WO2005045012A1 - Endodermal stem cells in liver and methods for isolation thereof - Google Patents

Abstract

The present invention relates to an endodermal stem cell and methods of isolation, culture, differentiation and use thereof.

Description

ENDODERMAL STEM CELLS IN LIVER AND METHODS FOR ISOLATION THEREOF

REFERENCE TO RELATED APPLICATIONS This application claims priority under 35 U.S.C. 119(e) from U.S.

Provisional Application Serial No. 60/517,980 filed November 5, 2004.

FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with the assistance of government support under United States Grant Nos. R01-HL073221-01 and U19 DK61244 from the National Institutes of Health. The government may have certain rights in the invention.

FIELD OF THE INVENTION The present invention relates to an isolated population of endodermal stem cells obtained from liver and methods of isolation, culture, differentiation and use thereof.

BACKGROUND OF THE INVENTION Liver disease is a common cause of morbidity and mortality. The most prevalent liver diseases are viral hepatitis (A, B and C), cirrhosis, and cancer of the liver. Despite the high incidence of diseases that result in liver dysfunction and failure, major advances in medical therapies are currently limited to disease prevention and supportive, rather than curative, approaches. Liver transplantation has become the standard treatment for end-stage liver disease. However, wide application is limited by the paucity of available donor organs. In addition, liver transplantation is associated with a certain level of morbidity and mortality. Many liver disorders result from hepatocyte dysfunction. Consequently, there has been an interest in hepatocyte transplantation for the treatment of acute and chronic liver failure, as well as inherited metabolic disorders. Hepatocyte transplantation has several advantages over whole liver transplant, including lower morbidity, hepatocytes can be cryopreserved, cell grafts are believed to be less immunogenic than whole organ grafts and a single donor organ can be used for several recipients. Despite these benefits, hepatocyte transplantation is also limited by a scarcity of donor organs/useable cells. Liver regeneration is a well-known phenomenon and presently, the regenerative properties of the liver are taken advantage of in the treatment of liver diseases. Despite its common usage, what is usually referred to as liver regeneration is actually a process of compensatory growth. In an average liver resection, approximately two-thirds of the liver is removed. The resected liyer tissue removed by surgery does not grow back. Instead, the portions of the liver remaining after a typical hepatectomy increase in size to compensate for the loss of tissue and expand until the mass of the regenerated liver reaches approximately ± 10% of the original organ mass. At the end of the process (about 2 weeks in rodents and perhaps 1-2 months in humans), liver mass is restored but anatomical form is not reconstituted. This is a clear indication that compensatory growth after hepatectomy is a tightly controlled process, and is in synchrony with the body. However, the liver functions independently of its anatomical form (Bucher, N.L.R., (1963) . Rev. Cytol. 15: 245-300; Fausto, N., (2000) J. Hepatol. 32: 19-31; Fausto, N., (2001) The Liver Biology and Pathobiologv, Lippincott, Williams, and Wilkins, New York, NY, pp. 591-60). While it has been determined that hepatocyte proliferation is the primary reason for regaining liver mass after resection, there are situations when these cells are unable to divide, or do so to a limited degree. This happens when the liver is damaged chronically, such as in alcoholic liver disease or in hepatitis induced by viral infection (HBV or HCV). In contrast to other regenerating tissues (bone marrow, skin), liver regeneration is not dependent on a small group of progenitor or stem cells. Cells with stem cell properties, however, may appear in large numbers when mature hepatocytes are inhibited from proliferation (Sell, S., (1994) Mod. Pathol. 7(1): 105-12; Thorgeirsson, S.S., (1996) FASEB J. 10(11): 1249-56; Fausto, N., et al. (1993) Proc. Soc. Exp. Biol. Med. 204(3): 237-41). Liver regeneration after partial hepatectomy is carried out by proliferation of all the existing mature cellular populations composing the intact organ. These include hepatocytes (the main functional cells of the organ); biliary epithelial cells (lining biliary ducts); fenestrated endothelial cells, which are a unique type of endothelial cells with large cytoplasmic gaps (fenestrae) that allow maximal contact between circulating blood and hepatocytes; Kupffer cells (macrophages in hepatic sinusoids); and cells of Ito, which are stellate cells unique to the liver and located under the sinusoids that surround hepatocytes with long processes, store vitamin A, synthesize connective tissue proteins, and secrete several growth factors (Gressner, A.M., (1995) J. Hepatol. 22(2 Suppl): 55-60; Housset, C.N., et al. (1995) J. Hepatol. 22(2 Suppl): 55-60). Hepatocytes regenerated after partial hepatectomy and chemical injury require at most two rounds of hepatocyte replication. However, despite their maintenance in a quiescent state and low replicative activity in the normal liver (Webber, E.M., et al. (1994) Hepatology 19: 489-497; Webber, E.M., et al. (1998) Hepatology 28: 1226-1234), in culture, constitutive hepatocyte proliferation can coexist with a differentiated phenotype. Repeated regenerative episodes (e.g., five successive partial hepatectomies) do not exhaust the hepatocyte' s proliferative capacity. Additionally, studies in culture have shown that hepatocytes under the influence of hepatocyte growth factor (HGF) and epidermal growth factor (EGF) retrodifferentiate, undergo multiple proliferative events, expand in a clonal fashion, and redifferentiate to form mature hepatocytes. This demonstrates that mature hepatocytes are not terminally differentiated cells. They can proliferate almost without limit in culture, and these cultured hepatocytes can perform all essential functions needed for homeostasis, such as glucose regulation, synthesis of blood proteins such as albumin and coagulation proteins, secretion of bile, biodegradation of toxic compounds, and others. Despite their high replicative abilities, transplanted hepatocytes used in transplantation do not replicate efficiently in the normal rat or mouse liver

(Ponder, K.P., et al. (1991) Proc. Natl. Acad. Sci. USA 88: 1217-1221; Gupta, S., et al. (1991) Hepatology 14: 144-149; Sokhi, R.P., et al. (2000) Am. J. Physiol. Gastrointest. Liver Physiol. 279: 631-640). The exceptions to this are observed in livers of either very young or very old rats, where transplanted cells exhibit spontaneous proliferative activity. This translates into the repopulation of only 0.5% - 1% of the liver following transplantation of 20 million cells in the rat or 2 million cells in the mouse liver, which can be increased to approximately 5% by transplanting cells repeatedly. However, correction of specific diseases might be incomplete with this magnitude of liver reconstitution. hi general, hepatocytes are highly susceptible to freeze-thaw damage and significant fractions of cells are lost following cryopreservation. If the initial cell isolate is of relatively marginal viability to begin with, it becomes difficult to obtain adequate numbers of cells for transplantation. Often, induction of transplanted cell proliferation in the liver requires selective ablation of native hepatocytes with chemicals, e.g. carbon tetrachloride, or hepatotoxic transgenes. Extensive liver repopulation occurs in animals with hepatic expression of urokinase-type plasminogen activator, or other animals containing genetic mutations that promote hepatobiliary injury or genotoxic hepatic damage. Perturbation of initial cell distributions in the liver sinusoids, interference with the phagocytotic responses activated by cell transplantation, and manipulation of the sinusoidal endothelial integrity prior to cell transplantation could have salutary effects on transplanted cell engraftment and subsequent liver repopulation (Slehria, S., et al. (2002) Hepatology 35: 1320- 1328; Malhi, H., et al. (2002) Hepatology 36: 112-121; Joseph, B., et al. (2002) Gastroenterology 123(5): 1677-85). Oval cells have lineage generation capacity but are activated only under special conditions (e.g., in damaged liver tissue). Oval cell progenitors are thought to be localized in biliary ductules (canals of Hering) in normal adult liver and have also been identified during liver embryonic development (Shiojiri, N., et al. (1991) Cancer Res. 51(10: 2611-20). Work by Evarts and others have determined that oval cells are bipotential and give rise to both hepatocytes and biliary ductal epithelial cells (Evarts, R.P., et al. (1987) Carcinogenesis 8: 1737- 1740; Evarts, R.P., et al. (1989) Cancer Res. 49: 1541-1547). Recent studies have identified many cell-surface markers for oval cells both in rodents and humans (Baumann, U., et al. (1999) Hepatology 30: 112-117; Roskams, T., et al. (1998) J. Hepatol. 29: 455-463). For examples, Oval cells express several hematopoietic markers, such as Thyl.l, CD34, Flt3 -receptor, and c-Kit, and also express AFP, CK19, γ-glutamyl-transferase, and OV-6. The origin of oval cells, such as an oval cell precursor or other less differentiated liver-specific cells, is not known. Oval cells proliferate in vivo only when hepatocyte proliferation is inhibited. Thus, attempts to isolate and culture oval cells have been successful only under conditions where the cells are induced to proliferate in the presence of toxins and other chemicals (Fausto, N., et al. 1987, In Pretlow, T.G., Pretlow, T.P.P. (Eds.) Purification and Culture of Oval cells from Rat Liver, Cell Separation: Methods and Selected Applications, Vol. 4. Academic Press, New York, NY, pp. 45-77). Oval cells have been isolated from rat livers treated with carcinogenic agents such as 3,5-diethoxycarbonyl-1.4-dihydrocollidine (Wang, X. et al, (2003) Proc. Natl. Acad. Sci. USA 100(1): 11881-11888). Oval cells have also been massively induced in the livers of adult rats fed choline-deficient diets supplemented with the hepatocarcinogenic agent N-2-acetylaminofluorene (Sell, S., et al., (1981a) Carcinogenesis 2: 7-14; Sell, S., et al., (1981b) GANN 72: 479-487), as well as under enzymatic harvesting conditions designed to destroy hepatocytes (Grisham, J.W. (1980) Ann. NY Acad. Sci. 349: 128-137; Koch, and Leffert (1980) Ann. NY Acad. Sci. 349: 111-127; Marceau, et al., (1980) Ann. NY Acad. Sci. 349: 138-152; Herring et al, (1983) In Vitro 19: 576-588). Frequently, cells isolated by these protocols transform into a tumorigenic phenotype due to treatment with such agents, precluding their use for clinical transplantation. Cellular therapy with stem cells and their progeny is a promising new approach to this largely unmet medical need. Hepatocyte transplantation provides a viable method for repopulation of liver tissues damaged by disease or loss of liver mass, however current methods for culturing and maintenance of primary hepatocyte culture are not sufficient for successful transplantation. Isolation and maintenance of oval cells and other liver-specific progenitor-like cells requires the addition of toxins and other chemicals for their proliferation, thus precluding their use in the clinical setting. Therefore, a need exists to identify, isolate and characterize primitive cells that can differentiate into viable liver tissue and can be used in cellular replacement therapies, as well as to develop methods for culturing such cells.

SUMMARY OF THE INVENTION The present invention provides for the isolation of endodermal stem cells from endodermally derived tissues, such as liver. Methods of the invention can result in the isolation of a population of endodermal stem cells that have a different phenotype from other previously identified stem cells. Therefore, the present invention relates to a endodermal stem cell and methods of isolation, culture, differentiation and use thereof. Other aspects of the invention are disclosed in, or are obvious from, the following disclosure and are within the ambit of the invention. One aspect of the present invention relates to an isolated endodermal stem cell, or population of endodermal stem cells, that express CD45 and CD34, but not CK19, albumin or OV-6. Endodermal stem cells of the invention have the ability to differentiate into any endodermal cell type, including, but not limited to, pancreatic, islet, intestinal, thyroid, lung, colon, bladder and liver (e.g., hepatocyte and biliary epithelial cells) cell types. The endodermal stem cells can be derived from a mammal, including, but not limited to, a human, rat or mouse. In yet another aspect, the present invention provides an endodermal stem cell that expresses CD45, and CD34, but not CK19, albumin or OV-6, wherein the genome of the cell has been altered by insertion of a preselected DNA sequence into the genome of the endodermal stem cell. One embodiment of the invention provides for a pharmaceutical composition including an effective amount of the endoderm stem cells of the invention or differentiated progeny derived therefrom and a pharmaceutically acceptable carrier. another aspect, a method of isolating a population of endodermal stem cells of the invention are provided by disassociating an endodermal tissue to form a heterogeneous population of primary parenchymal endodermal cells; culturing the primary cell population in liquid culture media so that cells exhibiting one or more differentiated phenotypes in the primary cell population are decreased; and isolating the endodermal stem cells from said cultured population. Endodermal stem cells of the present invention can be obtained from any endodermal tissue, including but not limited to, liver, stomach, duodenum, exocrine and endocrine pancreas, lung, and thyroid. The endodermal tissue can be obtained from a mammal, including, but not limited to, a rat, mouse, or human. Preferably the mammal from which the cells are obtained is free of disease, for example, free of liver disease, such as hepatitis or Wilson's disease. In a preferred embodiment, the heterogeneous population of primary cells is obtained from an endodermal tissue which has not been manipulated so as to stimulate liver tissue growth and/or inhibit cell growth, for example, inhibit normal mechanisms for liver growth restoration, such as by exposure to toxins, for example, those toxins and/or agents which inhibit mature cells, including, but not limited to, hepatocytes. Preferred embodiments of the present method use as a starting material heterogeneous populations of primary liver cells obtained from a mammal. Preferably, the cells are disassociated in the presence of a suitable enzyme. In specific preferred embodiments, heterogeneous populations of primary cells are disassociated in the presence of a collagenase. Preferably the enzyme does not adversely effect the viability of the cell or enrich or select for a specific cell type. The methods provided herein further comprise enriching for endodermal stem cells in the population by culturing the cells for at least about 7 days, preferably about 7-14 days, or more preferably about 10-14 days, such that differentiated phenotypes are decreased in culture. Cultures can be extended for durations beyond 14 days, such as about 15 to about 20 days and even longer, for about 21 to about 28 days, where desired. , In yet another aspect, the present invention comprises methods for the generation of at least one differentiated cell type from the stem cells, including but not limited to pancreatic, islet, intestinal, thyroid, lung, colon, bladder or liver cell types (e.g., hepatocytes and/or biliary ductal epithelial cells). Stem cells of the invention can be differentiated ex vivo or in vivo, preferably in the presence of 15% FBS, HGF, and/or FGF-4 to form differentiated tissues of hepatocyte and biliary ductal lineage. In yet another aspect, the present invention provides a method for providing an endoderm cell type to a subject in need thereof by administering the endoderm stem cells of the invention or differentiated progeny derived therefrom in an amount effective to provide an endoderm cell type to the subject. Preferably, the endoderm cell type is of pancreatic, islet, intestinal, thyroid, lung, colon, bladder or liver type. In preferred embodiments, stem cells of the invention can be differentiated ex vivo prior to administration or in vivo, preferably in the presence of 15% FBS, HGF, and FGF-4 to form differentiated tissues of hepatocyte and biliary ductal lineage. The differentiation factors can be, but are not limited to, HGF, FGF, TGFα, TGFβ, EGF, Oncostatin M, dexamethasone, nicotinamide or a combination thereof. Another aspect provides a method wherein the endodermal stem cells or differentiated progeny cells are administered by contacting the cells with a damaged tissue of the subject, such as damages liver tissue, but can also be contacted with normal tissues. Additionally, an effective amount of endodermal stem cells or differentiated progeny therefrom can be administered to a subject by systemic or localized injection, catheterized delivery, topical application and/or perinatal delivery. One embodiment provides for use of endodermal stem cells in medical therapy. The medical therapy includes treating pancreatic, intestinal, thyroid, lung, bladder or liver damage as a result of an injury or disease. Another embodiment provides for the use of the endodermal stem cells of the invention to a prepare a medicament for treating pancreatic, intestinal, thyroid, lung, bladder, or liver damage as a result of an injury or disease. The medicament may also include a physiologically acceptable carrier.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 depicts the emergence of endodermal stem cells from primary liver cultures. By day 10 the majority of hepatocytes die out and a distinct population of cells appear. These cells, endodermal stem cells, rapidly repopulate the cultures forming very dense colonies by day 20. At this point, endodermal stem cells constitute > 90% of the cells, the remainder appear to be fibroblast-like cells and no hepatocytes remain in the culture. Figure 2 depicts immunohistochemistry (IHC) analysis of endodermal stem cells. Due to high autofluorescence, IHC was conducted on endodermal stem cells. The cells stained positive for HNF-3/3. Endodermal stem cells were negative for oval cell marker OV-6, stellate cell marker, desmin and hepatocyte marker CK18. They also stained negative for biliary epithelial markers CK7 and 19 (data not shown). Figure 3 depicts a Western blot. Protein lysates were transferred to Immuno-Blot PVDF membrane and incubated overnight with antibodies against CK19, CK18, CD34, c-Kit, or /3-actin. Endodermal stem cells (LDSC); negative control (-); rat bone marrow (BM) and rat hepatocyte (Hep) used as controls. Figure 4 depicts morphological changes that endodermal stem cells undergo in hepatic differentiation medium. Between days 5 and 7 fibroblast-like cells appear in the culture. Around day 14, small clusters of hepatocytes emerge, followed by expansion of the cultures. At day 21, 10-20% of the cells have hepatocyte morphology, the rest are fibroblast-like cells and with a few endodermal stem cells. Figure 5 depicts immunohistochemistry (LHC) hepatocytes differentiated from endodermal stem cells at day 21. Clusters of such hepatocytes were subjected to LHC were determined to be positive for CK18 and albumin, suggesting that they are mature hepatocytes. They were negative for CK7 (data not shown). Figure 6 graphically depicts urea production from endodermal stem cell derived hepatocytes.

DETAILED DESCRIPTION OF THE INVENTION Definitions As used herein, the terms below are defined by the following meanings: "Endodermal stem cells" of the present invention are cells that can proliferate, can differentiate into more than one lineage, and populate target tissues. The term "populate" refers to replacing or replenishing damaged cells, supplementing the functional capacity of normal cells, or engrafting cells of a desired type for the first time in a tissue or tissues of interest. Endodermal stem cells have the ability to "proliferate", which is defined as the ability to produce identical, replicate progeny cells without differentiating to another cell type. The term "isolated" refers to a cell which is not associated with one or more cells or one or more cellular components that is associated with the cell in vivo. The phrase "has not been exposed to concurrent stimulation of growth and inhibition of restoration" refers endodermal tissue, such as liver, which has not been manipulated, prior to obtaining cells for the generation of the endodermal stem cells of the invention, to generate concurrent stimulation of growth and inhibition of normal mechanisms for tissue growth (i.e., blockade of the proliferation of hepatocytes). For example, the stimulus for liver growth can occur through several different methods, including surgical resection, nutritional stress, or chemically induced necrosis. Blockade of hepatocyte proliferation is frequently achieved using chemicals (such as 2-acetylammofluorene and various carcinogens) that impede or prevent mitotic division of mature hepatocytes. The methods of the invention require no adverse chemicals (e.g., those which render a cell preparation unsuitable for clinical use) or toxins, and thus, the resulting endodermal stem cells can be used for clinical applications. The term "self-renewal" refers to the ability to produce replicate daughter stem cells having differentiation potential that is identical to those from which they arose. An "endodermally derived" tissue refers to a tissue, the developmental origin of which derives from the endodermal germ layer of an embryo. A cell having a "differentiated phenotype" is one which is more differentiated than the endodermal stem cells of the present invention, for example, a cell that is committed to a specialized path of lineage differentiation or that has reached a point of terminal differentiation. An enriched population of cells refers to a population of cells in which one or more cell types are present in greater numbers than that which could be found in vivo. An increased percentage of a cell type of interest can be provided by, for example, other cells not surviving the culturing process or by dedifferentiation of the cells in the population to a different, more primitive, phenotype of interest. "Selection" as used herein, has its normal meaning in the art, i.e., selection is the process of detecting or identifying a target, such as a protein, nucleic acid molecule, or cell having desired properties, by favoring that target over other undesired members of the same class. Typically, the selection methods described herein utilize selective culture techniques >(e.g. utilizing variable duration, cell density, or amounts of CO₂), such that only proteins, nucleic acid molecules, cells, or cell phenotypes having the desired properties are able to survive, while other undesired proteins, nucleic acid molecules, cells, or cell phenotypes are reduced or decreased. "Expansion" refers to the propagation of a cell or cells without differentiation. "Gene expression products" refer to polypeptides produced by transcriptional activation of a differentially regulated gene. Gene expression products can be used to identify a cell or cells within a population. Preferably, the gene expression products of the present invention are cell-surface proteins or transcription factors that can be identified by detection methods known in the art (e.g., immunohistochemistry, RT-PCR). "Engraft" refers to the process of cellular contact and incorporation into an existing tissue of interest in vivo. A "subject" is a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, humans, farm animals, sport animals and companion animals. Subjects that can benefit from the stem cells and methods of the invention can include, but are not limited to, those suffering from a loss of function of endodermal cells, including but not limited to liver cells, as a result of physical or disease related damage. An "effective amount" generally means an amount which provides the desired local or systemic effect and performance. The terms "comprises," "comprising," and the like can have the meaning ascribed to them in U.S. Patent Law and can mean "includes," "including" and the like. As used herein, "including" or "includes" or the like means including, without limitation.

Isolation and Characterization of Endodermal Stem Cells of the Invention The present invention relates to an endodermal stem cell and methods of isolation, culture, differentiation and use thereof. One aspect of the present invention relates to an isolated endodermal stem cell or a population of endodermal stem cells that express CD45 and CD34, but not CK19, albumin and OV-6. Endodermal stem cells of the invention express CD45, c-Kit, Thy-1, RT1A, CD34 and HNF-3β, but do not express desmin, CK7, CK8, CK18, CK19, albumin, OV-6, RTIB, granulocyte, erythroid and CD3. Methods of the invention can result in the isolation of a population of endodermal stem cells that have different phenotypes from other previously identified stem cells. Unlike traditional isolation and culture protocols for liver stem cells, methods of the invention require no adverse chemicals (e.g., those which render a cell preparation unsuitable for clinical use) or toxins, and thus, the resulting endodermal stem cells can be used for clinical applications. For example, the endodermal tissue, such as liver, is not manipulated to generate concurrent stimulation of growth and inhibition of normal mechanisms for tissue growth (i.e., blockade of the proliferation of hepatocytes). For example, the stimulus for liver growth can be satisfied through several different methods, including surgical resection, nutritional stress, or chemically induced necrosis. Blockade of hepatocyte proliferation is frequently achieved using chemicals (such as 2-acetylaminofluorene and various carcinogens) that impede or prevent mitotic division of mature hepatocytes. In one aspect, methods of isolating endodermal stem cells of the invention are provided including disassociating a an endodermally derived tissue to form a heterogeneous population of primary endodermal cells; culturing the primary cell population in liquid culture media so that cells exhibiting one or more differentiated phenotypes in the primary cell population are selectively decreased; and isolating the endodermal stem cells from said cultured population, h preferred embodiments, primary cells are obtained from liver. Starting material for culture systems of the present invention comprises heterogeneous populations of primary cells, such as primary liver cells, which can be obtained according to any methods well known in the art, including but not limited to, enzymatic degradation, mechanical separation, filtration, centrifugation and combinations thereof. Primary cells can be obtained from any endodermally derived tissue, including but not limited to, liver, stomach, duodenum, exocrine and endocrine pancreas, lung, and thyroid. The endodermal tissue can be obtained from a mammal, such as rat, mouse, or human. Isolation of liver cells from liver tissue has been well known in the art since the mid-1960s (Howard, R.B., et al. (1967) J. Cell Biol. 35: 675-684). Rat hepatocytes were isolated using a combined mechanical/enzymatic digestion technique, subsequently modified by Berry and Friend (Berry, M.N. and Friend, D.S. (1969) J. Cell Biol. 43: 506-520). This technique was further developed by Seglen to become the widely used two-step collagenase perfusion technique (Seglen, P.O., (1976) Methods Cell Biol. 13: 29-83). For whole livers, cannulae can be placed in the existing major blood vessels of the liver, and secured in place by sutures. For segments of liver, cannulae can be placed in patent blood vessel openings on the cut surface, and secured by sutures. In this case, small blood vessel openings need to be sealed to prevent leakage of perfusion solutions from the cut surface. The liver tissue is perfusd with a divalent cation-free buffer solution at 37°C containing a cation- chelating agent, such as ethylenediamine tetraacetic acid (EDTA) or ethylene glycol tetraacetic acid (EGTA). Buffer solutions can comprise salt solutions such as N-2-hydroxyethylpiperazine-N'-ethanesulfonic acid (HEPES) or Williams E medium, but can also include salts such as NaCl, KC1, among others. This leads to disruption of the desmosomal structures that hold cells together. The tissue is then perfused with the buffer solution containing a divalent cation and matrix-degrading enzymes that act to digest the tissue. The hepatocytes are separated by low speed centrifugation, and the hepatocyte pellets obtained are washed with ice-cold buffer solution to purify the cells. The number and quality of the isolated liver cells can vary depending on the quality of the tissue used, the composition of perfusion buffer solutions, and the type and concentration of enzyme. Frequently used enzymes include, but are not limited to, collagenase, pronase, trypsin, Dispase I, hyaluronidase, thermolysin, and/or pancreatin. Collagenase is most commonly used, often prepared from bacteria, and often consists of a poorly purified blend of enzymes, which may have inconsistent enzymatic action. Some of the enzymes exhibit protease activity, which may cause unwanted reactions affecting the quality and quantity of viable/healthy cells. It is understood by those of skill in the art to use enzymes of sufficient purity and quality to obtain viable liver cell populations. Methods for disassociating liver cells other than hepatocytes have also been described in the art, and many of them involve minor variations of the above-mentioned collagenase technique. By way of example, a method for simultaneous isolation of hepatocytes and stellate cells describes perfusion with calcium and collagenase, followed by mincing and filtering the liver tissue through 0.8 mm sterile gauze, placed over a stainless steel mesh to release hepatocytes (Riccalton-Banks, L., et al, (2003) Mol. Cell. Biochem. 248: 97- 102). Differential centrifugation is advantageously used to separate parenchymal from non-parenchymal cells. A gradient can also be optionally used, such as sucrose, Percoll, or Ficoll Hypaque cushions. Similarly, immunomagnetic beads can also be advantageously used to selectively separate cell populations of interest based on cell-surface marker expression. The supernatant fractions presumably containing the non-parenchymal cells, such as stellate cells, can be further sedimented at a higher g force to obtain these suspended cells. Centrifugation speeds can vary anywhere from 50 to 1000 x g. Likewise, filters may be used, alone or in combination with the aforementioned cell separation techniques disclosed above. Filters can be of varying pore size, depending on the type of cell desired. Filtering allows the skilled artisan to separate "small" versus "large" hepatocytes. It is thought that "small" hepatocytes may represent a mixed population of cells that may include liver progenitor-like cells, such as the endodermal stem cells of the invention (Tateno, C, and Yoshizato, K. (1996a) Am. J. Pathol. 149: 1593-1605; (1996b) Am. J. Pathol. 148: 383-392). Porosities can range from 0.2 μm, but can be as large as 1.0 mm. Preferably, the porosity necessary to isolate LD-SCs is 5-10 μm. Other methods of harvesting primary cells exclude enzymatic digestion techniques. Mechanical disruption has been widely used, however the yields of liver cells produced by this approach are often an order of magnitude less than by collagenase digestion, as well as being much less consistent. In addition, the cells are metabolically less active. However, recent methods involving sucrose- EDTA perfusion in combination with controlled vibration in a cooled environment have been developed with reasonable success (Kravchenko, L et al, (2002) Cell. Biol. Int. 26(11): 1003-1006). The liver perfusion is performed in situ using a solution of sucrose containing EDTA (pH 7.4). After perfusion, the liver is removed from the body, placed into a petri dish, and divided finely in a small volume of ice-cold medium. The cells of the liver fragments are liberated by means of controlled mechanical vibrational disaggregation (MVD), using a homogenizer motor. The resultant slurry produced by this method can then be filtered through coarse mesh to give an initial suspension of liver cells. The cells can be suspended in medium, and then centrifuged at low speed to separate cells of interest from undesired or non- viable cells. The above discussion focuses on liver, but techniques to disassociate cells in endodermally derived tissues other than liver are well-known in the art. The invention further provides for enriching endodermal stem cells in a population of cells. Accordingly, in one embodiment, once sufficiently disassociated, primary cells can be cultured under enriching conditions. In preferred embodiments, enrichment is carried out by culturing the cells beyond about 7 days, so that differentiated phenotypes types are decreased. Through methods of the present invention, a cell population is enriched wherein one or more of the differentiated phenotypes found among the primary cells are decreased, so that a endodermal stem cell population can be identified and/or isolated. The cells expressing differentiated phenotypes can be lost because one or more differentiated cell types are physically decreased or eliminated during culture. Alternatively, the differentiated phenotypes can be decreased because one or more cell types retrodifferentiates during culture. Thus, enrichment can take place through a decrease of primary cells having a differentiated phenotype (i.e., through cell death, retrodifferentiation or combinations thereof). As used herein, a "decrease" includes a complete elimination of one or more differentiated phenotypes. Primary cell cultures invariably consist of a heterogeneous population of cells. This population of cells can be separated as described above, but can also be further altered by enriching culture techniques. For example, under standard in vitro cell culture conditions, differentiated liver cells such as hepatocytes, usually do not survive for longer than 10-14 days, and do not proliferate. Thus, the hepatocyte phenotype is selectively lost from the cell population over time. Other decreased phenotypes, can be, for example, mature epithelial cells, such as β-cells, pancreatic acinar cells, gastric epithelial cells, bile duct epithelial cells, liver epithelial cells, and intestinal epithelial cells, among others. hi a preferred embodiment, culturing is extended for about 7 days or greater, such as about 7 to about 14 days, more preferably about 10 to about 14 days. Cultures can be extended for durations beyond 14 days, such as about 15 to about 20 days and even longer, for about 21 to about 28 days, where desired. Selection techniques of the present invention further comprise positive selection, including but not limited to, flow cytometry and affinity purification. Where a heterogeneous population of liver cells is present, non- parenchymal cells, such as the endodermal stem cells of the invention, can be enriched by culturing for about 7 to 21 days. In vitro or ex vivo maintenance of different liver cell types can benefit from enrichment media supplemented with different concentrations of serum, and/or nonnutritional growth factors or supplements, such as HGF, EGF, insulin, and/or glucocorticoids, depending on the cell type desired. Alternatively, enrichment of a preferred liver cell type can also occur if the cells are grown in the absence of serum, growth factors, or other supplements. Selection media within the context of the present invention can comprise cell culture media well known in the art and described herein, but which contain or lack cell-culture supplements, serum, or growth factors that preferentially allow survival of one or more cell types over others, which cells can be reduced or decreased under such conditions. Preferably, selection of endodermal stem / cells described herein occurs by culturing a heterogeneous population of primary cells for at least 7 days or longer. It is believed that by extending the culture of the heterogeneous population, other undesired cell types are killed, fail to proliferate, or de-differentiate in culture. The longer the cells remain under selection, the more unwanted cell types are decreased, and the purity of desired cells increases. A sample of endodermal stem cells of the present invention is "substantially pure" when it is at least 50-60%) of the cell population. But cells are also substantially pure at higher purities. The purity of the endodermal stem cell population after at least one week of culture can be at least 50-60%, but can increase to 60-70%, preferably 70-80%>, more preferably 80-90%, and even more preferably 90-100%, upon culturing beyond at least one week. Purity can be measured by any appropriate standard method, for example, by fluorescence activated cell sorting (FACS). After isolation and enrichment, the endodermal stem cells of the invention can be maintained and allowed to proliferate in culture medium that is well established in the art and commercially available from the American Type Culture Collection (ATCC). Such media include, but are not limited to, Dulbecco's Modified Eagle's Medium (DMEM), DMEM F12 medium, Eagle's Minimum Essential Medium, F-12K medium, Iscove's Modified Dulbecco's Medium, or RPMI- 1640 medium. It is within the skill of one in the art to modify or modulate concentrations of media and/or media supplements as necessary for the cells used. It will also be apparent that many media are available as low-glucose formulations, with or without sodium pyruvate. Also contemplated is supplementation of cell culture medium with mammalian sera. Sera often contain cellular factors and components that are necessary for viability and expansion. Examples of sera include fetal bovine serum (FBS), bovine serum (BS), calf serum (CS), fetal calf serum (FCS), newborn calf serum (NCS), goat serum (GS), horse serum (HS), human serum, chicken serum, porcine serum, sheep serum, rabbit serum, rat serum (RS), serum replacements, and bovine embryonic fluid. It is understood that sera can be heat- inactivated at 55-65°C if deemed necessary to inactivate components of the complement cascade. Modulation of serum concentrations, or withdrawal of serum from the culture medium can also be used to promote survival of one or more desired cell types. Preferably, the endodermal stem cells are cultured in the presence of FBS and serum specific for the species cell type. Preferably, endodermal stem cells derived from rat will benefit from FBS concentrations of about 1% and rat serum concentrations at about 9%. Human endodermal stem cells can be maintained in culture medium comprising FBS at ranges between 0- 5%, and human serum at a concentration between 5-15%. Similarly, murine endodermal stem cells can be maintained in FBS at concentrations ranging from 0-5% and mouse serum at concentrations between 5-15%. Concentrations of serum can be determined empirically. Additional supplements can also be used to supply the cells with the necessary trace elements for optimal growth and expansion. Such supplements include insulin, transferrin, sodium selenium, and combinations thereof. These components can be included in a salt solution such as, but not limited to, Hanks' Balanced Salt Solution® (HBSS), Earle's Salt Solution®, antioxidant supplements, MCDB-201® supplements, phosphate buffered saline (PBS), N-2- hydroxyethylpiperazine-N'-ethanesulfonic acid (HEPES), nicotinamide, ascorbic acid and/or ascorbic acid-2-phosphate, as well as additional amino acids. Many cell culture media already contain amino acids; however some require supplementation prior to culturing cells. Such amino acids include, but are not limited to, L-alanine, L-arginine, L-aspartic acid, L-asparagine, L-cysteine, L- cystine, L-glutamic acid, L-glutamine, L-glycine, L-histidine, L-inositol, L- isoleucine, L-leucine, L-lysine, L-methionine, L-phenylalanine, L-proline, L- serine, L-threonine, L-tryptophan, L-tyrosine, and L-valine. Antibiotics are also typically used in cell culture to mitigate bacterial, mycoplasmal, and fungal contamination. Typically, antibiotics or anti-mycotic compounds used are mixtures of penicillin/streptomycin, but can also include, but are not limited to amphotericin (Fungizone®), ampicillin, gentamicin, bleomycin, hygromycin, kanamycin, mitomycin, mycophenolic acid, nalidixic acid, neomycin, nystatin, paromomycin, polymyxin, puromycin, rifampicin, spectinomycin, tetracycline, tylosin, and zeocin. Hormones can also be advantageously used in cell culture and include, but are not limited to D-aldosterone, diethylstilbestrol (DES), dexamethasone, β- estradiol, hydrocortisone, insulin, prolactin, progesterone, somatostatin/human growth hormone (HGH), thyrotropin, thyroxine, and L-thyronine. β- mercaptoethanol can also be supplemented in cell culture media. Liver cells can also benefit from culturing with triiodithyronine, α-tocopherol acetate, and glucagon. Lipids and lipid carriers can also be used to supplement cell culture media, depending on the type of cell and the fate of the differentiated cell. Such lipids and carriers can include, but are not limited to cyclodextrin (α, β, γ), cholesterol, linoleic acid conjugated to albumin, linoleic acid and oleic acid conjugated to albumin, unconjugated linoleic acid, linoleic-oleic-arachidonic acid conjugated to albumin, oleic acid unconjugated and conjugated to albumin, among others. Albumin can similarly be used in fatty-acid free formulation. Also contemplated is the use of feeder cell layers. Feeder cells are used to support the growth of fastidious cultured cells, including endodermal stem cells. Feeder cells are normal cells that have been inactivated by γ-irradiation. In culture, the feeder layer serves as a basal layer for other cells and supplies cellular factors without further growth or division of their own (Lim, J.W. and Bodnar, A., (2002) Proteomics 2(9): 1187-203). Examples of feeder layer cells typically used with liver cell cultures are hepatocytes and embryonic fibroblasts (Suzuki, A. et al, (2000) Transplant. Proc. 32: 2328-2330), but can be any post- mitotic cell that is capable of supplying cellular components and factors that are advantageous in allowing optimal growth, viability, and expansion of endodermal stem cells. In some cases, feeder cell layers are not necessary to keep stem cells in an undifferentiated, proliferative state, as leukemia inhibitory factor (LLF) has anti-differentiation properties. Often, supplementation of a defined concentration of LIF is all that is necessary to maintain stem cells in an undifferentiated state. Cells in culture can be maintained either in suspension or attached to a solid support, such as extracellular matrix components and synthetic or biopolymers. Stem cells often require additional factors that encourage their attachment to a solid support, such as type I, type II, and type IV collagen, concanavalin A, chondroitin sulfate, fibronectin, "superfibronectin" and/or fibronectin-like polymers, gelatin, laminin, poly-D and poly-L-lysine, Matrigel™, thrombospondin, and/or vitronectin. The maintenance conditions of stem cells can also contain cellular factors that allow stem cells, such as the endodermal stem cells of the invention, to remain in an undifferentiated form. It may be advantageous under conditions where the cell must remain in an undifferentiated state of self-renewal for the medium to contain epidermal growth factor (EGF), platelet derived growth factor (PDGF), leukemia inhibitory factor (LIF), and combinations thereof. It is apparent to those skilled in the art that supplements that allow the cell to self- renew but not differentiate must be removed from the culture medium prior to differentiation. It is also apparent that not all stem cells will require these factors. In fact, these factors may elicit unwanted effects, depending on the cell type. Liver stem or progenitor cells isolated using standard protocols are usually tumorigenic and result in cells that are AFP, HNF-3β, cytokeratin (CK) 19, OV-6, CD45, CD34, c-kit, γ-glutamyl-transferase, and Thy-1 positive. Hepatocytes are CK8, CK18, AFP (relatively low) and HNF-3β positive while desmin, CK7, CK19, OV-6, CD45, CD34, c-kit, and Thy-1 negative. Small hepatob lasts are CK18, CK8, and albumin positive, while negative for AFP, HNF-3β, CK19, OV-6, CD45, CD34, c-kit, and Thy-1. In contrast to these populations, the endodermal stem cells of the invention express HNF-3/3, CD45, CD34, c-kit, RT1A and Thy-1, but not OV-6, CK7, CK18, CK19, CK18, albumin, RTIB, granulocyte, erythroid, CD3 and desmin as demonstrated by RNA and protein expression. This expression pattern indicates that endodermal stem cells of the invention are more primitive than other progenitor cells isolated using traditional methods. These cells have a phenotype (OV-6 and CK19 negative) that is consistent with that of a primitive endodermal stem cell. Accordingly, other methods of positive selection can be used, either alone or together with the methods described above, to identify and/or isolate stem cells of the invention. Other methods of positive selection can include visual selection, using microscopy and optionally additional means of detection, including but not limited to, immunoblotting, immunofluorescence, and/or enzyme-linked immunosorbent assay. Other methods of positive selection can also include, but are not limited to, additional selective culture techniques (e.g., variable cell densities, or amounts of CO₂), flow cytometry, and/or microchip- based methods of cell separation.

Uses for Endodermal Stem Cells of the Invention Endodermal stem cells of the invention can be used for the generation of endodermal lineages, including but not limited to, liver, pancreas, islet cells, lung, intestine, colon, thyroid, bladder and stomach. For liver cells, endodermal stem cells of the invention can be induced to differentiate into hepatocytes and biliary epithelium. For pancreatic cells, acinar cells, ductal cells, islet cells, such as α-cells, β-cells, δ-cells, and other cells can be generated from the endodermal stem cells described herein. Stomach cells that can be generated include, but are not limited to, mucosal cells, parietal cells, chief cells, and gastric endocrine cells. Intestinal cells can also be generated, such as epithelial cells and enteroendocrine cells, but differentiation is not limited to these cell types. Thyroid cells, such as but not limited to, follicular and parafollicular cells can be generated from the endodermal stem cells of the present invention. Additionally, lung cells such as mucosal cells of the airways, which include ciliary epithelium, mucosal cells, serous cells, and alveolar cells, such as those that produce surfactants can be generated from the endodermal stem cells of the present invention. Therefore, one embodiment provides methods for providing epithelial cells, which can include, but are not limited to, liver epithelial cells, biliary ductal epithelial cells, lung epithelial cells, gastric epithelial cells, or bowel epithelial cells, comprising differentiating endodermal stem cells of the invention in the presence of differentiation factors and isolating the epithelial cells. The differentiation factors can be, but are not limited to, HGF, FGF, TGFα, TGFβ, EGF, Oncostatin M, dexamethasone, and/or nicotinamide. Differentiation can occur in vivo or ex vivo. The invention further provides methods for providing endodermally derived cells, which can be, but are not limited to, exocrine pancreatic, endocrine pancreatic, islet, thyroid, intestinal, colon, bladder and/or lung cells. The stem cells of the invention are differentiated in the presence of differentiation factors including, but not limited to, β-cellulin, GLP-1, HGF, KGF, nicotinamide, FGF, FGF-4, TGF-α, TGF-β, activin, cyclopamin, and/or BMP inhibitors, and the differentiation can occur in vivo or ex vivo. Cytokines that can be advantageously used to differentiate endodermal stem cells of the invention into cells of endodermal lineages include, but are not limited to, HGF, FGF, TGFα, TGFβ, EGF, Oncostatin M, dexamethasone, and nicotinamide. These differentiated cell types can be committed to a specific lineage or cell type, or even terminally differentiated. Epithelial cells can also be generated from the endodermal stem cells described herein. Bile duct epithelial cells, lung epithelial cells, liver epithelial cells, bowel epithelial cells, and gastric epithelial cells comprise, for example, the types of cells that can be induced by addition of cytokines including, but not limited to, HGF, FGF, TGFα, TGFβ, EGF, Oncostatin M, dexamethasone, and nicotinamide. Endodermal stem cells of the invention can be induced to differentiate into one or more liver cell types in the presence of cytokines and growth factors, which can be liver-specific (Michalopoulos, G.K. and DeFrances, M.C. (1997) Science 276: 60-66). Preferably, the endodermal stem cells can be induced to differentiate into hepatocytes. Hepatocyte growth factor (HGF), or scatter factor, is a well-known cytokine that promotes differentiation to a hepatocyte phenotype. Similarly, epidermal growth factor (EGF) has also been implicated in proliferation and differentiation of liver cells. Other cytokines commonly associated with hepatic differentiation and proliferation are tumor necrosis factor-α (TNFα), transforming growth factor-α (TGF-α), insulin, IGF-1 and -2, the interleukins, such as but not limited, to IL-4, IL-6, IL-8, IL-9, and IL-13, chemokines, such as macrophage inflammatory protein (MIP- 1 α, MIP- 1 β), RANTES, monocyte chemoattractant protein-1 (MCP-1), the GRO family, platelet derived growth factor (PDGF), keratinocyte growth factor (KGF), fibroblast growth factor- 1, -2, and -4 (FGF), and norepinephrine (Leffert, H.L. et al, (1988) In: The Liver: Biology and Pathobioloev: Koch, K.S. et al, (1990) hi Vitro Cell Dev. Biol. 26: 1011-1023). Preferably, endodermal stem cells can be differentiated in the presence of HGF and FGF-4, but can also include beta- cellulin, GLP-1, HGF, KGF, nicotinamide, TGF-α, TGF-β, activin, cyclopamin, and BMP inhibitors, among others. Endodermal stem cells and other fastidious cells can benefit from co- culturing with another cell type. Such co-culturing methods arise from the observation that certain cells can supply yet-unidentified cellular factors that allow the stem cell to differentiate into a specific lineage or cell type. These cellular factors can also induce expression of cell-surface receptors, some of which can be readily identified by monoclonal antibodies. Generally, cells for co-culturing can be selected based on the type of lineage one skilled in the art wishes to induce, and it is within the abilities of the skilled artisan to select the appropriate cells for co-culture. Methods of identifying and subsequently isolating differentiated cells from their undifferentiated counterparts can be carried out by methods well known in the art. Cells that have been induced to differentiate can be identified by selectively culturing cells under conditions whereby differentiated cells outnumber undifferentiated cells. These conditions include, for example, extending the amount of time that cells are grown in culture, such that survival of a desired cell type is encouraged. Many primary cells achieve senescence, and fail to divide, or die, after a period of time. Other conditions comprise modulating the type and concentration of serum, or culturing the cells in the presence or absence of growth factors and/or cytokines that induce differentiation to another cell type. Differentiation can also be advantageously achieved by modulation of serum concentrations, or withdrawal of serum from the culture. Preferably, endoderm stem cells of the invention are differentiated in the presence of 15% FBS when differentiation to a hepatocyte phenotype is desired. Other methods of inducing differentiation can include, but are not limited to, modulating the acidity of the culture medium, as well as the oxygen and carbon dioxide levels during culture. Similarly, differentiated cells can be identified by morphological changes and characteristics that are not present on their undifferentiated counterparts, such as cell size, the number of cellular processes (i.e., formation of dendrites and/or branches), and the complexity of intracellular organelle distribution. Also contemplated are methods of identifying differentiated cells by their expression of specific cell-surface markers such as cellular receptors and transmembrane proteins. Monoclonal antibodies against these cell-surface markers can be used to identify differentiated cells. Detection of these cells can be achieved through fluorescence activated cell sorting (FACS), and/or enzyme-linked immunosorbent assay (ELISA). From the standpoint of transcriptional upregulation of specific genes, differentiated cells often display levels of gene expression that are different from undifferentiated cells. Reverse-transcription polymerase chain reaction (RT-PCR) can also be used to monitor changes in gene expression in response to differentiation. In addition, whole genome analysis using microarray technology can be used to identify differentiated cells. Accordingly, once differentiated cells are identified, they can be separated from their undifferentiated counterparts, if necessary. The methods of identification detailed above also provide methods of separation, such as FACS, preferential cell culture methods, ELISA, magnetic beads, and combinations thereof. A preferred embodiment of the invention envisions the use of FACS to identify and separate cells based on cell-surface antigen expression. It is understood that the methods of identification and separation are not limited to analysis of differentiated cell types, but can also be used to identify undifferentiated cell types such as the endodermal stem cells of the invention. Endodermal stem cells of the invention can also be used in cell replacement therapies. Undifferentiated stem cells can be administered to a tissue of interest in a subject to supplement functioning cells or replace cells, which have lost function. Alternatively, methods of providing differentiated cells are also contemplated, wherein stem cells are differentiated in the presence of differentiation factors, isolated, and administered into or upon the body of a subject. Preferably, the differentiated cells are cells of the endodermal lineage, such as liver cells (e.g., hepatocytes). Disease states characterized by loss of liver mass and/or function, and that could benefit from endodermal stem cells and methods of the invention include, but are not limited to, Alagille Syndrome, alcoholic liver disease (alcohol-induced cirrhosis), α-1-antitrypsin deficiency, autoimmune hepatitis, Budd-Chiari Syndrome, biliary atresia, Byler Disease, cancer of the liver, Caroli Disease, Brigler-Najjar Syndrome, Dubin- Johnson Syndrome, fatty liver, galactosemia, Gilbert Syndrome, Glycogen Storage Disease I, hemangioma, hemochromatosis, hepatitis A-G, porphyria, primary biliary cirrhosis, sclerosing cholangitis, tyrosinemia, and/or Wilson's Disease. Epithelial cells derived from endodermal stem cells of the invention can be used in cell replacement therapy to treat or alleviate symptoms of several organ diseases. The cells can be used to treat or alleviate congenital liver disorders, for example, storage disorders such as mucopolysaccharidosis, leukodystrophies, GM2 gangliosidosis; increased bilirubin disorders, for instance Crigler- Najjar syndrome; ammonia disorders such as inborn errors of the urea-cycle, for instance ornithine decarboxylase deficiency, citrullinemia, and argininosuccinic aciduria; inborn errors of amino acids and organic acids such as phenylketoinuria, hereditary tyrosinemia, αl-antitrypsin deficiency; and/or coagulation disorders such as factor VIII and LX deficiency. Epithelial cells derived from endodermal stem cells of the invention can also be used in cell replacement therapy to treat or alleviate symptoms of biliary disorders such as biliary cirrhosis and biliary atresia, as well as to treat or alleviate symptoms of pancreas disorders such as pancreatic atresia, pancreas inflammation, and αl-antitrypsin deficiency. Further, pancreas epithelium can be made from the cells of the present invention, as well as β-cells. These cells can be used for the therapy of diabetes (subcutaneous implantation or intra- pancreas or intra-liver implantation). Further, the epithelial cells of the present invention can also be used in cell replacement therapy and/or gene therapy to treat or alleviate symptoms of gut epithelium disorders such as gut atresia, inflammatory bowel disorders, bowel infarcts, and bowel resection. In addition to the liver diseases described above, the cells can also be used to treat acquired liver disorders due to viral infections. The novel methods of stem cell isolation, wherein the cells are isolated in the absence of toxins, have afforded opportunities to use these cells in the clinical setting, wherein they can be used to differentiate into a particular liver-specific, epithelial, and/or endodermal lineage cell of choice, and transplanted into a subject in need thereof, whereby they can replace or replenish damaged or diseased cells, enhance healthy cell function, or provide cells for the first time. Exogenous factors (e.g., cytokines, differentiation factors and other factors) can be administered prior to, after or concomitantly with the endodermal stem cells of the invention. For example, a form of concomitant administration would comprise combining a factor of interest in the culture media prior to administration. Doses or for administrations are variable, may include an initial administration followed by subsequent administrations; but nonetheless, can be ascertained by the skilled artisan, from this disclosure, the documents cited herein, and the knowledge in the art. Endodermal stem cells of the invention or their progeny can be administered via localized injection, including catheter administration, systemic injection, localized injection, parenteral administration, or intrauterine injection into an embryo. ₍ A method to potentially increase cell survival, when introducing the cells into a subject in need thereof, is to incorporate endodermal stem cells or their differentiated progeny of interest into a biopolymer or synthetic polymer. Depending on the subject's condition, the site of injection might prove inhospitable for cell seeding and growth because of scarring or other impediments. Examples of biopolymer include, but are not limited to, cells mixed with fibronectin, fibrin, fibrinogen, thrombin, collagen, and proteoglycans. This could be constructed with or without included cytokines, growth factors, differentiation factors or nucleic acid expression constructs. Additionally, these could be in suspension, but residence time at sites subjected to flow would be nominal. Another alternative is a three-dimensional gel with cells entrapped within the interstices of the cell biopolymer admixture. Again, differentiation factors, growth factors or cytokines could be included within the cells. These could be deployed by injection via various routes described herein. An issue concerning the therapeutic use of endodermal stem cells is the quantity of cells necessary to achieve an optimal effect. In current human studies of autologous mononuclear bone marrow cells, empirical doses ranging from 1 to 4 x 10⁷ cells have been used with encouraging results. However, different scenarios may require optimization of the amount of cells injected into a tissue of interest. Thus, the quantity of cells to be administered will vary for the subject being treated, h a preferred embodiment, between 10 to 10 , more preferably 10 to 10 , and most preferably 3 x 10 stem cells and optionally, 50 to 500 μg/kg per day of a cytokine can be administered to a human subject. However, the precise determination of what would be considered an effective dose may be based on factors individual to each patient, including their size, age, size tissue damage, and amount of time since the damage occurred. Therefore, dosages can be readily ascertained by those skilled in the art from this disclosure and the knowledge in the art. Another issue regarding the use of endodermal stem cells is the purity of the population. Liver cells, for example, comprise mixed populations of cells, which can be purified to a degree sufficient to produce a desired effect. Those skilled in the art can readily determine the percentage of endodermal stem cells in a population using various well-known methods, such as fluorescence activated cell sorting (FACS). Preferable ranges of purity in populations comprising endodermal stem cells are about 50 to about 55%, about 55 to about 60%, and about 65 to about 70%. More preferably the purity is about 70 to about 75%, about 75 to about 80%, about 80 to about 85%; and most preferably the purity is about 85 to about 90%, about 90 to about 95%, and about 95 to about 100%. Purity of the stem cells can be determined according to the cell surface marker profile within a population. Dosages can be readily adjusted by those skilled in the art (e.g., a decrease in purity may require an increase in dosage). The skilled artisan can readily determine the amount of cells and optional additives, vehicles, and/or carrier in compositions to be administered in methods of the invention. Typically, any additives (in addition to the active stem cell(s) and/or cytokine(s)) are present in an amount of 0.001 to 50 % (weight) solution in phosphate buffered saline, and the active ingredient is present in the order of micrograms to milligrams, such as about 0.0001 to about 5 wt %, preferably about 0.0001 to about 1 wt %, most preferably about 0.0001 to about 0.05 wt % or about 0.001 to about 20 wt %, preferably about 0.01 to about 10 wt %, and most preferably about 0.05 to about 5 wt %. Of course, for any composition to be administered to an animal or human, and for any particular method of administration, it is preferred to determine therefore: toxicity, such as by determining the lethal dose (LD) and LD₅₀ in a suitable animal model e.g., rodent such as mouse; and, the dosage of the composition(s), concentration of components therein and timing of administering the composition(s), which elicit a suitable response. Such determinations do not require undue experimentation from the knowledge of the skilled artisan, this disclosure and the documents cited herein. And, the time for sequential administrations can be ascertained without undue experimentation. When administering a therapeutic composition of the present invention, it will generally be formulated in a unit dosage injectable form (solution, suspension, emulsion). The pharmaceutical formulations suitable for injection include sterile aqueous solutions and dispersions. The carrier can be a solvent or dispersing medium containing, for example, water, saline, phosphate buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like) and suitable mixtures thereof. Additionally, various additives which enhance the stability, sterility, and isotonicity of the compositions, including antimicrobial preservatives, antioxidants, chelating agents, and buffers, can be added. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and the like. In many cases, it will be desirable to include isotonic agents, for example, sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin. According to the present invention, however, any vehicle, diluent, or additive used would have to be compatible with the stem cells. Sterile injectable solutions can be prepared by incorporating the cells utilized in practicing the present invention in the required amount of the appropriate solvent with various amounts of the other ingredients, as desired. Examples of compositions comprising endodermal stem cells of the invention include liquid preparations for administration, including suspensions; and, preparations for intramuscular or intravenous administration (e.g., injectable administration), such as sterile suspensions or emulsions. Such compositions may be in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose, dextrose, or the like. The compositions can also be lyophilized. The compositions can contain auxiliary substances such as wetting or emulsifying agents, pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired. Standard texts, such as "REMINGTON'S PHARMACEUTICAL SCIENCE", 17th edition, 1985, incorporated herein by reference, may be consulted to prepare suitable preparations, without undue experimentation. Compositions of the invention are conveniently provided as liquid preparations, e.g., isotonic aqueous solutions, suspensions, emulsions or viscous compositions, which may be buffered to a selected pH. Liquid preparations are normally easier to prepare than gels, other viscous compositions, and solid compositions. Additionally, liquid compositions are somewhat more convenient to administer, especially by injection. Viscous compositions, on the other hand, can be formulated within the appropriate viscosity range to provide longer contact periods with specific tissues. The choice of suitable carriers and other additives will depend on the exact route of administration and the nature of the particular dosage form, e.g., liquid dosage form (e.g., whether the composition is to be formulated into a solution, a suspension, gel or another liquid form, such as a time release form or liquid-filled form). Solutions, suspensions and gels normally contain a major amount of water (preferably purified, sterilized water) in addition to the cells. Minor amounts of other ingredients such as pH adjusters (e.g., abase such as NaOH), emulsifiers or dispersing agents, buffering agents, preservatives, wetting agents and jelling agents (e.g., methylcellulose), may also be present. The compositions can be isotonic, i.e!, they can have the same osmotic pressure as blood and lacrimal fluid. The desired isotonicity of the compositions of this invention may be accomplished using sodium chloride, or other pharmaceutically acceptable agents such as dextrose, boric acid, sodium tartrate, propylene glycol or other inorganic or organic solutes. Sodium chloride is preferred particularly for buffers containing sodium ions. Viscosity of the compositions, if desired, can be maintained at the selected level using a pharmaceutically acceptable thickening agent. Methylcellulose is preferred because it is readily and economically available and is easy to work with. Other suitable thickening agents include, for example, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, carbomer, and the like. The preferred concentration of the thickener will depend upon the agent selected. The point is to use an amount, which will achieve the selected viscosity. Viscous compositions are normally prepared from solutions by the addition of such thickening agents. A pharmaceutically acceptable preservative or cell stabilizer can be employed to increase the life of the compositions. Preferably, if preservatives are necessary, it is well within the purview of the skilled artisan to select compositions that will not affect the viability or efficacy of the endodermal stem cells as described in the present invention. Those skilled in the art will recognize that the components of the compositions should be selected to be chemically inert. This will present no problem to those skilled in chemical and pharmaceutical principles, or problems can be readily avoided by reference to standard texts or by simple experiments (not involving undue experimentation), from this disclosure and the documents cited herein. Compositions can be administered in dosages and by techniques well known to those skilled in the medical and veterinary arts taking into consideration such factors as the age, sex, weight, and condition of the particular patient, and the composition form used for administration (e.g., solid vs. liquid). Dosages for humans or other mammals can be determined without undue experimentation by the skilled artisan, from this disclosure, the documents cited herein, and the knowledge in the art. Suitable regimes for initial administration and further doses or for sequential administrations also are variable, may include an initial administration followed by subsequent administrations; but nonetheless, can be ascertained by the skilled artisan, from this disclosure, the documents cited herein, and the knowledge in the art. Endodermal stem cells described herein can be genetically modified by introducing heterologous DNA or RNA into the cell by a variety of recombinant methods known to those of skill in the art. These methods are generally grouped into four major categories: (1) viral transfer, including the use of DNA or RNA viral vectors, such as retroviruses (including lentiviruses), Simian virus 40 (SV40), adenovirus, Sindbis virus, and bovine papillomavirus, for example; (2) chemical transfer, including calcium phosphate transfection and DEAE dextran transfection methods; (3) membrane fusion transfer, using DNA-loaded membranous vesicles such as liposomes, red blood cell ghosts, and protoplasts, for example; and (4) physical transfer techniques, such as microinjection, electroporation, nucleofection, or direct "naked" DNA transfer. The endodermal stem cells of the invention can be genetically altered by insertion of pre-selected isolated DNA, by substitution of a segment of the cellular genome with pre-selected isolated DNA, or by deletion of or inactivation of at least a portion of the cellular genome of the cell. Deletion or inactivation of at least a portion of the cellular genome can be accomplished by a variety of means, including but not limited to genetic recombination, by antisense technology (which can include the use of peptide nucleic acids, or PNAs), or by ribozyme technology, for example. The altered genome may contain the genetic sequence of a selectable or screenable marker gene that is expressed so that the progenitor cell with altered genome, or its progeny, can be differentiated from progenitor cells having an unaltered genome. For example, the marker may be a green, red, yellow fluorescent protein, β-galactosidase, the neomycin resistance gene, dihydrofolate reductase (DHFR), or hygromycin, but are not limited to these examples. In some cases, the underlying defect of a pathological state is a mutation in DNA encoding a protein such as a metabolic protein. Preferably, the polypeptide encoded by the heterologous DNA lacks a mutation associated with a pathological state. In other cases, a pathological state is associated with a decrease in expression of a protein. A genetically altered endodermal stem cell may contain DNA encoding such a protein under the control of a promoter that directs expression of the recombinant protein. Alternatively, the cell may express a gene that can be regulated by an inducible promoter or other control mechanism where conditions necessitate highly controlled regulation or timing of the expression of a protein, enzyme, or other cell product. Such stem cells, when transplanted into a subject suffering from abnormally low expression of the protein, produce high levels of the protein to confer a therapeutic benefit. For example, the endodermal stem cell of the invention can contain heterologous DNA encoding a metabolic protein such as ornithine transcarbamylase, arginosuccinate synthetase, glutamine synthetase, glycogen synthetase, glucose- 6-phosphatase, succinate dehydrogenase, glucokinase, pyruvate kinase, acetyl CoA carboxylase, fatty acid synthetase, alanine aminotransferase, glutamate dehydrogenase, ferritin, low density lipoprotein (LDL) receptor, P450 enzymes, and/or alcohol dehydrogenase. Alternatively, the cell may contain DNA encoding a secreted plasma protein such as albumin, transferrin, complement component C3, α2-macroglobulin, fibrinogen, Factor XIILC, Factor IX, and/or αl-antitrypsin. Insertion of one or more pre-selected DNA sequences can be accomplished by homologous recombination or by viral integration into the host cell genome. The desired gene sequence can also be incorporated into the cell, particularly into its nucleus, using a plasmid expression vector and a nuclear localization sequence. Methods for directing polynucleotides to the nucleus have been described in the art. The genetic material can be introduced using promoters that will allow for the gene of interest to be positively or negatively induced using certain chemicals/drugs, to be eliminated following administration of a given drug/chemical, or can be tagged to allow induction by chemicals (including but not limited to the tamoxifen responsive mutated estrogen receptor) expression in specific cell compartments (including but not limited to the cell membrane). Calcium phosphate transfection can be used to introduce plasmid DNA containing a target gene or polynucleotide into isolated or cultured endodermal stem cells and is a standard method of DNA transfer to those of skill in the art. DEAE-dextran transfection, which is also known to those of skill in the art, may be preferred over calcium phosphate transfection where transient transfection is desired, as it is often more efficient. Since the cells of the present invention are isolated cells, microinjection can be particularly effective for transferring genetic material into the cells. This method is advantageous because it provides delivery of the desired genetic material directly to the nucleus, avoiding both cytoplasmic and lysosomal degradation of the injected polynucleotide. This technique has been used effectively to accomplish germline modification in transgenic animals. Cells of the present invention can also be genetically modified using electroporation or nucleofection. Liposomal delivery of DNA or RNA to genetically modify the cells can be performed using cationic liposomes, which form a stable complex with the polynucleotide. For stabilization of the liposome complex, dioleoyl phosphatidylethanolamine (DOPE) or dioleoyl phosphatidylcholine (DOPQ) can be added. Commercially available reagents for liposomal transfer include LipofectinS (Life Technologies). Lipofectin, for example, is a mixture of the cationic lipid N-[l-(2, 3-dioleyloyx)propyl]-N-N-N- trimethyl ammonia chloride and DOPE. Liposomes can carry larger pieces of DNA, can generally protect the polynucleotide from degradation, and can be targeted to specific cells or tissues. Cationic lipid- mediated gene transfer efficiency can be enhanced by incorporating purified viral or cellular envelope components, such as the purified G glycoprotein ofthe vesicular stomatitis virus envelope (VSV-G). Gene transfer techniques which have been shown effective for delivery of DNA into primary and established mammalian cell lines using lipopolyamine-coated DNA can be used to introduce target DNA into the endodermal stem cells described herein. Naked plasmid DNA can be injected directly into a tissue mass formed of differentiated cells from the isolated endodermal stem cells. This technique has been shown to be effective in transferring plasmid DNA to skeletal muscle tissue, where expression in mouse skeletal muscle has been observed for more than 19 months following a single intramuscular injection. More rapidly dividing cells take up naked plasmid DNA more efficiently. Therefore, it is advantageous to stimulate cell division prior to treatment with plasmid DNA. Microprojectile gene transfer can also be used to transfer genes into stem cells either in vitro or in vivo. The basic procedure for microprojectile gene transfer was described by J. Wolff in Gene Therapeutics (1994), page 195. Similarly, microparticle injection techniques have been described previously, and methods are known to those of skill in the art. Signal peptides can be also attached to plasmid DNA to direct the DNA to the nucleus for more efficient expression. Viral vectors are used to genetically alter endodermal stem cells of the present invention and their progeny. Viral vectors are used, as are the physical methods previously described, to deliver one or more target genes, polynucleotides, antisense molecules, or ribozyme sequences, for example, into the cells. Viral vectors and methods for using them to deliver DNA to cells are well known to those of skill in the art. Examples of viral vectors that can be used to genetically alter the cells of the present invention include, but are not limited to, adeno viral vectors, adeno-associated viral vectors, retro viral vectors (including lentiviral vectors), alphaviral vectors (e. g., Sindbis vectors), and herpes virus vectors. Endodermal stem cells of the invention can be used for many diverse clinical and pre-clinical applications, which can include, but are not limited to, use in toxicological or genomic screening methods, determination of levels of enzymes and coagulation factors, as well as treatment of the diseases disclosed herein. Endodermal stem cells of the invention can provide a variety of differentiated and undifferentiated cultured cell types for high-throughput toxicological or genomic screening. The cells can be cultured in, for example, 96-well or other multi-well culture plates to provide a system for high- throughput screening of, for example, target cytokines, chemokines, growth factors, or pharmaceutical compositions in pharmacogenomics or pharmacogenetics. Thus, the present invention provides for use of endodermal stem cells to detect cellular responses (e.g., toxicity) to bioactive (biologic or pharmacologic) agents, comprising contacting a culture of cells, or the differentiated progeny thereof, with one or more biologic or pharmacologic agents, identifying one or more cellular response to the one or more biologic or pharmacologic agents, and comparing the cellular responses of the cell cultures to the cellular responses of control cultures. Such responses can be determined by monitoring the activities of molecules such as, but not limited to, alkaline phosphatase, cytochrome P450, urea pathway enzymes, among others. The endodermal stem cells of the invention further provide a unique system in which cells can be differentiated to form specific cell lineages from the same individual. Unlike most primary cultures, these cells can be maintained in culture and can be studied over time. Multiple cultures of cells from the same individual and from different individuals can be treated with the factor of interest to determine whether differences exist in the effect of the cellular factor on certain types of differentiated cells with the same genetic makeup or on similar types of cells from genetically different individuals. Cytokines, chemokines, pharmaceutical compositions and growth factors, for example, can therefore be screened in a timely and cost-effective manner to more clearly elucidate their effects. Cells isolated from a large population of individuals and characterized in terms of presence or absence of genetic polymorphisms, particularly single nucleotide polymorphisms, can be stored in cell culture banks for use in a variety of screening techniques. For example, endodermal stem cells derived from liver from a statistically significant population of subjects, which can be determined according to methods known to those of skill in the art, provide an ideal system for high-throughput screening to identify polymorphisms associated with increased positive or negative response to a range of substances such as, for example, pharmaceutical compositions, vaccine preparations, cytotoxic chemicals, mutagens, cytokines, chemokines, growth factors, hormones, inhibitory compounds, chemotherapeutic agents, and a host of other compounds or factors. Information obtained from such studies has broad implications for the treatment of infectious disease, cancer, and a number of metabolic diseases. Thus, the invention provides methods for using the endodermal stem cells described herein to characterize pharmaco genetic cellular responses to biologic or pharmacologic agents, comprising isolating the cells from a population of subjects, expanding the cells in culture to establish a plurality of cell cultures, optionally differentiating the cells into a desired endodermal lineage, contacting the cell cultures with one or more biologic or pharmacologic agents, identifying one or more cellular responses to the one or more biologic or pharmacologic agents, and comparing the cellular responses of the cell cultures from different subjects. In the method of using endodermal stem cells to characterize pharmacogenetic cellular responses to biologic or pharmacologic agents, or combinatorial libraries of such agents, endodermal stem cells are preferably isolated from a statistically significant population of subjects, culture expanded, and contacted with one or more biologic or pharmacologic agents. Endodermal stem cells of the invention optionally can be induced to differentiate, wherein differentiated cells are the desired target for a certain biologic or pharmacologic agent, either prior to or after culture expansion. By comparing the one or more cellular responses of the cultures from subjects in the statistically significant population, the effects of the biologic or pharmacologic agent can be determined. Effects of the biologic or pharmacologic agent can be induction of apoptosis, changes in gene expression, chromosomal damage, and/or decreases or increases in liver enzyme function. Alternatively, genetically identical endodermal stem cells, or cells differentiated therefrom, can be used to screen separate compounds, such as compounds of a combinatorial library. Gene expression systems for use in combination with cell-based high-throughput screening have been described (Jayawickreme, C. and Kost, T., Curr. Opin. Biotechnol. (1997) 8: 629-634). Rice, et al., which utilizes a cell culture system for primary human umbilical vein endothelial cells, has described a high volume screening technique used to identify inhibitors of endothelial cell activation. (Rice, et al., Anal. Biochem. (1996) 241: 254-259). The cells of the present invention can provide a variety of cell types; both terminally differentiated and undifferentiated, for high-throughput screening techniques used to identify a multitude of target biologic or pharmacologic agents. The endodermal stem cells of the invention provide a source of cultured cells from a variety of genetically diverse subjects, who may respond differently to biologic and pharmacologic agents. The invention also envisions a tissue-engineered organ, or portion, or specific section thereof, a tissue engineered device comprising a tissue of interest and optionally, cytokines, growth factors, or differentiation factors that induce differentiation into a desired cell type, wherein the endodermal stem cells of the invention are used to generate tissues including, but not limited to, pancreas, lung, liver, intestine, thyroid, endocrine, esophagus, colon, stomach, and gall bladder. Tissue-engineered organs can be used with a biocompatible scaffold to support cell growth in a three-dimensional configuration, which can be biodegradable. Tissue-engineered organs generated from the endodermal stem cells of the present invention can be implanted into a subject in need of a replacement organ, portion, or specific section thereof. The present invention also envisions the use of the endodermal stem cells or cells differentiated therefrom as part of a bioreactor, e.g., a liver assist device. Homogenous organs, portions, or sections derived from the endodermal stem cells of the invention can be implanted into a host. Likewise, heterogeneous organs, portions, or sections derived from endodermal stem cells induced to differentiate into multiple tissue types can be implanted into a subject in need thereof. The transplantation can be autologous, such that the donor of the stem cells from which organ or organ units are derived is the recipient of the engineered tissue. The transplantation can be heterologous, such that the donor of the stem cells from which organ or organ units are derived is not that of the recipient of the engineered-tissue. Once transferred into a host, the tissue-engineered organs can recapitulate the function and architecture of the native host tissue. The tissue- engineered organs will benefit subjects in a wide variety of applications, including the treatment of cancer and other disease disclosed herein, congenital defects, or damage due to surgical resection. The endodermal stem cells of the present invention can generate engineered tissues that are functionally optimized for a particular anatomical section within an organ. For example, the stomach has many functions, some of which are specific to distinct anatomical sections, such as the fundus, corpus or antrum. A gastrin-producing tissue-engineered stomach can be efficiently produced from endodermal stem cells of the invention that are induced to differentiate into organs or organ units comprising each individual cell or tissue type. Another example is the small and large intestine. For example, organ or organ units derived from small and large intestine can have general absorption properties of small intestine, but the water absorption and hardiness of large intestine. Other known tissue-specific locations of particular functions within organs are listed in standard physiology textbooks (see, for example, Guyton and Hall, "Textbook of Medical Physiology, 10^th ed." (2000) W.B. Saunders Co). Thus, one aspect of the present invention provides a tissue-engineered organ, or portion thereof, or specific section thereof, or a tissue engineered device including one or more tissues of interest and optionally, cytokines, growth factors, or differentiation factors that induce differentiation into a desired cell type, wherein the endodermal stem cells of the invention are used to generate tissues including, but not limited to, pancreas, lung, liver, intestine, thyroid, endocrine, esophagus, colon, stomach, and/or gall bladder. Tissue- engineered organs and devices can comprise a scaffold, which can be polymeric and/or biodegradable, to support cell growth in a three-dimensional configuration. Tissue-engineered organs generated from the endodermal stem cells of the present invention can be implanted into a subject in need of augmented or replacement organ, portion, or specific section thereof. Polymer scaffolds that can be used in the development of tissue- engineered organs derived from the stem cells of the invention function in place of a connective tissue scaffold or matrix, and are designed to optimize gas, nutrient, and waste exchange by diffusion. Polymer scaffolds can comprise, for example, a porous, non- woven array of fibers. The polymer scaffold can be shaped to maximize surface area, to allow adequate diffusion of nutrients and growth factors to the cells. Taking these parameters into consideration, one of skill in the art could configure a polymer scaffold having sufficient surface area for the cells to be nourished by diffusion until new blood vessels interdigitate the implanted engineered-tissue using methods known in the art. Polymer scaffolds can comprise a fibrillar structure. The fibers can be round, scalloped, flattened, star-shaped, solitary or entwined with other fibers. Branching fibers can be used, increasing surface area proportionately to volume. Unless otherwise specified, the term "polymer" includes polymers and monomers that can be polymerized or adhered to form an integral unit. The polymer can be non-biodegradable or biodegradable, typically via hydrolysis or enzymatic cleavage. The term "biodegradable" refers to materials that are bioresorbable and/or degrade and/or break down by mechanical degradation upon interaction with a physiological environment into components that are metabolizable or excretable, over a period of time from minutes to three years, preferably less than one year, while maintaining the requisite structural integrity. As used in reference to polymers, the term "degrade" refers to cleavage of the polymer chain, such that the molecular weight stays approximately constant at the oligomer level and particles of polymer remain following degradation. Materials suitable for polymer scaffold fabrication include polylactic acid (PLA), poly-L-lactic acid (PLLA), poly-D-lactic acid (PDLA), polyglycolide, polyglycolic acid (PGA), polylactide-co-glycolide (PLGA), polydioxanone, polygluconate, polylactic acid-polyethylene oxide copolymers, modified cellulose, collagen, polyhydroxybutyrate, polyhydroxpriopionic acid, polyphosphoester, poly(alpha-hydroxy acid), polycaprolactone, polycarbonates, polyamides, polyanhydrides, polyamino acids, polyorthoesters, polyacetals, polycyanoacrylates, degradable urethanes, aliphatic polyesterspolyacrylates, polymethacrylate, acyl substituted cellulose acetates, non-degradable polyurethanes, polystyrenes, polyvinyl chloride, polyvinyl flouride, polyvinyl imidazole, chlorosulphonated polyolifins, polyethylene oxide, polyvinyl alcohol, teflon RTM, nylon silicon, and shape memory materials, such as poly(styrene- b/oc/c-butadiene), polynorbornene, hydrogels, metallic alloys, and oligo(e- caprolactone)diol as switching segment/oligo( >-dioxyanone)diol as physical crosslink. Other suitable polymers can be obtained by reference to The Polymer Handbook, 3rd edition (Wiley, N.Y., 1989). Factors, including nutrients, growth factors, inducers of differentiation or de-differentiation, products of secretion, immunomodulators, inhibitors of inflammation, regression factors, or other biologically active compounds can be incorporated into or can be provided in conjunction with the polymer scaffold.

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the cells of the invention, and are not intended to limit the scope of the invention.

EXAMPLES

Example 1: Isolation of Endodermal Stem Cells Hepatocytes from 150 to 300 gm Sprague Dawley rats were harvested by a modified two-step in situ collagenase perfusion technique (cells with a similar phenotype were generated from Fischer rats as well as from C57-B16 mice). Rats were anesthetized with pentobarbital at a dose of about 6-lOmg/lOOg of body weight. A laparatomy was performed. After portal vein cannulation, perfusion was performed at a rate of 25 ml/min for 15 min with perfusion solution (Per 1), which contains 143 mM NaCl, 6.7 mM KC1, 10 mM N-2- hydroxyethylpiperazine-N'-ethanesulfonic acid (HEPES), 1.0% fatty acid-free bovine albumin (BSA), and 0.05% collagenase (clostridiopeptidase A) at pH7.6. The liver was then removed from the rat and transferred to a petri dish containing cold Williams' E medium. The liver was gently combed to remove hepatocytes. This suspension was filtered through 100 μM sterile nylon gauze, and the remaining cells went through three centrifugations (50 x g for 1 min) and washings in William's E Medium. Each rat harvest yielded about 60 to about 350 million hepatocytes depending on the initial size of the animals. Freshly isolated rat liver cells were washed twice in room temperature phosphate buffered saline (PBS) to remove dead cells and cell debris. Cell viability, determined by trypan blue exclusion, varied between 50% and 95%. The culture medium consisted of 87.5% DMEM-LG (Cellgro) + 12.5% MCDB- 201 (Sigma) supplemented with 9% rat serum (Equitech, TX) , 1% FBS (Hyclone; FBS can be eliminated from the culture medium, although this lowers the overall efficiency of the isolation procedure), 1 mg/ml BSA (Sigma), 100 μM β-mercaptoethanol (Gibco), 25 mM HEPES (Cellgro), 5 mM Nicotinamide (Sigma) and Penicillin (100U/ml)/Streptomycin (100 μg/ml) (Gibco) with a final concentration of bicarbonate at 2.775 g/L. The cells were cultured on Type I collagen (rat tail collagen, Upstate Biotechnology) coated tissue culture plates or flasks (Falcon) at a density of about 2.5 X 10⁴ cells/ml and about 5.0 X 10³ cells/cm² at 37°C and 7% CO₂ (it was determined that the efficiency of endodermal stem cell isolation was increased by culture at 7%> CO as opposed to 5% CO₂ concentration). The seeding density was about 33%> lower for younger rats that weighed less than 200 g. The medium was changed by 80% on days 4 (the first day was considered as day 0; LD-SCs can also be generated in cultures, with lower efficiency, without any media change on day 4). After the media change on day 4, no media changes were made and endodermal stem cells were allowed to appear and proliferate for the following 2-3 weeks. On day 15 and 25, endodermal stem cells were harvested and evaluated by a variety of techniques, including FACS, immunofluorescence, PCR, immunohistochemistry, and in vitro and in vivo differentiation ability. The cultured liver cells (e.g., hepatocytes) quickly attached to the culture dishes and formed monolayer cultures with a confluency of about 20-30% within 48 hours. Following the media change on day 4, epithelial cells gradually died, and by day 10, fewer than ten percent of the cells remained alive (Figure 1). Meanwhile, between days 7 and 10, a new population of cells emerged that had a different morphology (5-25 micron in diameter), were round to oval and either firmly attached to the dishes or were very loosely attached and/or free floating. Over the next 7 to 14 days, the number of these cells increased rapidly reaching the average maximum density of about 2 to 3 X 10⁴ cells/cm² (Range: about 1 to A 9

5 X 10 cells/cm ). At this density, they generally formed tightly packed, round cell clusters reminiscent of colonies formed in hematopoietic cultures, h this stage, the cultures also contained few (1-5%) fibroblast-like cells that were not present initially in the cultures. The cells have been maintained for several weeks at high density when cultured in fresh medium. Example 2: hnmunohistochemistrv Immunocytochemical analysis on attached cells was performed by using the streptavidin-biotin-peroxidase method or the streptavidin-biotin alkaline phosphatase method (Dako, Glostrup, Denmark) after fixation with 4% paraformaldehyde. Mouse monoclonal antibodies (mo-Abs) were against cytokeratin-7 (CK7; Dako, 1:75), CK18 (Cymbus Biotechnology, Chandlers Ford, UK, 1:10), CK19 (Maine Biotechnology Services, Portland, U.S., 1:75), desmin (ICN, 1:12) and OV6 (gift from Dr. S. Sell, University of Texas Health Science Center, Houston, 1:50). Rabbit antisera were against HNFl (Santa Cruz Biotechnology, Santa Cruz, U.S., 1:50) and albumin (ICN/Cappel, Aurora, U.S., 1:500). Goat antiserum was against Hnf3β (Santa Cruz, 1:50). Anti-mouse and anti-rabbit biotinylated secondary antibodies were from Amersham Pharmacia, Uppsala, Sweden and diluted 1 :300. Anti-goat biotinylated secondary antibody was from Vector Laboratories, Burlingame, U.S. and diluted 1:300. Color development was performed with the D AB+ Substrate-Chromogen System (Dako) or with the New Fuchsin Substrate System (Dako). Immunofluorescence studies were attempted on the isolated endodermal stem cells, but high autofluorescence made interpretation of such studies difficult. Therefore, immunohistochemistry studies were completed to phenotype this novel population of endodermal stem cells. The endodermal stem cells of the invention are desmin, cytokeratin (CK) 7, CK8, CK18, CK19, albumin, and OV-6 negative (Figure 2). Endodermal stem cells are positive for HNF-3β, whereas staining for α-fetoprotein (AFP) was inconclusive. Hepatocytes were CK7, CK19, desmin, and OV-6 negative, while albumin and ' HNF-3β positive. Biliary ductal cells stained positive for CK19 and OV-6. Stellate or Ito cells were desmin positive. The small number of fibroblast-like cells found adherent to the plates stained positive for desmin, but was negative for CK7, CK19, OV-6, albumin, and HNF-3,8. Example 3: Flow cytometric analysis For fluorescence-activated cell sorting (FACS), endodermal stem cells, freshly isolated rat bone marrow, or freshly isolated rat hepatocytes were stained sequentially with primary antibodies (CD3, c-Kit, Thy-1, CD-45, RTIB, RT1A, Granulocyte, or anti-erythroid antibodies. If the primary antibody was not fluorescently conjugated, the cells were washed and then incubated with an anti- mouse IgG fluorescently conjugated antibody and analyzed using a FACSCalibur (Becton Dickinson). Cells were also incubated with propidium iodide to eliminate dead cells. Appropriate isotype controls were used and were found to be negative and positive controls which were found to be positive. (The antibodies used include: CD3: Anti-CD3 FITC (BD Catalogue # 557354), Anti- CD3 PE (BD Catalogue # 550353), Anti-CD3 APC (BD Catalogue # 557030); c-Kit: Anti-c-Kit (Santa cruz sc-168); Goat anti-rabbit IgG Fc fragment (111- 096-003 Jackson hnmunoresearch); Thy-1: Anti-Thyl.l FITC (BD Catalogue # 554897); Anti-Thyl.l FITC (BD Catalogue # 551401); CD45: Anti-CD45 FITC (BD Catalogue # 554877), Anti-CD45 PE (BD Catalogue # 554878); RTl A: Anti-RTIA-FITC (BD Catalogue # 554919), Anti-RTIA-PE (BD Catalogue # 559993); RTIB: Anti-RTIB-FITC (BD Catalogue # 554928), Anti-RTIB-PE (BD Catalogue # 554929); Granulocyte: Anti-GR FITC (BD Catalogue # 554907); Anti-GR PE (BD Catalogue # 550002); Erythroid: Anti-erythroid (BD Catalogue # 550961); anti IgM FITC (BD Catalogue # 553408); and anti IgM PE (BD Catalogue # 553409).) Flow cytometric studies demonstrated that the endodermal stem cells are CD45 (bright), c-kit (dim), Thy-1 (dim), and RTl A positive, while RTIB, granulocyte (a marker present on rat granulocytes), erythroid (a marker present on rat erythroid cells) and CD3 (a maker on T-cells) negative. Example 4: RT-PCR and O RT-PCR RNA was extracted from 3 x 10⁵ to 3 x 10⁶ endodermal stem cells. mRNA was reverse transcribed and cDNA underwent 40 rounds of amplification (ABI PRISM 7700, Perkin Elmer/Applied Biosystems) as follows: 40 cycles of a two step PCR (95°C for 15 seconds, 60°C for 60 seconds) after initial denaturation (95°C for 10 minutes) with 2 μl of DNA solution, IX TaqMan S YBR Green Universal Mix PCR reaction buffer. Primers used for amplification are listed in Table 1. mRNA levels were normalized using glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a housekeeping gene, and compared with mRNA levels in freshly isolated rat hepatocytes, rat hepatocytes cultured for one to four days, or freshly isolated rat bone marrow. Table 1 : Primers For RT-PCR Reactions

Quantitative real time polymerase chain reaction (PCR) confirmed the immunohistochemical and flow cytometric data. c-Kit, Thy-1, CD34 transcripts were detected in endodermal stem cells at levels between about 1 and 2.5% that of whole bone marrow. These transcripts were not detected in hepatocytes. The endodermal stem cells express low levels of cytokeratin-18, cytokeratin-19, and transthyretin. Although α-fetoprotein staining was inconclusive, it was repeatedly detected on the RNA level, albeit at 0.1 % that of hepatocytes. In addition, endodermal stem cells express high levels of c-met mRNA relative to hepatocytes and CXCR4 mRNA relative to bone marrow. Table 2 contains the expression levels of various markers detected by RT and Q-RT-PCR.

