken out of the freezer at-80 deg.C, rapidly dissolved, added to the DNA solution, and ice-cooled for 10 min. Water bath at 42 deg.c for 2 min. The EP tubes were incubated at 37 ℃ for 1 h at 220 rpm. And then coating the transformed bacterial liquid on an LB solid culture plate containing antibiotics.
S3, plasmid preparation: the Plasmid pEGFP-N1 was extracted according to the HiPure Plasmid maxiPrep Kit Plasmid Large extract Kit (TransGene Co.) instructions and stored at-20 ℃.
S4, transfecting cells: taking the vigorous growth pseudosciaena crocea ovary tissue cell line cells, and changing the liquid in the evening before the cells are electrically transferred when the cell coverage rate reaches 70% -80%, wherein the liquid does not contain double antibodies. Cells were digested with pancreatin at 37 ℃ and the suspended cells were collected in a 15mL centrifuge tube. The cells are collected by centrifugation, and the rotation speed is controlled to be about 800-1000 revolutions. Centrifuging for 3-5min, and discarding supernatant. The cells were resuspended well by pipetting 2mL of OPTI-MEM I, and centrifuged again to collect the cells. The supernatant was discarded. The same volume of OPTI-MEM I was added, the cells were suspended and a second centrifugation was performed to collect the cells. After completion, the supernatant was discarded and suspended 1X10 in 25ul Opti MEM I 6 Such that the resistance reaches 200 ohms. Cells were well suspended, plasmid was added, 5 μ g of plasmid was added per gap =2mm electrode cup; mix thoroughlyHomogenizing the cells, and subpackaging into electrode cups, wherein each electrode cup is 26 ul. And setting a program and carrying out an electrotransfer experiment. At 27 ℃ 5% CO 2 Cells were cultured normally in a constant temperature incubator until analysis was observed and photographed after 48 h. As shown in FIGS. 18 and 19, at 48h after transfection, green fluorescence was detected under a fluorescence microscope, and the pEGFP-N1 plasmid was expressed in this cell line. The established large yellow croaker ovary tissue cell line can adapt to the transfection experiment of the exogenous gene.
Example 7 starvation treatment of a large yellow croaker ovarian cell line
Taking large yellow croaker ovary tissue cells with the cell coverage rate of 80-100%, replacing the culture solution with complete culture solution at 27 ℃ and 5% CO 2 After incubation for 30 d, the color of the broth was found to change from orange to light yellow, indicating that the nutrients in the broth were largely consumed. Observing the cell morphology of the large yellow croaker ovary tissue under a microscope, as shown in FIG. 20, a large number of cells are detached from the wall to form a cavity; the refractivity of part of cells is enhanced under the observation of a microscope because the cells shrink due to nutrition consumption; the cells still have more cells to survive and the morphology is unchanged. As shown in FIG. 21, after the complete culture medium was replenished again, the surviving cells were proliferated again, and the cells still showed vigorous division and no change in morphology.
Example 8 Effect of conopeptides on cell proliferation of Large yellow croaker ovarian cell line
Selecting cells with good morphology and vigorous proliferation from the large yellow croaker ovary tissue cell line established in the example 1, digesting and collecting the cells, adding 1 mL of culture solution to gently blow and beat the cell precipitates to prepare cell suspension, sucking 10 microliter of the cell suspension into a 0.2 mL sterile centrifuge tube, adding 10 microliter of 0.4% trypan blue staining solution, and blowing, beating and mixing uniformly; 10. mu.L of each cell staining mixture was aspirated into the A and B ends of the Countess II cell counter, and the concentration was adjusted to 1X10 per well using the Countess II cell counter 4 Respectively inoculating 250 mu L of cells into 48-well plates at 27 ℃, and culturing for 6h to make the suspension cells adhere to the wall; adding 10 μ L of conopeptide (0, 5 μ g/mL, 10 μ g/mL, 20 μ g/mL, 40 μ g/mL, 80 μ g/mL) at different concentrations for 6h, and repeating the samples at each concentration for 3 times; setting negativeComparison: add 10. mu.L PBS, 3 replicates; after the incubator continued culturing for 18 hours, the cells were collected, and a cell staining solution was prepared by the above cell staining method, and the amount of cell survival was counted by using a Countess II cell counter.
