CN104031935A - Intracellular expression method of large yellow croaker liver expression antibacterial peptide LEAP-2C in pichia pastoris - Google Patents
Intracellular expression method of large yellow croaker liver expression antibacterial peptide LEAP-2C in pichia pastoris Download PDFInfo
- Publication number
- CN104031935A CN104031935A CN201410221810.XA CN201410221810A CN104031935A CN 104031935 A CN104031935 A CN 104031935A CN 201410221810 A CN201410221810 A CN 201410221810A CN 104031935 A CN104031935 A CN 104031935A
- Authority
- CN
- China
- Prior art keywords
- leap
- yellow croaker
- large yellow
- expression
- pao815
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses an intracellular expression method of large yellow croaker liver expression antibacterial peptide LEAP-2C in pichia pastoris. The method is characterized by comprising the following steps: constructing a recombinant expression vector of a large yellow croaker LEAP-2C gene (Accession Number: KJ024789); constructing a multi-copy expression box LEAP-2C/pAO815; introducing the recombinant expression vector into the pichia pastoris GS115 in an electric shock manner after digestion linearization; performing chromocytometry and recon screening so as to obtain a recombinant engineering strain; finally performing flask-shaking fermentation enlarged culture and methanol induction to realize the intracellular expression of the recombinant large yellow croaker LEAP-2C. The method has the advantages that the expression level is high, the production cost is low, the yield is high, and the large yellow croaker LEAP-2C yeast expression product can be applied to fodder additives for aquaculture and new antibacterial drugs.
Description
Technical field
The present invention relates to Cecropin Biotechnology field, especially relate to a kind of large yellow croaker liver and express the intracellular expression method of antibacterial peptide LEAP-2C in pichia spp.
Background technology
Antibacterial peptide in animal body is the important component part of innate immune system.Thereby on the one hand it as endogenous antibiont can be directly antibacterial or in the intracellular toxin reaction that reduces inflammation; Antibacterial peptide also can pass through chemotactic white corpuscle on the other hand, and regulating and controlling its activity affects host's autoimmunization system, thus performance provide protection.Antibacterial peptides itself different from microbiotic are a kind of small proteins that derives from cultivated animals, and animal is very low to its rejection, and after bacteriostatic action performs to certain degree, the proteolytic enzyme in animal body can be degraded antibacterial peptide.According to the charge property carrying, can be divided into cationic antibacterial peptide (cationic AMPs, CAMPs), Anionic Antimicrobial Peptides (anionic AMPs, AAMPs) and neutral antibacterial peptide (neutral AMPs, NAMPs).Wherein CAMPs is a class larger in known AMPs, research shows, some CAMPs, except bacterium, fungi, virus, protozoon and cancer cells etc. are had good direct inhibition or lethal effect, also participate in the immunologic processes such as immunomodulatory, immuno-stimulating, anti-inflammatory and immunosuppression.In recent years, Chinese scholars from aquatic animal isolation identification the multiple CAMPs such as cathelicidin, defensin, epinecidin-1 and hepcidin.
All there is greatest differences with function in its expression of several antibacterial peptides of having found in large yellow croaker at present.Hepcidin, this antibacterial peptide, mainly in renal expression, mainly has resistance to specific vibrio marinopraesens, and has iron metabolism regulation activity.Piscidin mainly expresses at the gill, mainly parasite is produced to killing action.It is the one of CAMPs that liver is expressed antibacterial peptide 2 (liver-expressed antimicrobial peptide 2, LEAP-2), results from liver and participates in the blood circulation in body.It was found in human blood ultrafiltrated early than 2003, had broad spectrum antibiotic activity, may pass through to destroy bacterial cell film integrality, or gathered in tenuigenin by permeates cell membranes and be combined with nucleic acid, finally caused bacterium death.Large yellow croaker LEAP-2 mainly expresses in blood, and bacterium and fungi are all had to killing action.Therefore, the LEAP-2 of aquatic animal large yellow croaker is developed to antimicrobial product, not only can be used for preventing and treating aquatic products disease, also will reduce microbiotic and pollute and improve aquatic product quality, in aquaculture safety in production, there is potential application prospect.
LEAP-2C albumen (accession number: KJ024789) is a hypotype of LEAP-2, molecular weight is 9.08 kDa, although the preparation of LEAP-2C can separation and purification from serum, but because serum is few, content is low, if from serum separation and Extraction LEAP-2C albumen, output is extremely low, cost is high, cannot meet the actual requirement of aquaculture application.In heterologous gene expression system, prokaryotic expression system output is high, and cost is low, but has significant deficiency for expressing eukaryotic gene, and because the processing lacking after translation is modified, the biologic activity of expression product tends to be affected.Chinese hamster ovary cell expression system in eukaryotic expression system, activity is higher, but yields poorly, and cell cultures cost is very high.Pichia pastoris phaff in eukaryotic expression system (
pichia pastoris) expression system, expression amount is large, and recombinant protein biologic activity is high, is one of idealized system of expressing eukaryotic gene.Be showed no at present the report that adopts Pichia anomala expression to prepare large yellow croaker LEAP-2C both at home and abroad.
Summary of the invention
Technical problem to be solved by this invention is to provide the large yellow croaker liver that a kind of expression level is high, production cost is low and output is high and expresses intracellular expression method and the application thereof of antibacterial peptide LEAP-2C in pichia spp, and this liver is expressed antibacterial peptide LEAP-2C protein fermentation product and can be applicable in aquaculture feed additive and antibacterial new drug.