Table 2: Expression Levels of Markers in Hepatocytes and endodermal stem cells

*NT - Not Tested, NE - Not Expressed + or - indicates whether the sample is positive or negative for the respective marker. Cycle number is the PCR cycle at which the PCR product reaches a certain specified fluorescence intensity which is kept constant for all samples. The relative expression values represent endodermal stem cell mRNAs relative to hepatocytes or bone marrow where indicated. For example, for c-Kit, CD34, Thy-1, and CXCR4, relative expression numbers are relative to bone marrow as they are not expressed by hepatocytes. Likewise, CK19, CK18, AFP, albumin, TTR, HNF-1, HNF-3/3, and cMET expression are relative to hepatocytes as they are not expressed by bone marrow. Fresh hepatocytes were negative for hematopoietic markers CD45, c-Kit, Thy-1 and CD34.

The cells were further analyzed by Q-PCR as described above and below, the results of which are presented in Table 3 below, for the following markers: CDX1 (Primers: 5'-cccaaggacgtgttctgagt-3' (SEQ ID NO:15) and 5'- gccctaggacacaagagctg-3' (SEQ ID NO:16)), PAPl-F (Primers: 5'- ctgccttagaccgtgctttc-3' and 5'-cccttgtccatgatgctctt-3'(SEQ ID NO: 17)), CCK-F (Primers: 5'-tgccgaggactacgaatacc-3' (SEQ ID NO: 18) and 5'- ggtctgggagtcactgaagg-3' (SEQ TD NO: 19)), Gastrin (rat) (Primers: 5'- agatgcctcgactgtgtgtg-3 ' (SEQ ID NO:20) and 5 '-gaagtgttgaggaccctgga-3 ' (SEQ ID NO:21)); Musashil (Primers: 5'-cgagctcgactccaaaacaat-3' (SEQ ID NO:22) and 5'-ggctttcttgcattccacca-3' (SEQ ID NO:23)), TTF1 (Primers: 5'- aacccacttgtccctgacac-3' (SEQ ID NO:24) and 5'-cttgtcgatgatgccctttt-3' (SEQ LD NO:25)), hexl (Primers: 5'-gctctggaaccccttcctac-3' (SEQ ID NO:26 and ggattctcctgcttcagtcg (SEQ ID NO:27)), tcf4 (Primers: 5'-cggggttaaggagcagt-3' (SEQ ID NO:28) and 5'-gggaggaagagaaggtgtcc -3' (SEQ ID NO:29)), glucagon (Primers: 5'-aacaacattgccaaacgtca-3' (SEQ ID NO:30) and 5'- acggcgggagtctaggtatt-3 ' (SEQ ID NO:31)), cdx2 (Primers: 5 '- agtgggattgtggacctcag-3' (SEQ ID NO:32) and 5'-gaaagcttggtgcctgtagc-3' (SEQ ID NO:33)), and secretin (Primers: 5 '-gtcgaacactcaggccctac-3 ' (SEQ ID NO:34) and gaagttcttgcagccagctt (SEQ ID NO:35)). Quantitative RT-PCR analysis of endodermal stem cells: Endodermal stem cells were harvested and underwent quantitative RT-PCR using the SYBR green method for mRNAs as indicated. The mRNA levels were normalized using rat GAPDH as a housekeeping gene. + or - indicates whether the sample is positive or negative for the respective marker. Cycle Number is the PCR cycle at which the PCR product reaches a certain specified fluorescence intensity which is kept constant for all samples. The background level of the assay is around 35-40 cycles depending on the specific primer. The relative expression values represent endodermal stem cell mRNA relative to hepatocytes, duodenum, pyloric stomach, or thyroid where indicated. For TTF-1, thyroid tissue was used as a control. Forj Secretin, CDX1, CDX2, relative expression numbers are relative to duodenum as they are not expressed by hepatocytes. Likewise, for Musashi and HEX1 are relative to hepatocytes as they are not expressed by duodenum. For Gastrin, relative expression numbers are relative to pyloric stomach.

Table 3

*NT - Not Tested, NE - Not Expressed Duod - Duodenum, PS - Pyloric Stomach

Example 5: Western Blotting Protein lysates, obtained from endodermal stem cells, rat hepatocytes, or rat BM were separated on 8.0% polyacrylamide electrophoresis gels. Gels were transferred to blots and after blocking, blots were incubated with antibodies against CK18 (Cymbus Biotechnology, Chandlers Ford, UK, 1:100), CK19 (Maine Biotechnology Services, Portland, U.S., 1:200), CD34 (Santa Cruz, 1 :250), CDl 17 (Santa Cruz, 1 :250). Blots were washed and incubated with a goat anti-mouse or ant-rabbit horseradish peroxidase-conjugated antibody (1:10,000 and 1 :20,000 dilution). Bands were visualized by means of an enhanced chemiluminescence (ECL) detection system. Western blot analysis demonstrated that CD34 and c-kit are present at the protein level in endodermal stem cells, whereas CK18 was absent (Figure 3). CK19 expression was variable, as one of four blots was positive.

Example 6: Differentiation of endodermal stem cells Endodermal stem cells were obtained from 15-25 day cultures by pipetting and tapping the dishes to avoid contaminating the samples with strongly adherent cells. Cell were replated on collagen-coated tissue culture plates ( 6 to 24 well plates) at a density of 1 X 10⁵ cells/cm² in expansion medium supplemented with 15%. FBS and 9%. rat serum, 20 ng/ml HGF (R&D, Minneapolis) and 10 ng/ml of FGF-4 (R&D). The medium was changed every 5 to 7 days and supernatant was flash frozen and kept for functional analysis. Cells were analyzed at 21 days. On several occasions, some cells in the endodermal stem cells cultures underwent spontaneous morphological change from small round/oval cells to epithelial cells with morphological features of hepatocytes (Figures 4-5). Such morphological changes could also be induced by culturing the endodermal stem cells with 15%, HGF and FGF4. This resulted in foci of epithelial cells that stained positive for CK18 and albumin, consistent with hepatocyte differentiation, hi some cultures, endodermal stem cells formed lumen structures that were surrounded by CK19 positive cells, a marker of biliary duct epithelium.

Example 7: Urea Production from Differentiated Endodermal Stem Cells Urea concentrations were determined by a colorimetric assay per manufacturer's instructions (Sigma- Aldrich) hepatocytes derived from endodermal stem cells. Briefly, 100 μl of culture supernatant or media was added to a cuvette. 0.5 ml of a urease solution was added and incubated for twenty minutes. 1 ml of phenol nitroprusside was added, followed by 1 ml of alkaline hypoclorite. 5 ml of water was added to the cuvette and the sample was mixed and allowed to incubate for 30 minutes before the absorbance reading was examined. Rat hepatocytes grown in monolayer were used as positive controls and unused culture medium used as a negative control. Since the assay also measures ammonia, samples were also assessed for ammonia before and after urease addition. No urea or ammonia was detected in culture medium alone. Endodermal stem cells do not produce urea in vitro. When endodermal stem cells were cultured for 2 weeks in hepatogenic differentiated media (as described above), endodermal stem cells derived hepatocyte-like cells produced urea. (Figure 6)

Example 8: Endodermal Stem Cells Transfected with GFP Retrovirus Endodermal stem cells and GFP retrovirus (MSCV) were incubated in retrovirus supernatant with 8 μM Polybrene for 5 hours, followed by one wash with PBS. The cells were then re-cultured in the original conditioned media. Transduction efficiency was determined at 72 hours by counting 10 high power fields on a fluorescent microscope. Any method available to the art to transfect cells can be employed to transfect endodermal stem cells. Approximately 80% of the endodermal stem cell population was transfected with GFP retrovirus was infected and expressed GFP.

Example 9: Transplantation of Endodermal Stem Cells into Rag-2-τc Null Mice as a Model of Bone Marrow Repopulation Female rag-2-γo null mice were lethally irradiated at 750 rads. Rat bone marrow cells and GFP-positive mouse bone marrow cells were isolated from Sprague Dawley rats and -actin-GFP mice respectively using standard techniques and protocols. The animals were broken up into 3 groups. The experimental group included animals injected with 1X10⁶ endodermal stem cells, while the control groups included animals injected with 1X10 rat bone marrow cells or 1X10⁶ GFP-positive bone marrow cells. The peripheral blood from these animals will be analyzed for evidence of bone marrow engraftment about 8 weeks after injection. Other organs will also be analyzed for evidence of engraftment.

Example 10: Transplantation of Endodermal Stem Cells into Mice as a Model for Liver Engraftment and Repopulation The ability of endodermal stem cells to engraft into liver, differentiate into mature hepatocytes and biliary duct, proliferate in vivo, and produce tumors after administration will be examined. NOD-SCID mice will be grouped in three groups (one experimental group and two control groups). In the experimental group, about 3,000,000 endodermal stem cells will be transplanted into NOD- SCID mice, for example, by injecting the cells either into the portal vein or into the spleen (which will then deliver the cells to the liver). For the two control groups, one will group will not receive donor cells, while the other group will receive rat hepatocytes. hi one situation, all transplanted mice will be female, while all done cells will be isolated form male animals, allowing transplanted cells to be easily identified (through Y chromosome staining). Additionally, it is planned to precondition all transplanted mice with retrorsme to prevent hepatic growth. After preconditioning, a partial hepatectomy will be performed. Thus, due to retrorsine preconditioning and the loss of liver tissue due to partial hepatectomy, all hepatic regrowth should result from the transplanted cells.

BIBLIOGRAPHY Baumann, U., Crosby, H.A., Ramani, P., Kelly, D.A., Strain, A.J.: "Expression of the stem cell factor receptor c-kit in normal and diseased pediatric liver: identification of a human hepatic progenitor cell?" (1999) Hepatology 30: 112-117. Berry, M.N., and Friend, D.S.: "High-yield preparation of isolated rat liver parenchymal cells: a biochemical and fine structural study" (1969) J. Cell Biol. 43: 506-520. Bucher, N.L.R.: "Regeneration of mammalian liver" (1963) hit. Rev. ' Cytol. 15:245-300. Cao, S., CO. Esquivel, and E.B. Keeffe, New approaches to supporting the failing liver. Annu Rev Med. (1998) 49: 85-94. Evarts, R.P., Nagy, P., Marsden, E., Thorgeirsson, S.S.: "A precursor- product relationship exists between oval cells and hepatocytes in rat liver" (1987) Carcinogenesis 8: 1737-1740. Evarts, R.P., Nagy, P., Nakatsukasa, H., Marsden, E., Thorgeirsson, S.S.

"In vivo differentiation of rat liver oval cells into hepatocytes" (1989) Cancer Res. 49: 1541-1. Fausto, N., Thompson, N.L., Braun, L. (1987) hi: Pretlow, T.G., Pretlow, T.P.P. (Eds.) Purification and Culture of Oval Cells from Rat Liver, Cell Separation: Methods and Selected Applications, Vol. 4. Academic Press, New York, NY, pp.45-77. Fausto, N., Lemire, J.M., and Shiojiri, N.: "Cell lineages in hepatic development and the identification of progenitor cells in normal and injured liver" (1993) Proc. Soc. Exp. Biol. Med. 204(3): 237-41. Fausto, N.: "Liver Regeneration" (2000) J. Hepatol. 32: 19-31. Fausto, N.: "Liver Regeneration" (2001) In: Arias, I.M., Boyer, J.L., Chisari, F.V., Fausto, N., Schachter, D., Shafritz, D.A. (Eds.) The Liver Biology and Pathobiology Lippincott, Williams, and Wilkins, New York, NY, pp.591-60. Gressner, A.M.: "Cytokines and cellular crosstalk involved in the activation of fat-storing cells" (1995) J Hepatol. 22(2 Suppl): 28-36. iGrisham, J.W.: "Cell types in long-term propagable cultures of rat liver" (1980) Ami. NY Acad. Sci. 349: 128-137. Gupta, S., Aragona, E., Vemuru, R.P., Bhargava, K., Burk, R.D., Roy Chowdhury, J.: "permanent engraftment and function of hepatocytes delivered to the liver: implications for gene therapy and liver repopulation" (1991) Hepatology 14: 144-149. Gupta, S. and C.E. Rogler, Lessons From Genetically Engineered Animal

Models VI. Liver repopulation systems and study of pathophysiological mechanisms in animals. Am J Physiol. (1999) 277(6 Pt 1): G1097-102. Herring, A.S., Raychaudhuri, R., Kelley, S.P., and Iype, P.T.: "Repeated establishment of diploid epithelial cell cultures from normal and partially hepatectomized rats" (1983),In Vitro 19: 576-588. Housset, C.N., Rockey, D.C., Friedman, S.L., and Bissell, D.M.: "Hepatic lipocytes: a major target for endothelin-1". (1995) J Hepatol. 22(2 Suppl): 55-60. Howard, R.B., Christensen, A.K., Gibbs, F.A., and Pesch, L.A.: "The enzymatic preparation of isolated intact parenchymal cells from rat liver" (1967) J. Cell Biol. 35: 675-684. Inaoka, Y. (1967). Significance of the so-called oval cell proliferation during azo-dye hepatocarcinogenesis. Gann. 58: 355-366. Jayawickreme, CK. and Kost, T.A.: "Gene expression systems in the development of high-throughput screens" (1997) Curr. Opin. Biotechnol. 8: 629- 634. Joseph, B., Malhi, H., Bhargava, K.K., Palestro, C.J., McCuskey, R.S., Gupta, S.: "Kupffer cells participate in early clearance of syngeneic hepatocytes transplanted in the rat liver" (2002) Gastroenterology 123(5): 1677-85. Koch, K.S., and Leffert, H.L.: "Growth control of differentiated adult rat hepatocytes in primary culture" (1980) Ann. NY Acad. Sci. 349: 111-127. Koch, K.S., Lu, X.P., Brenner, D.A., Fey, G.H., Martinez-Conde, A., and Leffert, H.L.: "Mitogens and heatocyte growth control in vivo and in vitro" (1990) h Vitro Cell. Dev. Biol. 26: 1011-1023. Kravchenko, L., Petrenko, A., Shanina, I., and Fuller, B.: "A simple non- enzymatic method for the isolation of high yields of functional rat hepatocytes" (2002) Cell Biol. Int. 26(11): 1003-1006. Lesch, R., Reutter, W., Keppler, D., and Decker, K (1970). Liver restitution after acute galactosamine hepatitis. Autoradiographic and biochemical studies in rats. Exp Mol Pathol. 13: 58-69. Leffert, H.L., Koch, K.S., Lad, P.J., Shapiro, P., Skelly, H., and de Hemptinne, B.: "Hepatocyte regeneration, replication and differentiation" (1988) In: The Liver: Biology and Pathobiology (Arias, I., Popper, H., Schacter, D., and Shafritz, D., eds.), 2^nd ed., Raven, New York, pp. 833-850. Lim, J.W., and Bodnar, A.: "Proteome analysis of conditioned medium from mouse embryonic fibroblast feeder layers which support the growth of human embryonic stem cells". (2002) Proteomics. 2(9): 1187-203. Malhi, H., Annamaneni, P., Slehria, S., Joseph, B., Bhargava, K.K.,

Palestro, C.J., Novikoff, P.M., Gupta, S.: "Cyclophosphamide disrupts hepatic sinusoidal endothelium and improves transplanted cell engraftment in rat liver" (2002) Hepatology 36: 112-121. Matsusaka, S., et al., The role of oval cells in rat hepatocyte transplantation. Transplantation. (2000) 70(3): 441-6. Marceau, N., Goyette, R., Deschenees, J., and Valet, J.P.: "Morphological differences between epithelial and fibroblast cells in rat liver cultures, and the roles of cell surface fibronectin and cytoskeletal element organization in cell shape" (1980) Ann. NY Acad. Sci. 349: 138-152. Michalopoulos, G.K. and DeFrances, M.C: "Liver Regeneration" (1997) Science 276: 60-66. Mitaka, T., et al., Effects of mitogens and co-mitogens on the formation of small-cell colonies in primary cultures of rat hepatocytes. J Cell Physiol. (1993) 157(3): 461-8. Mitaka, T., et al., Growth and maturation of small hepatocytes. J Gastroenterol Hepatol. (1998) 13 Suppl: S70-7. Nagai, H., et al., Differentiation of liver epithelial (stem-like) cells into hepatocytes induced by coculture with hepatic stellate cells. Biochem Biophys Res Commun. (2002) 293(5): 1420-5. Petersen, B.E., et al, Hepatic oval cells express the hematopoietic stem cell marker Thy-1 in the rat. Hepatology. (1998) 27(2): 433-45. Petersen, B.E., Hepatic "stem" cells: coming full circle. Blood Cells Mol Dis. (2001) 27(3): 590-600. Ponder, K.P., Gupta, S., Leland, F., Darlington, G., Finegold, M.,

DeMayo, J., Ledley, F.D., Roy Chowdhury, J., Woo, S.L.C: "Mouse hepatocytes migrate to liver parenchyma and function indefinitely after intrasplenic transplantation" (1991) Proc Natl. Acad. Sci. U.S.A. 88: 1217-1221. Riccalton-Banks, L., Bhandari, R., Fry, J., and Shakesheff, K.M.: "A simple method for the simultaneous isolation of stellate cells and hepatocytes from rat liver tissue" (2003) Mol. Cell. Biochem. 248: 97-102. Rice, J.W., Davis, J.E., Crowl, R.M. and Johnston P.A.: "Development of a High Volume Screen to Identify Inhibitors of Endothelial Cell Activation" (1996) Anal. Biochem. 241: 254-259. Roskams, T., DeVos, R., VanEyken, P., Miyazaki, H., VanDamme, B.,

Desmet, V.: "Hepatic OV-6 expression in human liver disease and rat experiments: evidence for hepatic progenitor cells in man" (1998) J. Hepatol. 29: 455-463. Schwartz, R.E., Reyes, M., Koodie, L., Jiang, Y., Blackstad, M., Lund, T., Lenvik, T., Johnson, S., Hu, W.-S., Verfaillie, C. M., Multipotent adult progenitor cells from bone marrow differentiate into functional hepatocyte-like cells. J. Clin. Invest. (2002) 109: 1291-1302. Seglen, P.O.: "Preparation of isolated rat liver cells" (1976) Methods Cell Biol. 13: 29-83. Sell, S., Osborn, K., and Leffert, H.L.: "Autoradiography of oval cells appearing rapidly in the livers of rats fed N-2-fluorenylacetamide in a choline- devoid diet" (1981a) Carcinogenesis 2: 7-14. Sell, S., Leffert, H.L., Shinozuka, H., Lombardi, B., and Gochman, N.: "Rapid development of large numbers of AFP-containing "oval" cells in the liver of rats fed N-2-fluorenylacetamide in a choline-devoid diet. (1981b) GANN 72: 479-487. Sell. S., Cellular origin of cancer: dedifferentiation or stem cell maturation arrest? Environ Health Perspect.. (1993) 101(5): 15-26. Sell, S.: "Liver stem cells". (1994) Mod. Pathol. 7(1): 105-12. Shinozuka, H., Lombardi, B., Sell, S., and Iammarino, R.M. (1978). Early histological and functional alterations of ethionine liver carcinogenesis in rats fed a choline-deficient diet. Cancer Res 38, 1092-1098. Shiojiri, N., Lemire, J.M., and Fausto, N.: "Cell lineages and oval cell progenitors in rat liver development". (1991) Cancer Res. 51(10): 2611-20. Slehria, S., Rajvanshi, P., Ito, Y., Sokhi, R., Bhargava, K.K., Palestro, C.J., McCuskey, R.S., and Gupta, S.: "Hepatic sinusoidal vasodilators improve transplanted cell engraftment and ameliorate microcirculatory perturbations in the liver" (2002) Hepatology 35: 1320-1328. Sokhi, R.P., Rajvanshi, P., and Gupta, S.: "Transplanted reporter cells help in defining onset of hepatocyte proliferation during the life of F344 rats" (2000) Am. J. Physiol. Gastrointest. Liver Physiol. 279: 631-640. Suzuki, A., Taniguchi, H., Zheng, Y.W., Takada, Y., Fukunaga, K., Seino, K, Yazawa, K., Otsuka, M., Fukao, K, and Nakauchi, H.: "Clonal colony formation of hepatic stem/progenitor cells enhanced by embryonic fibroblast conditioning medium" (2000) Transplant. Proc. 32: 2328-2330. Suzuki, A., et al., Clonal identification and characterization of self- renewing pluripotent stem cells in the developing liver. J Cell Biol. (2002) 156(1): 173-84. Suzuki, A., et al., Flow-cytometric separation and enrichment of hepatic progenitor cells in the developing mouse liver. Hepatology. (2000) 32(6): 1230- 9. Tatematsu, M., Ho, R.H., Kaku, T., Ekem, J.K., and Farber, E. (1984). Studies on the proliferation and fate of oval cells in the liver of rats treated with 2-acetylaminofluorene and partial hepatectomy. Am J Pathol 114: 418-430. Tateno, C, and Yoshizato, K.: "Growth and differentiation in culture of clonogenic hepatocytes that expres both phenotypes of hepatocytes and biliary epithelial cells" (1996a) Am. J. Pathol. 149: 1593-1605. Tateno, C, and Yoshizato, K.: "Long-term cultivation of adult rat hepatocytes that undergo multiple cell divisions and express normal parenchymal phenotypes." (1996b) Am. J. Pathol. 148: 383-392. Thorgeirsson, S.S.: "Hepatic stem cells in liver regeneration". (1996)

FASEB J. 10(11): 1249-56. Vessey, C.J. and P.M. de la Hall, Hepatic stem cells: a review. Pathology. (2001) 33(2): 130-41. Wang, X., Foster, M., Al-Dhalimy, M., Lagasse, E., Finegold, M., and Grompe, M.: "The origin and liver repopulating capacity of murine oval cells" (2003) Proc. Natl. Acad Sci. U.S.A. 100(1): 11881-11888. Webber, E.M. Godowski, PJ, Fausto, N.: "hi vivo response of hepatocytes to growth factors requires an initial priming stimulus" (1994) Hepatology 19*: 489-497. Webber, E.M., Bruiz, J., Pierce, R.H., Fausto, N.: "Tumor necrosis factor primes hepatocytes for DNA replication in the rat" (1998) Hepatology 28: 1226- 12.

Claims

What is claimed is:

1. An isolated endodermal stem cell comprising gene expression products CD45 and CD34 and not CK19, albumin or OV-6.

2. The endodermal stem cell of claim 1, wherein the stem cell is derived from a mammal.

3. The endodermal stem cell of claim 2, wherein the mammal is a human, mouse or rat.

4. The endodermal stem cell of claim 1, wherein the stem cell can differentiate into a plurality of endodermal cell types.

5. The endodermal stem cell of claim 4, wherein the differentiated endodermal cell types are selected from the group consisting of pancreatic, islet, intestinal, thyroid, lung, colon, bladder and liver cell types.

6. The endodermal stem cell of claim 4, wherein the differentiated endodermal cell is a liver cell.

7. The endodermal stem cell of claim 6, wherein the liver cell is a hepatocyte or a biliary epithelial cell.

8. A pharmaceutical composition comprising an effective amount of the endoderm stem cells of claim 1 or differentiated progeny derived therefrom and a pharmaceutically acceptable carrier.

9. A method of isolating a population of endodermal stem cells of claim 1 , comprising: (a) disassociating an endodermal tissue to form a heterogeneous population of primary endodermal cells; (b) culturing the primary cell population in liquid culture media so that cells exhibiting one or more differentiated phenotypes in the primary cell population are decreased; and (c) isolating the endodermal stem cells from said cultured population.

10. The method of claim 9, wherein the endodermal tissue has not exposed to a toxic agent prior to disassociation.

10. The method of claim 9, wherein the endodermal tissue has not been exposed to concurrent stimulation of growth and inhibition of restoration prior to disassociation.

11. The method of claim 9, wherein the heterogeneous population is obtained from a mammal.

12. The method of claim 11, wherein the mammal is a human, mouse or rat.

13. The method of claim 9, wherein the endodermal tissue is selected from the group consisting of liver, stomach, intestine, pancreas, lung, colon, bladder and thyroid.

14. The method of claim 9, wherein the endodermal tissue is liver.

15. The method of claim 9, wherein the tissue is disassociated in the presence of an enzyme.

16. The method of claim 15, wherein the enzyme is selected from the group consisting of collagenase, trypsin, dispase I, hyaluronidase, thermolysin and pancreatin.

17. The method of claim 15, wherein the enzyme is collagenase.

18. The method of claim 9, wherein the population of endodermal stem cells is enriched by culturing the cells for at least about 7 days.

19. The method of claim 18, wherein the cultunng is earned out for about 7-14 days.

20. The method of claim 18, wherein the culturing is carried out for about 10-14 days.

21. The method of claim 9 further comprising differentiating the stem cells to yield an endodermal cell type.

22 The method of claim 21 , wherein the differentiated endodermal cell type is selected from the group consisting of pancreatic, islet, intestinal, thyroid, lung, colon, bladder and liver cell types.

23. The method of claim 21 , wherein the differentiated endodermal cell type is a liver cell type. i

24. The method of claim 23, wherein the liver cell type is a hepatocyte or a biliary epithelial cell.

25. The method of claim 21, wherein the stem cells are differentiated in the presence of one or more differentiation factors comprising β- cellulin, GLP-1, HGF, KGF, nicotinamide, TGF-α, TGF-β, activin, cyclopamin, BMP inhibitors, FGF, EGF, Oncostatin M, dexamethasone or nicotinamide.

26. A method for providing an endoderm cell type to a subject in need thereof, comprising administering the endoderm stem cells of claim 1 or differentiated progeny derived therefrom in an amount effective to provide an endoderm cell type to the subject.

27. The method of claim 26, wherein the endoderm cell type is selected from the group consisting of pancreatic, islet, intestinal, thyroid, lung, colon, bladder and liver cell types.

28. The method of claim 27, wherein the endodermal cell type is a liver cell type.

29. The method of claim 28, wherein the liver cell type is a hepatocyte or a biliary epithelial cell.

30. The method of claim 26, wherein the endoderm stem cells are differentiated to form hepatocytes prior to administration to the subject.

31. The method of claim 30, wherein the stem cells are differentiated in the presence of one or more differentiation factors to yield hepatocytes.

32. The method of claim 31 , wherein the differentiation factor comprises HGF, FGF, FGF-4, TGFα, TGF/3, EGF, Oncostatin M, dexamethasone, nicotinamide, or a combination thereof.

33. The method of claim 26, wherein the endodermal stem cells or differentiated progeny cells are administered by contacting the cells with a damaged tissue of the subject.

34. The method of claim 26, wherein the endodermal stem cells or differentiated progeny cells are administered by contacting the cells with a healthy tissue of the subject.

35. The method of claim 26, wherein the endodermal stem cells or differentiated progeny cells are administered by systemic or local injection.

36. The endodermal stem cells according to any one of claims 1-8 for use in medical therapy.

37. The use of claim 36, wherein the medical therapy is treating pancreatic, intestinal, thyroid, lung, bladder or liver damage as a result of an injury or disease.

38. The use of the endodermal stem cells according to any one of claims 1-8 to a prepare a medicament for treating pancreatic, intestinal, thyroid, lung, bladder or liver damage as a result of an injury or disease.

39. The use of claim 38, wherein the medicament includes a physiologically acceptable carrier.