As shown in FIG. 22, when the concentration of added conopeptides is gradually increased, the more obvious the effect on cell proliferation is, the number of survival cells is inversely proportional to the concentration of the conopeptides, and 80 μ g/mL of the conopeptides obviously inhibits the cell proliferation and even leads to the death of inoculated cells.
Example 9 overexpression of Nanog Gene affects expression of related pluripotency genes
S1, plasmid preparation: the pNanog-N1 Plasmid was extracted according to the instructions of HiPure Plasmid maxiPrep Kit (TransGene Co.) and stored at-20 ℃.
S2, transfecting cells: the vigorously growing cells of the large yellow croaker ovarian tissue cell line were taken, and the electrotransfection experiment and 6 parallel experiments were performed according to the electrotransfection procedure and setting procedure in example 6.
S3, real-time fluorescent quantitative PCR (RT-qPCR): in the experiment, a Total RNA Kit II (R6934-01) Kit is used for extracting RNA, and the RNA of the cells after electrotransformation and the RNA of the normal cells without electrotransformation are respectively extracted; accurately calculating and sucking 3 mu g as a template for reverse transcription according to the total RNA concentration of each sample by referring to the instruction of a RevertAID First Strand cDNA Synthesis Kit (Thermo Scientific) reverse transcription Kit; respectively analyzing 8 kinds of pluripotency genes by RT-qPCR technologySox2、Oct4、cMyc、Klf4、Esrrb、Gata6、Hand1、Gcnf) Expression profile in two groups of cells.β-actinAs internal reference primers, there were 6 biological replicates per cell group in this experiment, and 3 technical replicates per sample.
As shown in FIG. 23NanogGenetic ovarian cellsSox2AndOct4the expression of the protein is obviously improved,cMyc、Klf4andEsrrbthe expression of the gene is obviously increased; and thenGata6、Hand1、GcnfThe expression of (b) is obviously reduced; indicating overexpressionNanogThe genes have an effect on the regulation of expression of these pluripotency genesThe cell line can be used for analyzing expression regulation of related genes.
Example 10 dsRNA interference experiments to verify expression of related genes
S1.dsRNA preparation: according to transcription factorsfoxl2Andcyp19arespectively designing dsRNA primers in the full length, respectively designing the amplification lengths of 298 bp and 302 bp, respectively inserting the amplified lengths into PMD19-T plasmids, respectively preparing linearized DNA by taking a plasmid with correct sequencing as a template, preparing ss RNA through in vitro transcription, equivalently mixing the dissolved forward and reverse ssRNA, and then placing the mixture into a PCR instrument, wherein the reaction parameters are as follows: at 75 ℃ for 15 min, at 65 ℃ for 15 min, and finally, at 0.2 ℃/s, reducing the temperature to 25 ℃, detecting the quality and the size of dsRNA by using 1% agarose gel electrophoresis, and simultaneously, measuring the concentration by using an ultraviolet spectrophotometer and completely diluting to 1 mu g/mu L; to the remaining samples was added RNase in an amount of 1. mu.L and stored at-80 ℃ for subsequent interferent experiments.
S2, transfecting cells: the vigorous growth cell line cells of the large yellow croaker ovary tissue are taken, the electrotransfection step and the setting procedure are carried out according to the embodiment 6, and 6 parallel experiments are set.
S3, real-time fluorescent quantitative PCR (RT-qPCR): in the experiment, a Total RNA Kit II (R6934-01) Kit is used for extracting RNA, and the RNA of the cells after electrotransformation and the RNA of the normal cells without electrotransformation are respectively extracted; accurately calculating and sucking 3 mu g as a template for reverse transcription according to the total RNA concentration of each sample by referring to the instruction of a RevertAID First Strand cDNA Synthesis Kit (Thermo Scientific) reverse transcription Kit; respectively analyzing 8 individual correlative genes by adopting RT-qPCR technology (amh、dmrt2、dmrt1、foxl2、cyp19a、sox3、sox9、hsd3b7) Expression in three groups of cells. Beta-actin is used as an internal reference primer, each group of cells in the experiment has 6 biological repetitions, and each sample is subjected to 3 technical repetitions.