The present invention solves the problems of the technologies described above adopted technical scheme: large yellow croaker liver is expressed the intracellular expression method of antibacterial peptide LEAP-2C in pichia spp, and large yellow croaker LEAP-2C gene is inserted in extracellular expression carrier pAO815 and builds multiple copied expression vector; After linearization for enzyme restriction, electric shock imports in Pichia pastoris GS115, obtains recombinant strain; Through shake flask fermentation and methanol induction, realize the intracellular expression of restructuring large yellow croaker LEAP-2C, concrete steps are as follows:
(1) build recombinant expression plasmid
Extracting large yellow croaker hepatic tissue mRNA, the synthetic large yellow croaker LEAP-2C(accession number of reverse transcription is KJ024789), carry out the gene mature peptide region (Ser42-Ser79) of pcr amplification large yellow croaker LEAP-2C albumen as template design primer, by restriction enzyme Eco RI single endonuclease digestion for the pcr amplification product containing large yellow croaker LEAP-2C gene, PCR product after enzyme is cut with same restrictions restriction endonuclease Eco RI single endonuclease digestion plasmid pAO815 ligase enzyme be connected, transform in bacillus coli DH 5 alpha, obtain recombinant expression plasmid LEAP-2C/pAO815;
(2) structure of multiple copy expression cassette LEAP-2C/pAO815
The recombinant plasmid LEAP-2C/pAO815 building, through Bgl II and BamH I double digestion, is obtained to gene fragment AOX-LEAP-2C; Simultaneously by recombinant plasmid LEAP-2C/pAO815 after B amH I single endonuclease digestion, alkaline phosphatase treatment dephosphorylation, endonuclease bamhi AOX-LEAP-2C is inserted in dephosphorylized LEAP-2C/pAO815, transform after intestinal bacteria (E. coli) DH5 α, with Bgl II and BamH I double digestion, obtain recombinant plasmid 2 and copy expression cassette 2 (AOX-LEAP-2C)/pAO815, repeat aforesaid method, obtain multiple copy expression cassette recombinant plasmid n (AOX-LEAP-2C)/pAO815;
(3) conversion of pichia spp recon
By multiple copy expression cassette recombinant plasmid n (AOX-LEAP-2C)/pAO815 after Sa l I linearization for enzyme restriction, after competence Pichia pastoris GS115 cell is mixed in 16ul:1ug ratio with linearizing recombinant expression plasmid n (AOX-LEAP-2C)/pAO815, shock by electricity to transform and obtain transformant, transformant is cultivated to 2 ~ 4 d in 30 DEG C, grow faster 8 of macrocolonies of picking, through G418 screening and PCR qualification, positive colony is recombinant bacterial strain n (AOX-LEAP-2C)/pAO815-GS115; Recombinant strain n (the AOX-LEAP-2C)/pAO815-GS115 obtaining is inoculated in BMGY substratum, be cultured to OD600 and reach 2.0-6.0 collecting cell, be resuspended in BMMY substratum, add methyl alcohol to final concentration 1.0% abduction delivering every 24 h;
(4) protein determination of LEAP-2C and recombinant screen
Collect recombinant strain n (the AOX-LEAP-2C)/pAO815-GS115 suspension of different incubation time points, after ultrasonication, obtain restructuring large yellow croaker LEAP-2C Yeast protein sample, detect the protein content of large yellow croaker LEAP-2C in restructuring large yellow croaker LEAP-2C Yeast protein sample with ELISA, the highest bacterial strain of screening LEAP-2C protein expression content, obtains high expression level recombinant strain;
(5) high expression level yeast strain enlarged culturing
High expression level recombinant strain is inoculated in to the growth of BMGY substratum, cultivate 22-26h until OD600 reaches 2.0-4.0 for 30 DEG C, 1500rpm is centrifugal, and 5 min collect thalline, then thalline is proceeded to and in BMMY substratum, carries out methanol induction expression by 5-20wt% inoculum size, under the condition of pH 5.4-7.0,30 DEG C are continued to cultivate 96 hours, every 24 h add a methyl alcohol to methyl alcohol final concentration 0.5-5%, make pichia spp intracellular expression large yellow croaker LEAP-2C albumen, obtain the tunning of restructuring large yellow croaker LEAP-2C albumen.
In step (1), pcr amplification primer sequence is as follows:
Forward amplimer is: GGAATTCTCACTTCTATGGCGTTGGAA
Oppositely amplimer is: GGAATTCTCAGCTGGAGATCCAGAAAG.
In step (3), the preparation method of competence Pichia pastoris GS115 cell is as follows: Pichia pastoris GS115 is inoculated in YPD substratum, 30 DEG C of shaking culture are spent the night, get 0.5 ml cultured products, be inoculated into fresh YPD substratum, cultivate and reach 1.3-1.5 to OD600, the centrifugal supernatant that goes, respectively washes once with precooling sterilized water and the aseptic sorbyl alcohol of 1 mol/L, finally suspend with aseptic sorbyl alcohol 1 ml of 1 mol/L, obtain GS115 competence pichia spp.
Electric shock transforms the detailed process that obtains transformant and is in step (3): after getting competence Pichia pastoris GS115 cell 96 μ l and linearizing recombinant expression plasmid 6 μ g and being placed in and transforming and glass mix, conversion cup is placed in to ice bath to be kept 5 min shock by electricity transforming obtaining transformant, electroporation conversion electric shock condition: voltage 1500V; Electric capacity 25 μ F; Burst lengths 10 ms, once electric shock; After electric shock, transform in electric shock the Sorbitol Solution USP that adds 1 mol/L of 4 DEG C of precoolings of 1 ml in cup at once, use the piping and druming of micropipette rifle evenly to obtain transformant, be placed in ice bath for subsequent use.
The substratum that transformant described in step (3) adopts in the process of 30 DEG C of cultivation 2 ~ 4 d is 30 DEG C and is dried to the half-dried MD culture medium flat plate in surface.
