CN116590225B

CN116590225B - Application of phosphatidylcholine in preparation of preparation for promoting pig FAPs cell differentiation polyester

Info

Publication number: CN116590225B
Application number: CN202310530141.3A
Authority: CN
Inventors: 单体中; 刘事奇; 汪以真
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2023-05-12
Filing date: 2023-05-12
Publication date: 2023-10-20
Anticipated expiration: 2043-05-12
Also published as: CN116590225A

Abstract

The invention discloses application of phosphatidylcholine in preparation of a preparation for promoting pig FAPs cell differentiation polyester, belonging to the fields of agriculture and food science. The preparation phosphatidylcholine capable of effectively promoting the cell differentiation and polyester of the pig FAPs is obtained by screening various lipid factors and plant active ingredients, and the action concentration of the phosphatidylcholine for promoting the cell differentiation and polyester of the pig FAPs is determined; meanwhile, the effect of the strain is further verified under the 3D culture condition, and a new strategy can be provided for efficient production of high-quality cell culture meat and deposition regulation of animal intramuscular fat.

Description

Application of phosphatidylcholine in preparation of preparation for promoting pig FAPs cell differentiation polyester

Technical Field

The invention belongs to the field of agriculture and food science, and particularly relates to application of phosphatidylcholine in preparation of a polyester preparation for promoting cell differentiation of pig FAPs.

Background

Fat deposition in skeletal muscle, especially intramuscular fat (Intramuscular Fat, IMF) deposition, is closely related to the meat quality formation of livestock and poultry, and the content of the fat deposition is closely related to the organoleptic and edible quality of pork, so that a plurality of indexes such as the flavor, juiciness, tenderness, color and the like of the pork are directly determined. In recent years, related research on the deposition mechanism of IMF and the regulation thereof has been greatly advanced at home and abroad, but the cell source of IMF and the targeting regulation strategy thereof need to be further researched. IMF cells were found to differentiate from a variety of stem and progenitor cells, including, for example, side group cells (Side population cells, SP cells), pericytes (Pericytes), multipotent mesenchymal stem cells (Mesenchymal stem cells, MSCs), myosatellite cells (Muscle satellite cells muscle, SCs), fibroadipogenic progenitor cells (fibrio/adipogenic progenitors, FAPs), and the like, wherein FAPs specifically express pdgfrα and Sca-1, are the primary sources of cells in human and mouse muscle regeneration. FAPs are capable of directional differentiation in the adipogenic and fibrogenic directions, leading to fat deposition and fibrosis in the muscle. Therefore, how to regulate the differentiation potential of FAPs is of great importance for maintaining muscle growth and homeostasis and regulating intramuscular fat deposition.

At present, research on FAPs differentiation regulation is mainly focused on human and mice, and although porcine FAPs cells are annotated by recent porcine muscle single cell sequencing papers, papers such as FAPs in vitro culture and differentiation regulation are not reported.

At present, the related research of the FAPs of pigs is in a starting stage, and a method for targeted regulation and control of the differentiated polyester and intramuscular fat deposition of the FAPs is lacking; seed cells produced by meat cultures are currently mainly used as muscle satellite cells, whereas the nutritional components of single cell-derived meat cultures are also greatly different from normal muscle tissue, mainly because muscle tissue contains a variety of cells.

Disclosure of Invention

According to the invention, the pig FAPs cells are separated by using an immunomagnetic bead separation technology, an in-vitro 2D/3D culture system and a fat-forming induction method of the FAPs cells are initially established, but a method for regulating fat-forming differentiation of the FAPs cells in a targeted manner through a nutrition strategy so as to regulate intramuscular fat deposition and improve pork quality is still lacking. The preparation which can effectively promote the differentiation of the FAPs cells of the pigs to polyester is obtained by screening various lipid factors and plant active ingredients.

The invention provides application of phosphatidylcholine in preparation of a preparation for promoting pig FAPs cell differentiation polyester.

Preferably, phosphatidylcholine alone is the active ingredient in the formulation.

More optionally, the preparation further comprises auxiliary materials.

The invention also provides a preparation method of the cell culture meat, which comprises the following steps:

(1) Preparation of sodium alginate/gelatin 3D gel ball

Sodium alginate-gelatin solution (sodium alginate/gelatin mixed sol) with concentration of 2% was obtained by dissolving 0.5 g sodium alginate and 0.5 g gelatin in 50mL distilled water. 1g of calcium chloride was dissolved in 50mL distilled water to obtain a calcium chloride solution having a concentration of 2%. Dropwise adding the sodium alginate/gelatin solution into the calcium chloride solution, and crosslinking for 5-15 min to obtain sodium alginate/gelatin 3D gel balls;

(2) Inoculating FAPs cells on sodium alginate and sodium alginate/gelatin 3D bracket

Adding a calcium chloride solution into a cell culture plate, and mixing a pig FAPs cell suspension with sodium alginate/gelatin mixed sol according to a volume ratio of 1: 1-3, dropwise adding the mixture into a calcium chloride solution, and crosslinking for 5-15 min to form gel balls; discarding the residual calcium chloride solution, supplementing the growth medium, and adding 5% CO at 37deg.C ₂ Culturing in environment, performing adipogenic differentiation culture, and adding 1-100 μm PC during the adipogenic differentiation culture to obtain cell culture meat.

Preferably, in the step (1), sodium alginate solution, gelatin solution and calcium chloride solution are heated at 98 ℃ for 3 h respectively, ultraviolet irradiation is performed for 3 h sterilization, and the calcium chloride solution is filtered through a 0.22 μm filter membrane.

More preferably, the cells of porcine FAPs in step (2) are at 37℃with 5% CO ₂ Culturing in an incubator until the cell confluence rate reaches 75-85%, and obtaining the cell suspension of the pig FAPs through trypsin digestion and centrifugation.

More preferably, the concentration of the cell suspension of porcine FAPs in step (2) is 1.5X10 ⁵ cell/ml。

More preferably, the crosslinking time in the step (2) is 10min.

Compared with the prior art, the invention has the following beneficial effects:

the phosphatidylcholine can obviously promote the FAPs cells of pigs to differentiate and polyester, thereby improving the intramuscular fat content.

Drawings

FIG. 1 is a graph showing the effect of different trophic factors on the differentiation of polyester from porcine FAPs in example 1.

FIG. 2 is a graph showing the effect of PC on the differentiation of polyester from porcine FAPs (Nile red staining) in example 2.

FIG. 3 is a graph showing the effect of PC on expression of fatty acid synthesis-related genes of FAPs in swine in example 2.

FIG. 4 is a graph showing the effect of PC on expression of fatty acid synthesis-related proteins of FAPs in pigs in example 2.

FIG. 5 is a graph showing the effect of PC on polyester differentiation (Nile red staining) of swine FAPs under 3D culture conditions in example 3.

Detailed Description

Example 1 nutritional factor screening to promote the differentiation of porcine FAPs cells into polyester

1. Pig FAPs cell culture

Culture medium for subculture: dmem+15% fbs+1% diabody; changing the liquid once in two days, and washing twice with FBS before changing the liquid; and (5) passaging when the cell fusion rate reaches 85%.

And (3) passage: the medium was discarded, 2mL of PBS was added to wash the cells, PBS was discarded, 1.5. 1.5 mL pancreatin was added, digested for 3 min at 37 ℃,1 mL complete medium was added, after mixing, transferred to a centrifuge tube of 5mL, centrifuged at 1000 rpm for 4 min, after centrifugation the supernatant was discarded, resuspended in complete medium and inoculated into a culture plate for further culture.

2. Setting concentration gradient of nutrient factors

Each trophic factor was set to 4 concentration gradients: phosphatidylcholine (PC) is divided into 0, 1 μm, 10 μm, 100 μm; betaines (Bet) are classified as 0, 0.1 mM, 0.2 mM, 0.4 mM; epigallocatechin gallate (EGCG) is divided into 0, 0.2 μM, 2 μM, and 20 μM; phosphatidylserine (PS) is classified into 0, 1 μm, 10 μm, 100 μm; ornithine (Orithine) is classified into 0, 0.1, mM, 0.2, mM and 0.4, mM.

3. Pig FAPs cell adipogenesis induction

The above 5 trophic factors were added throughout the adipogenic differentiation (including MDI medium and INS medium), with 3 replicates per treatment setting.

When the fusion rate of the cells of the FAPs of the pigs is 85%, inoculating the cells to a 12-hole plate for culture, when the fusion rate of the cells is 85% -90%, replacing the cells with a lipid-forming induction culture medium MDI medium for inducing the FAPs to be lipid-forming and differentiating for 4 days, replacing a differentiation culture medium INS medium, and continuously culturing for 2 days.

MDI media contains IBMX 500. Mu.M, insulin 10. Mu.g/mL, rosiglitazone 2. Mu.g/mL and dexamethasone 1. Mu.M; INS medium contained 10. Mu.g/mL insulin.

4. Observation of the condition of differentiated polyester of FAPs in pigs

After the induction differentiation of the swine FAPs cells was completed, the medium was discarded, washed 2 times with 0.5mL of PBS, then fixed with 0.5mL of 4% paraformaldehyde for 15 min, then 4% paraformaldehyde was discarded, and washed 2 times with 0.5mL of PBS.

Lipid droplet size was observed in the microscope for each treatment group and compared by photographing.

The result shows that the addition of 100 mu M PC significantly promotes the differentiation of the FAPs cells of the pigs into polyester, and the fat drop becomes large; the addition of 0.2 mM Bet also has the effect of promoting the differentiation of swine FAPs cells into polyester, but has an effect less obvious than that of 100 mu M PC; the other 3 trophic factors had no effect on the cellular differentiation of porcine FAPs to polyester (fig. 1).

Example 2 validation and evaluation of the effects of trophic factors in 2D culture systems

1. Nile red (Nile red) dyeing

When the fusion rate of the cells of the FAPs of the pigs is 85%, inoculating the cells to a 12-hole plate for culture, when the fusion rate of the cells is 85% -90%, replacing the cells with a lipid-forming induction culture medium MDI medium for inducing the FAPs to be lipid-forming and differentiating for 4 days, replacing a differentiation culture medium INS medium, and continuously culturing for 2 days. The whole process of adipogenic differentiation was added with 0. Mu.M and 100. Mu.M PC, respectively.

After the induction differentiation of the swine FAPs cells was completed, the medium was discarded, washed 2 times with 0.5mL of PBS, then fixed with 0.5mL of 4% paraformaldehyde for 15 min, then 4% paraformaldehyde was discarded, and washed 2 times with 0.5mL of PBS. The samples were taken with PBS at 1:2000 dilute nile red fluorescent dye, add 300 μl of dye per well, incubate for 15 min in dark, discard dye, wash 3 times with PBS for 5 min each; the samples were taken with PBS at 1: DAPI dye (labeled nuclei) was diluted 5000, 300. Mu.L of dye was added to each well, incubated for 5 min in the dark, the dye was discarded, washed 3 times with PBS, followed by 50% glycerol sealed plate, and observed under a fluorescent microscope, photographed.

The results showed that 100. Mu.M PC group had more lipid droplets, suggesting that the addition of 100. Mu.M PC promoted the cellular differentiation of porcine FAPs to polyester (FIG. 2).