As figure 17 disturbsfoxl2Genetic ovarian tissue celldmrt1、dmrt2Andamhthe expression of (A) is more remarkable,sox9the expression of the gene is obviously increased; and thenfoxl2、cyp19aThe expression level of (A) is obviously reduced,sox3、hsd3b7the expression level of (2) is relatively decreased. In addition, disturbcyp19aGene ovarian groupTissue cellcyp19a、foxl2Andsox3the expression level of (a) is significantly reduced,hsd3b7the expression of (a) is also reduced; whiledmrt1、dmrt2、amhAndsox9the expression level of (A) is obviously increased.
The interference result shows that the cell line can be used for gene editing and other regulation and function analysis of related genes.
Example 11 culture broth optimization
Optimizing the culture solution:
complete culture solution 1 (based on L-15 culture solution, including final concentrations of 5% fetal bovine serum FBS, 0.5 ‰ beta-mercaptoethanol, 50 μ g/mL N-acetylglucosamine, 50 μ g/mL sodium carboxymethylcellulose, 10 μ g/L human FGF-basic, 5 μ g/L human EGF, 1 μ g/L human HGF, 100 IU/mL penicillin, 100 μ g/mL streptomycin, 100 IU/mL amphotericin B, 1% blood serum of large yellow croaker, and 1% embryo extract of large yellow croaker);
complete culture solution 2 (based on L-15 culture solution, including final concentrations of 10% fetal bovine serum FBS, 0.5 ‰ beta-mercaptoethanol, 50 μ g/mL N-acetylglucosamine, 50 μ g/mL sodium carboxymethylcellulose, 10 μ g/L human FGF-basic, 5 μ g/L human EGF, 1 μ g/L human HGF, 100 IU/mL penicillin, 100 μ g/mL streptomycin, 100 IU/mL amphotericin B, 1% large yellow croaker serum, and 1% large yellow croaker embryo extract);
complete culture solution 3 (based on L-15 culture solution, including 15% fetal bovine serum FBS, 0.5 ‰ beta-mercaptoethanol, 50 μ g/mL N-acetylglucosamine, 50 μ g/mL carboxymethylcellulose sodium, 10 μ g/L human FGF-basic, 5 μ g/L human EGF, 1 μ g/L human HGF, 100 IU/mL penicillin, 100 μ g/mL streptomycin and 100 IU/mL amphotericin B, 1% large yellow croaker serum and 1% large yellow croaker embryo extract at final concentration);
complete culture solution 4 (based on L-15 culture solution, including final concentrations of 16.7% fetal bovine serum FBS, 0.5 ‰ beta-mercaptoethanol, 50 μ g/mL N-acetylglucosamine, 50 μ g/mL sodium carboxymethylcellulose, 10 μ g/L human FGF-basic, 5 μ g/L human EGF, 1 μ g/L human HGF, 100 IU/mL penicillin, 100 μ g/mL streptomycin, and 100 IU/mL amphotericin B, 1% blood serum and 1% embryo extract of large yellow croaker);
a complete culture solution 5 (based on L-15 culture solution, including 20% fetal bovine serum FBS, 0.5 ‰ beta-mercaptoethanol, 50 μ g/mL N-acetylglucosamine, 50 μ g/mL carboxymethylcellulose sodium, 10 μ g/L human FGF-basic, 5 μ g/L human EGF, 1 μ g/L human HGF, 100 IU/mL penicillin, 100 μ g/mL streptomycin, 100 IU/mL amphotericin B, 1% large yellow croaker serum and 1% large yellow croaker embryo extract at final concentrations);
basal medium 1 (based on L-15 medium, including final concentrations of 16.7% FBS, 0.5 ‰ beta-mercaptoethanol, 50 μ g/mL N-acetylglucosamine, 50 μ g/mL sodium carboxymethylcellulose, 100 IU/mL penicillin, 100 μ g/mL streptomycin, and 100 IU/mL amphotericin B, respectively);
basal medium 2 (based on L-15 medium, including final concentrations of 10% FBS, 0.5 ‰ beta-mercaptoethanol, 50 μ g/mL N-acetylglucosamine, 50 μ g/mL sodium carboxymethylcellulose, 100 IU/mL penicillin, 100 μ g/mL streptomycin, and 100 IU/mL amphotericin B, respectively);
basal medium 3 (based on L-15 medium, including final concentrations of 16.7% FBS, 0.5 ‰ beta-mercaptoethanol, 50 μ g/mL N-acetylglucosamine, 50 μ g/mL sodium carboxymethylcellulose, 10 μ g/L human FGF-basic, 5 μ g/L human EGF, 1 μ g/L human HGF, 100 IU/mL penicillin, 100 μ g/mL streptomycin, and 100 IU/mL amphotericin B, respectively);
the cells with good growth condition of the ovarian tissue cell line are processed according to the proportion of 1 × 10 5 Respectively inoculating to 25cm 2 In a cell culture flask, the growth condition of the cells is observed by a microscope for 48 h.