In step (4), in ELISA detection restructuring large yellow croaker LEAP-2C Yeast protein sample, the detailed process of the protein content of large yellow croaker LEAP-2C is: ELISA microplate adopts the coated protein binding ability that increases of poly-lysine, then in each hole of ELISA microplate, add the restructuring large yellow croaker LEAP-2C Yeast protein sample of 100 times of dilutions, overnight incubation, the fish glue of employing 5% seals non-binding site, then anti-mouse LEAP-2C antibody is joined in each hole of ELISA microplate, hatch 1 h and wash three times, again by anti-the joining in each hole of ELISA microplate of anti-alkali phosphatase enzyme mark rabbit mouse two, hatch 1 h and wash three times, finally adopt ELISA microplate that alkaline phosphatase enzyme reaction substrate system completes reaction to detect the optical density(OD) of 405 nm wavelength in microplate reader, screen the highest restructuring yeast strains of LEAP-2C expression contents by the large yellow croaker LEAP-2C detecting in yeast split product, it is high expression level recombinant strain.
In step (5), the optimum condition of high expression level recombinant strain enlarged culturing is: methyl alcohol final concentration 1.0%, pH 6.6, inoculum size 10wt%.
Compared with prior art, the invention has the advantages that: the present invention has proposed first a kind of large yellow croaker LEAP-2C albumen and in pichia spp, obtained expression method, specifically express large yellow croaker LEAP-2C by obtaining the fermentation of pichia spp recombinant strain and inducement efficient.The present invention selects pichia spp intracellular expression system expression, and intracellular expression level reaches 102.2 mg/L left and right.This large yellow croaker LEAP-2C has broad-spectrum antimicrobial vigor, therefore adopts pichia spp great expression large yellow croaker LEAP-2C, can be used for the interpolation of large yellow croaker feed or further LEAP-2C protein purification for pharmacy.
In its preparation process, the recombinant plasmid LEAP-2C/pAO815 of structure is set up to multiple copied watchcase recombinant vectors n (AOX-LEAP-2C)/pAO815 through the method for Bgl II and BamH I double digestion.First, a part of LEAP-2 has been proved to be the directly growth of Antifungi, and our pre-stage test also confirms to adopt pPICZ α A carrier extracellular expression large yellow croaker LEAP-2C unsuccessful.Meanwhile, have in order to reach the high density large yellow croaker LEAP-2C pichia spp fermented liquid of producing upper using value, we build the large yellow croaker LEAP-2C carrier of multiple copied.Above-mentioned 2 reasons make us adopt pAO815 carrier intracellular expression large yellow croaker LEAP-2C, and this carrier can meet the requirement of intracellular expression and multiple copied expression; Secondly, pAO815 carrier, to use Bgl II and BamH I double digestion to obtain goal gene, adopt again BamH I single endonuclease digestion in carrier, to be connected into the method for goal gene, can build multiple copy expression cassette recombinant plasmid n (AOX-LEAP-2C)/pAO815, the method will ensure the LEAP-2C high expression level (concrete enzyme is cut position and seen Fig. 1) of recombination yeast
In its high expression level yeast strain enlarged culturing process, determine pH 6.6, methyl alcohol degree at end 1.0%, under inoculum size 10% condition, yeast recon can reach optimum fermentation condition, can reach 102.2 mg/L cultivating the high expression level of the large yellow croaker LEAP-2C that recombinates after 96 h, this also lays the first stone for industrial production purifying LEAP-2C for the present invention, and this application is finally likely produced for medicine.
In sum, the present invention proposes the method for large yellow croaker LEAP-2C at pichia spp intracellular expression first.The method expression level is high, production cost is low and output is high, the LEAP-2C fodder additives effective ingredient of its production is high, and yeast itself just can be used as fodder additives, be applicable to aquaculture application, good anti-bacterial effect simultaneously, can be mass-produced and production cost low, large yellow croaker LEAP-2C yeast expression product will be applied in aquaculture feed additive and antibacterial new drug.
Brief description of the drawings
Fig. 1 is the external structure schematic diagram of large yellow croaker LEAP-2C multiple copy expression cassette of the present invention;
Fig. 2 is PCR qualification n (AOX-LEAP-2C)/pAO815-GS115 yeast transformant; 1-8 is positive yeast transformant, the 9th, and empty carrier yeast transformant;
Fig. 3 is the large yellow croaker LEAP-2C protein content that ELISA detects the restructuring large yellow croaker LEAP-2C Yeast protein sample of different incubation time points.
Embodiment
Below in conjunction with accompanying drawing, embodiment is described in further detail the present invention.
One, specific embodiment
Embodiment 1
Large yellow croaker liver is expressed the intracellular expression method of antibacterial peptide LEAP-2C in pichia spp, and large yellow croaker LEAP-2C gene is inserted in extracellular expression carrier pAO815 and builds multiple copied expression vector; After linearization for enzyme restriction, electric shock imports in Pichia pastoris GS115, obtains recombinant strain; Through shake flask fermentation and methanol induction, realize the intracellular expression of restructuring large yellow croaker LEAP-2C, concrete steps are as follows:
(1) build recombinant expression plasmid
Extracting large yellow croaker hepatic tissue mRNA, the synthetic large yellow croaker LEAP-2C(accession number of reverse transcription is KJ024789), carry out the gene mature peptide region (Ser42-Ser79) of pcr amplification large yellow croaker LEAP-2C albumen as template design primer, by restriction enzyme Eco RI single endonuclease digestion for the pcr amplification product containing large yellow croaker LEAP-2C gene, PCR product after enzyme is cut with same restrictions restriction endonuclease Eco RI single endonuclease digestion plasmid pAO815 ligase enzyme be connected, transform in bacillus coli DH 5 alpha, obtain recombinant expression plasmid LEAP-2C/pAO815; Wherein pcr amplification primer sequence is as follows:
Forward amplimer is: GGAATTCTCACTTCTATGGCGTTGGAA
Oppositely amplimer is: GGAATTCTCAGCTGGAGATCCAGAAAG;
(2) structure of multiple copy expression cassette LEAP-2C/pAO815
The recombinant plasmid LEAP-2C/pAO815 building, through Bgl II and BamH I double digestion, is obtained to gene fragment AOX-LEAP-2C; Simultaneously by recombinant plasmid LEAP-2C/pAO815 after B amH I single endonuclease digestion, alkaline phosphatase treatment dephosphorylation, endonuclease bamhi AOX-LEAP-2C is inserted in dephosphorylized LEAP-2C/pAO815, transform after intestinal bacteria (E. coli) DH5 α, with Bgl II and BamH I double digestion, obtain recombinant plasmid 2 and copy expression cassette 2 (AOX-LEAP-2C)/pAO815, repeat aforesaid method, obtain multiple copy expression cassette recombinant plasmid n (AOX-LEAP-2C)/pAO815; As shown in Figure 1, adopt the method can obtain LEAP-2C multiple copy expression cassette;
(3) conversion of pichia spp recon
By multiple copy expression cassette recombinant plasmid n (AOX-LEAP-2C)/pAO815 after Sa l I linearization for enzyme restriction, after competence Pichia pastoris GS115 cell is mixed in 16ul:1ug ratio with linearizing recombinant expression plasmid n (AOX-LEAP-2C)/pAO815, shock by electricity to transform and obtain transformant, transformant is cultivated to 2 ~ 4 d in 30 DEG C, grow faster 8 of macrocolonies of picking, through G418 screening and PCR qualification, positive colony is recombinant bacterial strain n (AOX-LEAP-2C)/pAO815-GS115 (as shown in Figure 2); Recombinant strain n (the AOX-LEAP-2C)/pAO815-GS115 obtaining is inoculated in BMGY substratum, be cultured to OD600 and reach 2.0-6.0 collecting cell, be resuspended in BMMY substratum, add methyl alcohol to final concentration 1.0% abduction delivering every 24 h;
(4) protein determination of LEAP-2C and recombinant screen.
Collect recombinant strain n (the AOX-LEAP-2C)/pAO815-GS115 suspension of different incubation time points, after ultrasonication, obtain restructuring large yellow croaker LEAP-2C Yeast protein sample, detect the protein content of large yellow croaker LEAP-2C in restructuring large yellow croaker LEAP-2C Yeast protein sample with ELISA, the highest bacterial strain of screening LEAP-2C protein expression content, obtains high expression level recombinant strain;
(5) high expression level yeast strain enlarged culturing
High expression level recombinant strain is inoculated in to the growth of BMGY substratum, cultivate 22-26h until OD600 reaches 2.0-4.0 for 30 DEG C, 1500rpm is centrifugal, and 5 min collect thalline, then thalline is proceeded to and in BMMY substratum, carries out methanol induction expression by 10wt% inoculum size, under the condition of pH 6.6,30 DEG C are continued to cultivate 96 hours, every 24 h add a methyl alcohol to methyl alcohol final concentration 1.0%, make pichia spp intracellular expression large yellow croaker LEAP-2C albumen, obtain the tunning of restructuring large yellow croaker LEAP-2C albumen.
Embodiment 2
Large yellow croaker liver is expressed the intracellular expression method of antibacterial peptide LEAP-2C in pichia spp, and concrete steps are as follows:
(1) build recombinant expression plasmid
Extracting large yellow croaker hepatic tissue mRNA, the synthetic large yellow croaker LEAP-2C(accession number of reverse transcription is KJ024789), carry out the gene mature peptide region (Ser42-Ser79) of pcr amplification large yellow croaker LEAP-2C albumen as template design primer, by restriction enzyme Eco RI single endonuclease digestion for the pcr amplification product containing large yellow croaker LEAP-2C gene, PCR product after enzyme is cut with same restrictions restriction endonuclease Eco RI single endonuclease digestion plasmid pAO815 ligase enzyme be connected, transform in bacillus coli DH 5 alpha, obtain recombinant expression plasmid LEAP-2C/pAO815; Wherein pcr amplification primer sequence is as follows:
Forward amplimer is: GGAATTCTCACTTCTATGGCGTTGGAA
Oppositely amplimer is: GGAATTCTCAGCTGGAGATCCAGAAAG;
(2) structure of multiple copy expression cassette LEAP-2C/pAO815
The recombinant plasmid LEAP-2C/pAO815 building, through Bgl II and BamH I double digestion, is obtained to gene fragment AOX-LEAP-2C; Simultaneously by recombinant plasmid LEAP-2C/pAO815 after B amH I single endonuclease digestion, alkaline phosphatase treatment dephosphorylation, endonuclease bamhi AOX-LEAP-2C is inserted in dephosphorylized LEAP-2C/pAO815, transform after intestinal bacteria (E. coli) DH5 α, with Bgl II and BamH I double digestion, obtain recombinant plasmid 2 and copy expression cassette 2 (AOX-LEAP-2C)/pAO815, repeat aforesaid method, obtain multiple copy expression cassette recombinant plasmid n (AOX-LEAP-2C)/pAO815; As shown in Figure 1, adopt the method can obtain LEAP-2C multiple copy expression cassette;
(3) conversion of pichia spp recon
By multiple copy expression cassette recombinant plasmid n (AOX-LEAP-2C)/pAO815 after Sa l I linearization for enzyme restriction, after competence Pichia pastoris GS115 cell is mixed in 16ul:1ug ratio with linearizing recombinant expression plasmid n (AOX-LEAP-2C)/pAO815, shock by electricity to transform and obtain transformant, transformant is cultivated to 2 ~ 4 d in 30 DEG C, grow faster 8 of macrocolonies of picking, through G418 screening and PCR qualification, positive colony is recombinant bacterial strain n (AOX-LEAP-2C)/pAO815-GS115; Recombinant strain n (the AOX-LEAP-2C)/pAO815-GS115 obtaining is inoculated in BMGY substratum, be cultured to OD600 and reach 2.0-6.0 collecting cell, be resuspended in BMMY substratum, add methyl alcohol to final concentration 1.0% abduction delivering every 24 h;
Wherein the preparation method of competence Pichia pastoris GS115 cell is as follows: Pichia pastoris GS115 is inoculated in YPD substratum, 30 DEG C of shaking culture are spent the night, get 0.5 ml cultured products, be inoculated into fresh YPD substratum, cultivate and reach 1.3-1.5 to OD600, the centrifugal supernatant that goes, respectively washes once with precooling sterilized water and the aseptic sorbyl alcohol of 1 mol/L, finally suspend with aseptic sorbyl alcohol 1 ml of 1 mol/L, obtain GS115 competence pichia spp;
Electric shock transforms and obtains the detailed process of transformant and be: after getting competence Pichia pastoris GS115 cell 96 μ l and linearizing recombinant expression plasmid 6 μ g and being placed in and transforming and glass mix, conversion cup is placed in to ice bath to be kept 5 min shock by electricity transforming obtaining transformant, electroporation conversion electric shock condition: voltage 1500V; Electric capacity 25 μ F; Burst lengths 10 ms, once electric shock; After electric shock, transform in electric shock the Sorbitol Solution USP that adds 1 mol/L of 4 DEG C of precoolings of 1 ml in cup at once, use the piping and druming of micropipette rifle evenly to obtain transformant, be placed in ice bath for subsequent use; The substratum that this transformant adopts in the process of 30 DEG C of cultivation 2 ~ 4 d is 30 DEG C and is dried to the half-dried MD culture medium flat plate in surface;
(4) protein determination of LEAP-2C and recombinant screen
Collect recombinant strain n (the AOX-LEAP-2C)/pAO815-GS115 suspension of different incubation time points, after ultrasonication, obtain restructuring large yellow croaker LEAP-2C Yeast protein sample, detect the protein content of large yellow croaker LEAP-2C in restructuring large yellow croaker LEAP-2C Yeast protein sample with ELISA, the highest bacterial strain of screening LEAP-2C protein expression content, obtains high expression level recombinant strain;
Wherein in ELISA detection restructuring large yellow croaker LEAP-2C Yeast protein sample, the detailed process of the protein content of large yellow croaker LEAP-2C is: ELISA microplate adopts the coated protein binding ability that increases of poly-lysine, then in each hole of ELISA microplate, add the restructuring large yellow croaker LEAP-2C Yeast protein sample of 100 times of dilutions, overnight incubation, the fish glue of employing 5% seals non-binding site, then anti-mouse LEAP-2C antibody is joined in each hole of ELISA microplate, hatch 1 h and wash three times, again by anti-the joining in each hole of ELISA microplate of anti-alkali phosphatase enzyme mark rabbit mouse two, hatch 1 h and wash three times, finally adopt ELISA microplate that alkaline phosphatase enzyme reaction substrate system completes reaction to detect the optical density(OD) of 405 nm wavelength in microplate reader, screen the highest restructuring yeast strains of LEAP-2C expression contents by the large yellow croaker LEAP-2C detecting in yeast split product, it is high expression level recombinant strain,
(5) high expression level yeast strain enlarged culturing
High expression level recombinant strain is inoculated in to the growth of BMGY substratum, cultivate 22-26h until OD600 reaches 2.0-4.0 for 30 DEG C, 1500rpm is centrifugal, and 5 min collect thalline, then thalline is proceeded to and in BMMY substratum, carries out methanol induction expression by 10wt% inoculum size, under the condition of pH 6.6,30 DEG C are continued to cultivate 96 hours, every 24 h add a methyl alcohol to methyl alcohol final concentration 1.0%, make pichia spp intracellular expression large yellow croaker LEAP-2C albumen, obtain the tunning of restructuring large yellow croaker LEAP-2C albumen.
Above-mentioned BMGY culture medium prescription is: 1% yeast extract, 2% peptone, 100 mM potassiumphosphate PH6.0,1.34% YNB(yeast nitrogen alkali) 4 × 10-5% vitamin H, 1% glycerine.
Above-mentioned BMMY culture medium prescription is: 1% yeast extract, 2% peptone, 100 mM potassiumphosphate PH6.0,1.34% YNB, 4 × 10-5% vitamin H, 0.5% methyl alcohol.
Above-mentioned YPD culture medium prescription is: 2% Tryptones, 1% yeast extract, 2% glucose.
Above-mentioned MD culture medium prescription is: 1.34% YNB, 4 × 10
-5% vitamin H, 2% glucose.System flat board adds 1.5% agar.
Alkaline phosphatase enzyme reaction substrate system is purchased from Sigma Aldrich company.
Two, the optimal culture conditions of LEAP-2C high expression level recombinant strain screening
Concrete operation step is with above-described embodiment 1, and its difference is: study different methyl alcohol final concentration 0.5-5%, and different pH condition 5.4-7.0, different inoculum size (5-20wt%) conditions descend large yellow croaker LEAP-2C egg in pichia spp intracellular expression amount.
At pH6.2, under inoculum size 10% condition, methyl alcohol final concentration is 0.5,1.0,1.5,2.0,2.5,3.0,3.5,4.0,4.5, under 5.% condition, and the protein concentration of LEAP-2C is respectively 20.5,93.5,75.3,53.9,63.5,53.0,43.0,29.8,30.2,39.4 mg/L.Under methyl alcohol final concentration 1.0% condition, under inoculum size 10% condition, pH is controlled under 5.4,5.8,6.2,6.6,7.0 conditions, and LEAP-2C protein concentration is respectively 53.2,49.2,84.3,102.2,73.5 mg/L.Be that 1.0%, pH is 6.6 at methyl alcohol final concentration, inoculum size is respectively under 5%, 10%, 15%, 20% condition, and LEAP-2C protein concentration is respectively 56.2,102.2,97.5,95.4 mg/L.According to the content of large yellow croaker LEAP-2C in yeast product.Determine pH 6.6, methyl alcohol final concentration 1.0%, under inoculum size 10% condition, yeast recon can reach optimum fermentation condition.As shown in Figure 3, the high expression level of restructuring large yellow croaker LEAP-2C can reach 102.2 mg/L.At front 96 h of the process of yeast culture, along with the large yellow croaker LEAP-2C protein expression that carries out of cultivating continues to increase, and reach peak value 102.2 mg/L at the 96th h.And between 96-144 h, large yellow croaker LEAP-2C protein content is slow decreasing.
Three, verify containing the yeast product antibacterial activity in vivo of restructuring LEAP-2C albumen
Adopt 5 × 10
6cFU vibrio alginolyticus abdominal injection large yellow croaker is set up pathogenic bacterium infection model, and sick fish is divided into every group of 16 fishes of three groups.The recombinant expressed yeast of LEAP-2C of embodiment 1 and empty carrier contrast yeast product centrifugal concentrating, fragmentation, dry, obtain yeast powder.First group of feeding physiological saline, the recombinant expressed yeast product of LEAP-2C (1 mg/g body weight) of second group of feeding embodiment 1, the 3rd group of feeding empty carrier contrast yeast product (1 mg/g body weight).Three groups of total survival rates of large yellow croaker 48 h, are respectively 12.5%, 68.8%, 25.0%.Illustrate that the recombinant expressed yeast product of feeding LEAP-2C can effectively improve the survival rate of pathogenic infection large yellow croaker.
Four, the yeast product that contains restructuring LEAP-2C albumen is in the application of preparing in aquaculture feed additive
The liver of chemosynthesis is expressed to the direct feeding large yellow croaker of antibacterial peptide LEAP-2C albumen effect not obvious (in the large yellow croaker infecting vibrio alginolyticus, the total survival rate of 48 h of physiological saline group and chemosynthesis LEAP-2C, be respectively 12.5% and 18.8%, the survivorship curve of finding both through statistics does not have significant difference), may be because the low easy degraded of LEAP-2C protein concentration.And adopt the direct feeding large yellow croaker of yeast product that contains restructuring large yellow croaker LEAP-2C can obviously raise the survival rate of pathogenic infection large yellow croaker (data are shown in above-mentioned containing described in the yeast product antibacterial activity in vivo checking three of restructuring LEAP-2C albumen), because employing feeding method is acted on large yellow croaker by immunostimulant in practical application, this also confirms the actual application value of large yellow croaker LEAP-2C yeast fermentation product.
Above-described embodiment detailed description of the invention, but protection scope of the present invention is not limited to the technical scheme described in above-mentioned embodiment, and be as the criterion with the protection domain described in claim.
Claims (7)
1. large yellow croaker liver is expressed the intracellular expression method of antibacterial peptide LEAP-2C in pichia spp, and large yellow croaker LEAP-2C gene is inserted in extracellular expression carrier pAO815 and builds multiple copied expression vector; After linearization for enzyme restriction, electric shock imports in Pichia pastoris GS115, obtains recombinant strain; Through shake flask fermentation and methanol induction, realize the intracellular expression of restructuring large yellow croaker LEAP-2C, it is characterized in that step is as follows:
(1) build recombinant expression plasmid
Extracting large yellow croaker hepatic tissue mRNA, the synthetic large yellow croaker LEAP-2C(accession number of reverse transcription is KJ024789), carry out the gene mature peptide region (Ser42-Ser79) of pcr amplification large yellow croaker LEAP-2C albumen as template design primer, by restriction enzyme Eco RI single endonuclease digestion for the pcr amplification product containing large yellow croaker LEAP-2C gene, PCR product after enzyme is cut with same restrictions restriction endonuclease Eco RI single endonuclease digestion plasmid pAO815 ligase enzyme be connected, transform in bacillus coli DH 5 alpha, obtain recombinant expression plasmid LEAP-2C/pAO815;
(2) structure of multiple copy expression cassette LEAP-2C/pAO815
The recombinant plasmid LEAP-2C/pAO815 building, through Bgl II and BamH I double digestion, is obtained to gene fragment AOX-LEAP-2C; Simultaneously by recombinant plasmid LEAP-2C/pAO815 after B amH I single endonuclease digestion, alkaline phosphatase treatment dephosphorylation, endonuclease bamhi AOX-LEAP-2C is inserted in dephosphorylized LEAP-2C/pAO815, transform after intestinal bacteria (E. coli) DH5 α, with Bgl II and BamH I double digestion, obtain recombinant plasmid 2 and copy expression cassette 2 (AOX-LEAP-2C)/pAO815, repeat aforesaid method, obtain multiple copy expression cassette recombinant plasmid n (AOX-LEAP-2C)/pAO815;
(3) conversion of pichia spp recon
By multiple copy expression cassette recombinant plasmid n (AOX-LEAP-2C)/pAO815 after Sa l I linearization for enzyme restriction, after competence Pichia pastoris GS115 cell is mixed in 16ul:1ug ratio with linearizing recombinant expression plasmid n (AOX-LEAP-2C)/pAO815, shock by electricity to transform and obtain transformant, transformant is cultivated to 2 ~ 4 d in 30 DEG C, grow faster 8 of macrocolonies of picking, through G418 screening and PCR qualification, positive colony is recombinant bacterial strain n (AOX-LEAP-2C)/pAO815-GS115; Recombinant strain n (the AOX-LEAP-2C)/pAO815-GS115 obtaining is inoculated in BMGY substratum, be cultured to OD600 and reach 2.0-6.0 collecting cell, be resuspended in BMMY substratum, add methyl alcohol to final concentration 1.0% abduction delivering every 24 h;
(4) protein determination of LEAP-2C and recombinant screen
Collect recombinant strain n (the AOX-LEAP-2C)/pAO815-GS115 suspension of different incubation time points, after ultrasonication, obtain restructuring large yellow croaker LEAP-2C Yeast protein sample, detect the protein content of large yellow croaker LEAP-2C in restructuring large yellow croaker LEAP-2C Yeast protein sample with ELISA, the highest bacterial strain of screening LEAP-2C protein expression content, obtains high expression level recombinant strain;
(5) high expression level yeast strain enlarged culturing
High expression level recombinant strain is inoculated in to the growth of BMGY substratum, cultivate 22-26h until OD600 reaches 2.0-4.0 for 30 DEG C, 1500rpm is centrifugal, and 5 min collect thalline, then thalline is proceeded to and in BMMY substratum, carries out methanol induction expression by 5-20wt% inoculum size, under the condition of pH 5.4-7.0,30 DEG C are continued to cultivate 96 hours, every 24 h add a methyl alcohol to methyl alcohol final concentration 0.5-5%, make pichia spp intracellular expression large yellow croaker LEAP-2C albumen, obtain the tunning of restructuring large yellow croaker LEAP-2C albumen.
2. large yellow croaker liver according to claim 1 is expressed the intracellular expression method of antibacterial peptide LEAP-2C in pichia spp, it is characterized in that in step (1), pcr amplification primer sequence is as follows:
Forward amplimer is: GGAATTCTCACTTCTATGGCGTTGGAA
Oppositely amplimer is: GGAATTCTCAGCTGGAGATCCAGAAAG.
3. large yellow croaker liver according to claim 1 is expressed the intracellular expression method of antibacterial peptide LEAP-2C in pichia spp, the preparation method of its feature competence Pichia pastoris GS115 cell in step (3) is as follows: Pichia pastoris GS115 is inoculated in YPD substratum, 30 DEG C of shaking culture are spent the night, get 0.5 ml cultured products, be inoculated into fresh YPD substratum, cultivate and reach 1.3-1.5 to OD600, the centrifugal supernatant that goes, respectively wash once with precooling sterilized water and the aseptic sorbyl alcohol of 1 mol/L, finally suspend with aseptic sorbyl alcohol 1 ml of 1 mol/L, obtain GS115 competence pichia spp.
4. large yellow croaker liver according to claim 1 is expressed the intracellular expression method of antibacterial peptide LEAP-2C in pichia spp, it is characterized in that electric shock in step (3) transforms the detailed process that obtains transformant and is: after getting competence Pichia pastoris GS115 cell 96 μ l and linearizing recombinant expression plasmid 6 μ g and being placed in and transforming and glass mix, conversion cup is placed in to ice bath to be kept 5 min shock by electricity transforming obtaining transformant, electroporation conversion electric shock condition: voltage 1500V; Electric capacity 25 μ F; Burst lengths 10 ms, once electric shock; After electric shock, transform in electric shock the Sorbitol Solution USP that adds 1 mol/L of 4 DEG C of precoolings of 1 ml in cup at once, use the piping and druming of micropipette rifle evenly to obtain transformant, be placed in ice bath for subsequent use.
5. large yellow croaker liver according to claim 4 is expressed the intracellular expression method of antibacterial peptide LEAP-2C in pichia spp, it is characterized in that the transformant described in step (3) cultivates in 30 DEG C the substratum adopting in the process of 2 ~ 4 d and be 30 DEG C and be dried to the half-dried MD culture medium flat plate in surface.
6. large yellow croaker liver according to claim 1 is expressed the intracellular expression method of antibacterial peptide LEAP-2C in pichia spp, the detailed process that it is characterized in that the protein content of large yellow croaker LEAP-2C in the middle ELISA detection of step (4) restructuring large yellow croaker LEAP-2C Yeast protein sample is: ELISA microplate adopts the coated increase of poly-lysine protein binding ability, then in each hole of ELISA microplate, add the restructuring large yellow croaker LEAP-2C Yeast protein sample of 100 times of dilutions, overnight incubation, the fish glue of employing 5% seals non-binding site, then anti-mouse LEAP-2C antibody is joined in each hole of ELISA microplate, hatch 1 h and wash three times, again by anti-the joining in each hole of ELISA microplate of anti-alkali phosphatase enzyme mark rabbit mouse two, hatch 1 h and wash three times, finally adopt ELISA microplate that alkaline phosphatase enzyme reaction substrate system completes reaction to detect the optical density(OD) of 405 nm wavelength in microplate reader, screen the highest restructuring yeast strains of LEAP-2C expression contents by the large yellow croaker LEAP-2C detecting in yeast split product, it is high expression level recombinant strain.
7. large yellow croaker liver according to claim 1 is expressed the intracellular expression method of antibacterial peptide LEAP-2C in pichia spp, the optimum condition that it is characterized in that high expression level recombinant strain enlarged culturing in step (5) is: methyl alcohol final concentration 1.0%, pH 6.6, inoculum size 10wt%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410221810.XA CN104031935A (en) | 2014-05-23 | 2014-05-23 | Intracellular expression method of large yellow croaker liver expression antibacterial peptide LEAP-2C in pichia pastoris |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410221810.XA CN104031935A (en) | 2014-05-23 | 2014-05-23 | Intracellular expression method of large yellow croaker liver expression antibacterial peptide LEAP-2C in pichia pastoris |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104031935A true CN104031935A (en) | 2014-09-10 |
Family
ID=51462931
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410221810.XA Pending CN104031935A (en) | 2014-05-23 | 2014-05-23 | Intracellular expression method of large yellow croaker liver expression antibacterial peptide LEAP-2C in pichia pastoris |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104031935A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106222175A (en) * | 2016-08-02 | 2016-12-14 | 上海海洋大学 | The optimized gene of channel catfish LEAP 2 mature peptide and the preparation method of recombiant protein thereof |
| CN108977457A (en) * | 2018-08-31 | 2018-12-11 | 长江大学 | A kind of preparation method of ricefield eel antibacterial peptide |
| CN109536507A (en) * | 2018-12-13 | 2019-03-29 | 海南大学 | The peptide and prokaryotic expression preparation method of Bu Shi silvery pomfret Scad antibacterial peptide gene and its coding |
| CN112877277A (en) * | 2021-03-12 | 2021-06-01 | 集美大学 | Large yellow croaker ovary tissue cell line and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1821398A (en) * | 2006-03-09 | 2006-08-23 | 昆明理工大学 | Process for preparing heat-labile enterotoxin of E, coli |
-
2014
- 2014-05-23 CN CN201410221810.XA patent/CN104031935A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1821398A (en) * | 2006-03-09 | 2006-08-23 | 昆明理工大学 | Process for preparing heat-labile enterotoxin of E, coli |
Non-Patent Citations (1)
| Title |
|---|
| LI,H.X.和CHEN,J.: "KJ024789.1", 《GENBANK》, 1 May 2014 (2014-05-01) * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106222175A (en) * | 2016-08-02 | 2016-12-14 | 上海海洋大学 | The optimized gene of channel catfish LEAP 2 mature peptide and the preparation method of recombiant protein thereof |
| CN108977457A (en) * | 2018-08-31 | 2018-12-11 | 长江大学 | A kind of preparation method of ricefield eel antibacterial peptide |
| CN108977457B (en) * | 2018-08-31 | 2021-04-02 | 长江大学 | Preparation method of finless eel antibacterial peptide |
| CN109536507A (en) * | 2018-12-13 | 2019-03-29 | 海南大学 | The peptide and prokaryotic expression preparation method of Bu Shi silvery pomfret Scad antibacterial peptide gene and its coding |
| CN109536507B (en) * | 2018-12-13 | 2022-04-05 | 海南大学 | Antibacterial peptide gene of pompano and its coded peptide and prokaryotic expression preparation method |
| CN112877277A (en) * | 2021-03-12 | 2021-06-01 | 集美大学 | Large yellow croaker ovary tissue cell line and application thereof |
| CN112877277B (en) * | 2021-03-12 | 2022-09-23 | 集美大学 | Large yellow croaker ovary tissue cell line and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Irianto et al. | Probiotics in aquaculture | |
| CN105176874B (en) | Bacillus coagulans FM603 and its application | |
| CN105175518B (en) | The bacteriocin and preparation method thereof that bacillus coagulans FM603 is generated | |
| CN102895677B (en) | Multivalent carrier vaccine for shrimp and application thereof | |
| MXPA03008563A (en) | Delivery of disease control in aquaculture and agriculture using microbes containing bioactive proteins. | |
| CN104031935A (en) | Intracellular expression method of large yellow croaker liver expression antibacterial peptide LEAP-2C in pichia pastoris | |
| CN104694559A (en) | DNA segment for efficient expression of egg white lysozyme by employing recombinant pichia pastoris and expression method thereof | |
| CN104805040A (en) | Bacillus subtilis preparation, as well as preparation method and application | |
| CN103266074B (en) | B.subtilis spores strain and application thereof | |
| CN101423840B (en) | Method for producing recombinant sea cucumber antalzyme and recombinant sea cucumber antalzyme produced thereby | |
| CN102776222B (en) | Preparation and application of fused oral interferon for fowl | |
| CN103205383B (en) | Bacillus pumilus E14, culturing method thereof and application | |
| CN103724412A (en) | Fenneropenaeus chinensiss anti-lipopolysaccharide factor as well as preparation and application thereof | |
| CN101955942B (en) | DNA (Deoxyribonucleic Acid) molecule for encoding pig alpha-interferon and recombinant colibacillus as well as application thereof | |
| CN105104712A (en) | Microbiological feed additive and preparation method thereof | |
| CN102816815A (en) | Yeast fermentation production method of recombinant antibacterial peptide rCrustinI | |
| CN104418945A (en) | Preparation method of peptide and application of peptide in preparation of medicine and feed additive | |
| CN101659958B (en) | Multi-titer live vaccine as well as preparation method and application thereof | |
| CN104402987A (en) | Crassostrea gigas interleukin IL17N recombination protein as well as preparation and application thereof | |
| CN101314772A (en) | Recombination expression and application of shrimp antimicrobial peptide genes in probiotic bacteria | |
| CN106615622A (en) | Feed additive capable of promoting growth of chicks and enhancing capabilities of resisting infection of salmonella pullorum of chicks and application of feed additive | |
| Lee et al. | Production of antibacterial Bombyx mori cecropin A in mealworm-pathogenic Beauveria bassiana ERL1170 | |
| CN102949713B (en) | Bacillus subtilis multi-valent vector-based vaccine and application thereof | |
| CN102408480A (en) | Pichia pastoris-expressed bovine lactoferrin-derived antibacterial fragment BLfA and preparation method thereof | |
| CN102559672B (en) | Recombinant sea cucumber lysozyme N-terminal peptide, preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140910 |