2. Gene expression detection related to fatty acid synthesis

To further explore how 100. Mu.M PC promotes the differentiation of swine FAPs cells into polyester, we examined the expression of genes involved in fat/fatty acid synthesis. When the fusion rate of the pig FAPs cells is 85%, inoculating the pig FAPs cells to a 12-hole plate for culture, collecting the pig FAPs cells after the adipogenic differentiation is finished, adding 0.5mL TRIzol reagent into each hole after PBS washing for 2 times, extracting cell RNA, and detecting the quality and concentration of the RNA by using a NanoDrop 2000 instrument. cDNA was synthesized using a reverse transcription kit (Thermo Fisher). Real-time quantitative PCR was performed using a Applied Biosystems StepOnePlusTM real-time PCR system and SYBR Green Master Mix (Roche, indianapolis, in, united States). The relative expression level of the gene was calculated by the 2- ΔΔct method.

The real-time fluorescent quantitative PCR results showed that 100. Mu.M PC significantly increased the expression of Pparg, plin1, fabp4, adipoq and Cidec (FIG. 3).

The primer sequences were as follows:

18S-F（SEQ ID NO.1）：CCCACGGAATCGAGAAAGAG

18S-R（SEQ ID NO.2）：TTGACGGAAGGGCACCA

Pparγ-F（SEQ ID NO.3）：GGCGAGGGCGATCTTGACAG

Pparγ-R（SEQ ID NO.4）：GATGCGAATGGCCACCTCTTT

Perilipin1-F（SEQ ID NO.5）：CCCCCTGGTGGCGTCTGTAT

Perilipin1-R（SEQ ID NO.6）：ACTGGAGGGCCGGTATCTTTTCT

Fabp4-F（SEQ ID NO.7）：TGGAAACTTGTCTCCAGTG

Fabp4-R（SEQ ID NO.8）：GGTACTTTCTGATCTAATGGTG

Adipoq-F（SEQ ID NO.9）：CTCCTTCCACGTCACGGTCT

Adipoq-R（SEQ ID NO.10）：CCAGATAGAGGAGCACAGAGCC

Leptin-F（SEQ ID NO.11）：GGCCCTATCTGTCCTACGTTGAAG

Leptin-R（SEQ ID NO.12）：TGGAAGGCAGACTGGTGAGGAT

Cidea-F（SEQ ID NO.13）：TTATCGCCAGCAGAGTGGTC

Cidea-R（SEQ ID NO.14）：GATGTAGGTACCAGCCGGTGT

Cidec-F（SEQ ID NO.15）：ACAGAGAAACATGGAGCCCAA

Cidec-R（SEQ ID NO.16）：GTCAGCGGTGCTTACTTTGC。

3. fat/fatty acid synthesis-related protein expression assay

Collecting pig FAPs cells after lipid differentiation, washing with PBS for 2 times, adding protease inhibitor-containing protein lysis buffer, homogenizing or ultrasonic crushing, centrifuging at 12000 rpm for 10min on ice for 30 min at 4deg.C, and transferring the supernatant to a new 1.5 mL EP tube. After the BCA method was used to determine the protein concentration, 5X sample buffer was added and the mixture was boiled at 100 ℃ for 10min to denature the protein. 10% polyacrylamide gel is prepared, protein electrophoresis is carried out, 90V is carried out for 30 min, and 130V is carried out for 1 h. The protein bands were analyzed by gel imaging analysis system through the procedures of membrane transfer, 1h of blocking, overnight incubation with primary antibody, TBST elution, incubation with secondary antibody at room temperature, and the like.

Western blot detection results show that 100 mu M PC significantly improves PLIN1 and FABP4 protein expression compared with a control group (FIG. 4).

Example 3 application to meat development in 3D culture or cell culture

1. Preparation of sodium alginate/gelatin 3D gel ball

Sodium alginate-gelatin solution (sodium alginate/gelatin mixed sol) with concentration of 2% was obtained by dissolving 0.5 g sodium alginate and 0.5 g gelatin in 50mL distilled water. 1g of calcium chloride was dissolved in 50mL distilled water to obtain a calcium chloride solution having a concentration of 2%. Heating sodium alginate-gelatin solution and calcium chloride solution at 98deg.C for 3 h respectively, sterilizing by ultraviolet irradiation of 3 h, and filtering with 0.22 μm filter membrane to ensure sterility.

2. Inoculating FAPs cells on sodium alginate and sodium alginate/gelatin 3D bracket

Pig FAPs cells at 37℃and 5% CO ₂ Cell suspension was obtained by trypsin digestion and centrifugation when cultured in an incubator until cell confluence reached about 80%. 2mL of sterile chlorination was added to each well of a 12-well cell culture plateCalcium solution, cell suspension (1.5X10) ⁵ cell/ml) and sodium alginate/gelatin mixed sol according to the volume ratio of 1:2, uniformly mixing, dropwise adding the mixture into a calcium chloride solution by using a 1 mL pipette, and crosslinking for 10 minutes to form gel balls. Discard the remaining calcium chloride solution, wash twice with PBS, supplement growth medium (DMEM medium with 15% FBS), at 37℃with 5% CO ₂ Culturing in an incubator for 48 hours. Then, the culture was carried out for 8 days and 6 days with MDI medium and INS medium (100. Mu.M PC in both media), respectively, and adipogenic differentiation culture was carried out. The adipogenic induction, the harvest and the nile red staining of the cells of the pig FAPs are consistent with those of the cells of the pig FAPs in 2D culture.

The nile red staining results showed: the addition of 100. Mu.M PC significantly more lipid droplets compared to the control without PC indicated that the addition of 100. Mu.M PC promoted the cell differentiation polyester of swine FAPs and increased the production efficiency of cell culture meat (FIG. 5).

The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Claims

1. The application of phosphatidylcholine in preparing a preparation for promoting the cell differentiation polyester of the pig FAPs.

2. The use according to claim 1, wherein phosphatidylcholine alone is the active ingredient in the formulation.

3. The use according to claim 2, wherein the formulation further comprises excipients.

4. A method for preparing cell culture meat, comprising the steps of:

(1) Preparation of sodium alginate/gelatin 3D gel ball

Dissolving 0.5 g sodium alginate and 0.5 g gelatin in 50mL of distilled water to obtain sodium alginate/gelatin mixed sol with the concentration of 2%, dissolving 1g of calcium chloride in 50mL distilled water to obtain calcium chloride solution with the concentration of 2%, dropwise adding the sodium alginate/gelatin mixed sol into the calcium chloride solution, and crosslinking for 5-15 min to obtain sodium alginate/gelatin 3D gel spheres;

Adding a calcium chloride solution into a cell culture plate, and mixing a pig FAPs cell suspension with sodium alginate/gelatin mixed sol according to a volume ratio of 1: 1-3, dropwise adding the mixture into a calcium chloride solution, and crosslinking for 5-15 min to form gel balls; discarding the residual calcium chloride solution, supplementing the growth medium, and adding 5% CO at 37deg.C ₂ Culturing in environment, performing adipogenic differentiation culture, and adding 1-100 μm phosphatidylcholine during the adipogenic differentiation culture to obtain cell culture meat.

5. The method according to claim 4, wherein the step (1) further comprises heating the sodium alginate solution-gelatin solution and the calcium chloride solution at 98℃for 3 h, respectively, sterilizing the solution by ultraviolet irradiation for 3 h, and filtering the calcium chloride solution through a 0.22 μm filter.

6. The method of claim 5, wherein the cells of swine FAPs in step (2) are at 37℃and 5% CO ₂ Culturing in an incubator until the cell confluence rate reaches 75-85%, and obtaining the cell suspension of the pig FAPs through trypsin digestion and centrifugation.

7. The method of claim 6, wherein the concentration of the cell suspension of swine FAPs in step (2) is 1.5X10 ⁵ cell/ml。

8. The method according to claim 7, wherein the crosslinking time in the step (2) is 10min.