Preparing culture solution containing fetal bovine serum FBS (such as above complete culture solution 1-5) with concentration of 5%, 10%, 15%, 16.7%, and 20%, respectively, collecting ovary tissue cells of Pseudosciaena crocea in good morphology, and culturing at a ratio of 1 × 10 4 The cells were inoculated into 6-well plates, incubated for an additional 48h, digested and harvested, counted using a Countess II cell counter, and plotted for 6 replicates at each concentration.
As shown in FIG. 25, the cells using complete medium 4 (FIG. 25A) grew best and cell expansion became evident; the cells using basal medium 3 (FIG. 25B) had the next growth but less cell expansion than the cells using complete medium 1, and it was presumed that the addition of 1% of large yellow croaker serum and 1% of large yellow croaker embryo extract promoted cell proliferation; the cells using basal medium 1 (FIG. 25C) had a good growth status, which was not as good as the cells using complete medium 4 and the cells using basal medium 3, and it was presumed that the addition of three growth factors, human FGF-basic, human EGF and human HGF, promoted the growth of the cells; while the cells using basal medium 2 (FIG. 25D) had the worst growth and no significant expansion, the number of cells was significantly less than that of the cells cultured in the first three media, and it was presumed that the lower concentration of serum also affected the proliferation of the cells. As shown in fig. 26, it can be seen that the proliferation amount of the cells is proportional to the serum concentration, the proliferation amounts of the cells are obvious in 15%, 16.7% and 20%, the proliferation amounts of the cells cultured under the serum concentration of 5% and 10% are slow, and the proliferation amounts of the cells cultured under the serum concentration of 16.7% and 20% are not obviously different, so that the basal medium containing 15-20% of fetal bovine serum FBS is recommended.
Although specific embodiments of the invention have been described above, it will be understood by those skilled in the art that the specific embodiments described are illustrative only and are not limiting upon the scope of the invention, and that equivalent modifications and variations can be made by those skilled in the art without departing from the spirit of the invention, which is to be limited only by the appended claims.
Claims (3)
1. The cell line of the large yellow croaker ovary tissue is characterized in that the cell line of the large yellow croaker ovary tissue is a large yellow croaker ovary tissue cell line LYCO, the cell line is preserved in China Center for Type Culture Collection (CCTCC) at 2021 year, 1 month and 23 days, and the preservation number is CCTCC NO: C202117.
2. the use of the cell line of large yellow croaker ovary tissue of claim 1 in the study of the functional gene related to the gonad development of large yellow croaker.
3. The use of the cell line of large yellow croaker ovarian tissue of claim 1 in pharmacology, gene screening, gene editing and functional analysis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110272549.6A CN112877277B (en) | 2021-03-12 | 2021-03-12 | Large yellow croaker ovary tissue cell line and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110272549.6A CN112877277B (en) | 2021-03-12 | 2021-03-12 | Large yellow croaker ovary tissue cell line and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112877277A CN112877277A (en) | 2021-06-01 |
| CN112877277B true CN112877277B (en) | 2022-09-23 |
Family
ID=76041527
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110272549.6A Active CN112877277B (en) | 2021-03-12 | 2021-03-12 | Large yellow croaker ovary tissue cell line and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112877277B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113621553B (en) * | 2021-07-06 | 2023-06-30 | 福建农林大学 | Fugu bifidus ovary tissue cell line and application thereof |
| CN114107181B (en) * | 2021-11-19 | 2023-06-23 | 中国水产科学研究院黄海水产研究所 | Sturgeon embryo cell line, culture medium and preparation method thereof |
| CN114717176B (en) * | 2021-12-30 | 2023-07-21 | 福建农林大学 | Fugu bifidus spermary tissue cell line and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104031935A (en) * | 2014-05-23 | 2014-09-10 | 宁波大学 | Intracellular expression method of large yellow croaker liver expression antibacterial peptide LEAP-2C in pichia pastoris |
| JP2018203662A (en) * | 2017-06-02 | 2018-12-27 | 国立大学法人東京海洋大学 | Germ cell tracking antibody |
| CN111802536A (en) * | 2020-07-31 | 2020-10-23 | 福建傲农生物科技集团股份有限公司 | Feed additive for large yellow croaker female fish and preparation method and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667176B (en) * | 2013-12-09 | 2015-03-04 | 中国水产科学研究院长江水产研究所 | Carassius auratus gibelio brain tissue cell line sensitive to cyprinid herpesvirus II, and establishing method and application thereof |
| CN104004706A (en) * | 2013-12-19 | 2014-08-27 | 集美大学 | Pseudosciaena crocea brain cell line and establishing method thereof |
| CN103756952B (en) * | 2014-01-09 | 2016-08-17 | 中国水产科学研究院黄海水产研究所 | The structure of a kind of Cynoglossus semilaevis ovary cell line and application process |
-
2021
- 2021-03-12 CN CN202110272549.6A patent/CN112877277B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104031935A (en) * | 2014-05-23 | 2014-09-10 | 宁波大学 | Intracellular expression method of large yellow croaker liver expression antibacterial peptide LEAP-2C in pichia pastoris |
| JP2018203662A (en) * | 2017-06-02 | 2018-12-27 | 国立大学法人東京海洋大学 | Germ cell tracking antibody |
| CN111802536A (en) * | 2020-07-31 | 2020-10-23 | 福建傲农生物科技集团股份有限公司 | Feed additive for large yellow croaker female fish and preparation method and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| "大黄鱼性腺原代细胞培养技术的建立";郭一兰等;《集美大学学报》;20200930;321-327 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112877277A (en) | 2021-06-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112877277B (en) | Large yellow croaker ovary tissue cell line and application thereof | |
| CN112852716B (en) | Cell line of testis tissue of large yellow croaker and application thereof | |
| LU502505B1 (en) | Immortalized yak rumen epithelial cell line and construction method thereof | |
| CN114317443B (en) | Breast cancer organoid culture solution, and culture reagent combination and culture method thereof | |
| CN113621553B (en) | Fugu bifidus ovary tissue cell line and application thereof | |
| CN114292816B (en) | Lung cancer organoid culture solution, and culture reagent combination and culture method thereof | |
| CN112410290B (en) | Lateolabrax japonicus myocardial fibroblast line and application thereof | |
| CN111154763A (en) | Application of long-chain non-coding RNA lncMGPF in regulation and control of pig muscle development function | |
| CN110499280B (en) | In-vitro construction method of Acipenser parvum thecal cell line and reagent used by same | |
| CN116355898A (en) | Application of miRNA-133 in regulation of sheep embryo hair follicle development | |
| CN110511903A (en) | A kind of Study on Molecular Mechanism method and its application of miR-21-5p targeting Smad7 regulation pig ovary granular cell | |
| CN114317419A (en) | Method for constructing muscle cell line of Gymnocypris przewalskii | |
| CN109030131A (en) | A kind of refined dragonfish method of chromosome preparation | |
| CN109207422B (en) | European eel kidney cell line EK and application thereof | |
| CN115851972B (en) | Sheep hair follicle development marker miR-23b and application thereof | |
| CN115531297B (en) | Injectable hydrogel system loaded with platelet-rich plasma and umbilical cord mesenchymal stem cell spheres, and preparation method and application thereof | |
| CN115141796B (en) | Culture medium for grouper germ stem cells and long-term culture method thereof | |
| CN114107181B (en) | Sturgeon embryo cell line, culture medium and preparation method thereof | |
| CN114717184A (en) | Paralichthys olivaceus spermatogonial stem cell culture solution and method for establishing Paralichthys olivaceus spermatogonial stem cell line | |
| CN114717176B (en) | Fugu bifidus spermary tissue cell line and application thereof | |
| CN109402178B (en) | Efficient reprogramming method and application of mouse spermatogonial stem cells | |
| CN114807011B (en) | Fugu obscurus spermary cell line and construction method and application thereof | |
| CN111727934A (en) | Short-period efficient full-male Chinese softshell turtle seedling breeding method | |
| NL2034683B1 (en) | Application of shandong black cattle skeletal muscle differentiation regulatory gene loc112441863 | |
| CN111808823B (en) | Establishment method and application of sheep endometrial epithelial cell line |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |