CN113106059A

CN113106059A - High-migration mesenchymal stem cell and preparation method and application thereof

Info

Publication number: CN113106059A
Application number: CN202110370692.9A
Authority: CN
Inventors: 吴耀炯; 莫妙华
Original assignee: Shenzhen International Graduate School of Tsinghua University
Current assignee: Shenzhen International Graduate School of Tsinghua University
Priority date: 2021-04-07
Filing date: 2021-04-07
Publication date: 2021-07-13
Anticipated expiration: 2041-04-07
Also published as: WO2022213704A1; CN113106059B

Abstract

The invention provides a high-migration mesenchymal stem cell and a preparation method and application thereof. The preparation method of the high migration mesenchymal stem cell comprises the following steps: inoculating and suspending the mesenchymal stem cells into a mesenchymal stem cell culture solution, carrying out flowing liquid culture in a cell culture rotary bottle or a stirring type fermentation tank, collecting cell balls after the culture is finished, washing and digesting to form single cells, and thus obtaining the high-migration mesenchymal stem cells. The high migration mesenchymal stem cells prepared by the method have small volume, the average diameter is 11-14 μm, the expression rate of CXCR4 on the cell surface is up to more than 30%, the cell migration capability is strong, the pulmonary retention phenomenon is basically not generated by intravenous injection, and the number of the cells reaching ischemic myocardium is obviously increased.

Description

High-migration mesenchymal stem cell and preparation method and application thereof

Technical Field

The invention belongs to the technical field of stem cells, and particularly relates to a high-migration mesenchymal stem cell and a preparation method and application thereof.

Background

Mesenchymal Stem Cells (MSCs) are adult stem cells with a multidirectional differentiation ability, can differentiate to form various tissue cells, participate in constituting a tissue regeneration microenvironment by secreting a large amount of growth and immunoregulatory factors, and promote tissue injury repair. Mesenchymal stem cells are widely present in various tissues of the body, but their number decreases significantly with age. A large number of studies prove that the supplement of the mesenchymal stem cells can promote the regeneration and repair of various tissues.

The mesenchymal stem cells have wide sources and can be separated from tissues such as placenta, umbilical cord, bone marrow and the like. Because the mesenchymal stem cells have special low immunogenicity, allogeneic mesenchymal stem cell transplantation does not cause immunological rejection, tissue matching is not needed, and the mesenchymal stem cells are particularly suitable for tissue injury repair (such as treatment of brain, cardiac infarction and the like) and treatment of various degenerative diseases (such as diabetes, Parkinson's disease and the like), and intravenous injection is a main mesenchymal stem cell transplantation way.

The mesenchymal stem cells obtained from the tissues have small quantity, and can meet the clinical treatment requirement after in vitro amplification culture. At present, a two-dimensional (2D) adherent culture method is generally adopted for mesenchymal stem cells, and microcarrier co-culture is usually required to be added in the culture process based on a bioreactor, for example: GE microcarriers (Cytopore, Cytodex, Cytoline), gelatin microcarriers etc., to which cells are attached, are essentially 2D cultures. During the 2D culture process, cells are subjected to epigenetic change while proliferating, so that the expression of a plurality of genes is abnormal, the expression is expressed as the increase of the cell volume, the expression of surface migration related molecules is abnormal, for example, the expression of CXCR4(C-X-C Motif Chemokine Receptor4) is obviously reduced, more than 90 percent of the cells are blocked in pulmonary capillaries after intravenous injection, and most of the cells die due to ischemia within 24 hours and are difficult to reach extrapulmonary damaged tissues. There are also three-dimensional (3D) hanging drop cultures, for example: WO2009134532a2 discloses a hanging drop culture method, which is a static culture method although capable of forming cell aggregates, and the expression level and the targeted migration capability to ischemic tissues of the obtained mesenchymal stem cells CXCR4 are still insufficient.

Disclosure of Invention

Based on the defects in the prior art, the first purpose of the invention is to provide a preparation method of high migration mesenchymal stem cells; the second purpose of the invention is to provide the highly migrated mesenchymal stem cell prepared by the preparation method; the third purpose of the invention is to provide the application of the high migration mesenchymal stem cells in preparing medicines for treating tissue injury repair, degenerative diseases, immune rejection after organ transplantation, organ function decline, organ and tissue ischemia and inflammation.

The purpose of the invention is realized by the following technical means:

in one aspect, the invention provides a preparation method of high migration mesenchymal stem cells, which comprises the following steps:

inoculating and suspending the mesenchymal stem cells into a mesenchymal stem cell culture solution, carrying out flowing liquid culture in a cell culture rotary bottle or a stirring type fermentation tank, collecting cell balls after the culture is finished, washing and digesting to form single cells, and thus obtaining the high-migration mesenchymal stem cells.

The inventor creatively adopts a culture method based on three-dimensional (3D) dynamic cells, the method inoculates and suspends the mesenchymal stem cells in a mesenchymal stem cell culture solution, and performs flowing liquid culture in a cell culture rotary bottle (with a stirring device) or a stirring type fermentation tank, and no microcarrier is needed to be added in the culture process, so that the volume of the mesenchymal stem cells can be reduced, and the mobility of the mesenchymal stem cells in blood circulation and the migration capability of the mesenchymal stem cells to damaged tissues can be improved; in addition, the inventor creatively discovers in experiments that the cells flow with the liquid and gradually form cell aggregates (cell spheres), the shearing force generated by the liquid flow caused by stirring can further remarkably increase the migration capacity of the mesenchymal stem cells and remarkably increase the expression level of a mesenchymal stem cell surface migration related receptor CXCR 4; the dual role of shear forces in cell aggregation and formation of flowing liquid promotes the expression and targeted migration of mesenchymal stem cell CXCR4 to ischemic tissues.

In the above preparation method, preferably, the mesenchymal stem cell is seeded at a density of (0.5 to 10) × 10⁵Individual cells/mL.

In the above preparation method, preferably, the mesenchymal stem cell culture solution comprises a low glucose DMEM culture solution containing 1-20% (V/V) fetal bovine serum or 0.5-10% (V/V) human platelet lysate or serum substitute (e.g., PALL ultraser G). The low glucose DMEM medium may be a commercial low glucose DMEM medium (e.g., from Thermo Fisher Scientific). The mesenchymal stem cell culture solution can also adopt other conventional cell basic culture solutions.

In the above preparation method, preferably, the mesenchymal stem cell culture solution further comprises 0.1% to 5% (W/V, final concentration) of human serum albumin, 1 to 100nmol/L (final concentration) of trichostatin a, 1 to 50 μ g/mL (W/V, final concentration) of human fibronectin, and 1 to 40ng/mL (W/V, final concentration) of bFGF (basic fibroblast growth factor). The mesenchymal stem cell culture solution added with human serum albumin, trichostatin A, human fibronectin and bFGF can ensure the balling and survival of cells in a suspension flowing system.

In the above production method, the conditions for conducting the fluid culture in the cell culture spinner flask or the agitation fermenter are preferably as follows: 37 ℃ and 5% CO₂Under the condition, the stirring speed is 5-200 rpm, and the culture time is 5-200 h.

In the above-mentioned production method, the method of collecting the cell pellet after completion of the culture preferably includes a centrifugation method, a filtration method or a natural sedimentation method.

In the above preparation method, preferably, the step of washing and digesting to form single cells comprises: the collected cell pellet was washed with phosphate buffer and then digested with trypsin to form single cells.

In the above preparation method, preferably, the phosphate buffer is a phosphate buffer free of calcium and magnesium ions.

In the above-mentioned production method, preferably, the trypsin is an EDTA-containing trypsin.

On the other hand, the invention also provides a high-migration mesenchymal stem cell which is prepared by the preparation method.

The average diameter of the high migration mesenchymal stem cells is 11-14 mu m, and the expression rate of receptor CXCR4 for expressing cell migration on the surface is more than 30%.

On the other hand, the invention also provides application of the high migration mesenchymal stem cells in preparing medicines for treating diseases such as tissue injury repair, degenerative diseases, immune rejection after organ transplantation, organ function decline, organ and tissue ischemia, inflammation and the like.

In the above application, preferably, the tissue damage includes tissue damage caused by cerebral infarction or myocardial infarction, and the like; the degenerative diseases comprise diabetes, Parkinson's disease, senile dementia or degenerative joint diseases and the like; the immune diseases comprise systemic lupus erythematosus, psoriasis or rheumatoid arthritis and the like; the post-organ transplant immune rejection comprises host-to-graft rejection or graft-to-host rejection; the organ failure comprises ovarian or gonadal failure; the ischemia of organs and tissues comprises heart, brain or lower limb ischemia and the like; the inflammation includes inflammatory reaction after mechanical injury or chemical injury, immune inflammation or chemical stimulation inflammation and the like.

The high migration mesenchymal stem cells of the invention basically do not generate the pulmonary retention phenomenon after intravenous injection and do not block the pulmonary blood vessels.

The invention has the beneficial effects that:

(1) the high-migration mesenchymal stem cells prepared by the method have small volume, the diameter is generally below 15 mu m, the size is uniform, and the average diameter is 11-14 mu m.

(2) The cell surface of the high migration mesenchymal stem cell prepared by the invention can express a high level of cell migration related receptor CXCR4, and the expression rate is up to more than 30%.

(3) The high-migration mesenchymal stem cells prepared by the method have strong cell migration capability, and compared with the mesenchymal stem cells obtained by ordinary two-dimensional adherent culture, ordinary three-dimensional hanging drop culture and the like, the high-migration mesenchymal stem cells obtained by the three-dimensional carrier-free dynamic culture have obviously enhanced migration capability.

(4) After intravenous injection, the high-migration mesenchymal stem cells prepared by the method greatly reduce the retention of the lung and basically do not generate the retention of the lung.

(5) The high-migration mesenchymal stem cells prepared by the method have strong targeted migration capability to ischemic tissues, and the number of the high-migration mesenchymal stem cells reaching ischemic cardiac muscle after intravenous injection is obviously increased.

Drawings

FIG. 1 is a comparison graph of the expression level of CXCR4 measured by flow cytometry on the surface of human placental mesenchymal stem cells of adherent culture primary (P0) and 5 th generation (P5) in comparative example 1 of the present invention.

FIG. 2 is a comparison graph of Real-Time PCR measurements of the mRNA expression levels of CXCR4 in 5 th generation human placental mesenchymal stem cells from adherent culture (2D MSC) of comparative example 1, hanging drop culture (3D MSC-H) of comparative example 2, and spinner flask culture (3D MSC-S) of example 1 in accordance with the present invention.

Fig. 3 is a graph comparing cell surface expression levels of CXCR4 of 5 th generation human placental mesenchymal stem cells of comparative example 1 adherent culture (2D MSC), comparative example 2 hanging drop culture (3D MSC-H) and example 1 spinner flask culture (3D MSC-S) of the present invention analyzed by flow cytometry.

FIG. 4 is a Transwell chamber graph for measuring the migration ability of mesenchymal stem cells cultured in adherent culture (2D) of comparative example 1, in hanging drop culture (3D-H) of comparative example 2, in spinner flask culture (3D-S) of example 1 and in spinner flask culture (3D-S-B) after the function of CXCR4 was blocked (A in the graph is a comparison graph of the number of cells showing migration after DAPI staining; B in the graph is a comparison graph of the number of counted multi-visual field average cells).

FIG. 5 is a graph of imaging and detecting lung retention 24H after mice are injected intravenously with mesenchymal stem cells of comparative example 1 adherent culture (2D MSC), comparative example 2 hanging drop culture (3DMSC-H) and inventive example 1 spinner flask culture (3D MSC-S) in small animals.

FIG. 6 is a graph comparing the number of mesenchymal stem cells reaching ischemic myocardium after intravenous injection for the same number of comparative example 1 adherent culture (2D MSC), comparative example 2 hanging drop culture (3D MSC-H), and inventive example 1 spinner flask culture (3D MSC-S).

Detailed Description

The technical solutions of the present invention will be described in detail below in order to clearly understand the technical features, objects, and advantages of the present invention, but the present invention is not limited to the practical scope of the present invention. The raw materials of the reagents used in the following examples were all commercially available and commonly used unless otherwise specified.

Example 1:

the embodiment provides a preparation method of high migration mesenchymal stem cells, which specifically comprises the following steps:

(1) adopting a cell culture rotary bottle rotary culture method to culture the human placenta-derived mesenchymal stem cells according to the ratio of 3 multiplied by 10⁵The inoculation density of each cell/mL is suspended in the mesenchymal stem cell culture solution, and the culture solution is placed in a cell rotary bottle at 37 ℃ and 5% CO₂And stirring under the condition to realize flowing liquid culture, wherein the stirring speed is 60rpm, the culture solution is in a flowing state in a culture device, continuously culturing for 60h, and during the culture period, the mesenchymal stem cells are aggregated to form cell balls with uniform size, and the diameter of the cell balls is about 200 mu m. Collecting cell balls in a centrifugal mode after the culture is finished;

wherein the mesenchymal stem cell culture fluid is 5% human Platelet Lysate (PLUS)^TMHuman patelet Lysate) low glucose DMEM (Dulbecco's Modified Eagle Medium); the culture solution also comprises the following additives: 1% human serum albumin, 6.25nmol/L of Trichostatin A (TSA), 5. mu.g/mL human fibronectin (fibronectin) and 5ng/mL bFGF (basic fibroblast growth factor).

Wherein, the human placenta-derived mesenchymal stem cells are mesenchymal stem cell single cell suspension which is obtained by conventional 2D adherent culture for 5 generations and is digested.

(2) Putting the collected mesenchymal stem cell balls into a 15mL centrifuge tube, and adding 5mL of DPBS (phosphate buffer solution without calcium and magnesium ions) for washing once; then adding a proper amount of 0.25% trypsin liquid (containing 0.02% of EDTA) for digesting for about 3min until cell balls become loose, and gently blowing and beating the cells to disperse the cells into single cell suspension; and then adding an isovolumetric DMEM culture medium containing 10% fetal calf serum to stop the trypsin action, 1300r/min, centrifuging for 5min, removing the supernatant, and finally adding a phosphate buffer containing 1% Bovine Serum Albumin (BSA) to re-suspend the cells to form a single cell suspension to obtain the high migration mesenchymal stem cell suspension.

1. RNA extraction and real-time quantitative PCR measurement of CXCR4 gene expression levels:

(1) directly using the cultured cell pellet, removing cell culture solution from the collected cell pellet, washing with phosphate buffer solution once, and adding 1.0mL

The cells were pipetted evenly and transferred to a 1.5mL tube for lysis.

(2) Washed again with PBS and 1.0mL

The pellet was blown evenly until the pellet was completely digested, transferred to a 1.5mL tube, and the cells were lysed thoroughly.

(3) Adding 0.2mL of chloroform, mixing uniformly, centrifuging at room temperature for 15min, and layering in a centrifuge tube: RNA is located in the upper aqueous phase, and the denatured protein is located in the lower organic phase or between the two layers;

(4) transferring the supernatant into a new 1.5mL tube, adding isopropanol with the same volume to precipitate nucleic acid, mixing uniformly, standing at 4 ℃ for 30min, and centrifuging for 15 min; the supernatant was discarded, the precipitate was washed with 75% ethanol, and after the precipitate was dried in the air, 20. mu.L of DNase/RNase-free water was added to dissolve it.

(5) After the RNA concentration was measured by Nanodrop, the reaction was performedAnd (4) transcribing. Taking 1. mu.g of RNA as a template, and using a reverse transcription kit PrimeScript according to the instruction of reagent use^TMThe RT reagent Kit with gDNA Eraser (TaKaRa) further removes residual genome DNA, obtains high-purity RNA for reverse transcription, and obtains cDNA for real-time quantitative PCR reaction.

(6) Performing fluorescent quantitative PCR reaction by using a TaKaRa SYBR premix Ex Taq kit, wherein the real-time fluorescent PCR amplification program comprises the following steps: 95 ℃ for 45 seconds; 95 ℃ for 5 seconds; 60 ℃ for 31 seconds; the 45 cycles were repeated, three replicates for each experimental sample at the same time. And (3) according to the Ct value fed back by the instrument, applying a 2-delta Ct method and taking Gapdh as an internal reference to quantify the expression quantity of the CXCR4 gene in the sample.

The primers used were:

CXCR4-F：ATCCCTGCCCTCCTGCTGACTATTC(SEQ ID NO:1)；

CXCR4-R：GAGGGCCTTGCGCTTCTGGTG(SEQ ID NO:2)；

Gapdh-F：CGTGGAAGGACTCATGACCA(SEQ ID NO:3)；

Gapdh-R：TCCAGGGGTCTTACTCCTTG(SEQ ID NO:4)。

2. flow cytometry measurement of cell surface CXCR4 expression levels:

(1) taking 100 mu L of high migration mesenchymal stem cell suspension, respectively placing the suspension into 3 EP tubes, wherein one tube is a blank control, the second tube is an isotype control (isotype IgG labeled by PE), the third tube is an antibody (anti-CXCR 4 flow antibody labeled by PE), incubating on ice for 30min, and keeping out of the sun.

(2) 1mL of phosphate buffer was added to each EP tube, the mixture was centrifuged at 1300rpm for 5min, the supernatant was discarded, the cells were resuspended in 0.5mL of phosphate buffer containing 1% bovine serum albumin, the expression of CXCR4 in the sample was measured by BD flow cytometer, and the measurement results were analyzed by BD Csampler software, whereby the expression of CXCR4 in isotype control cells was set to 0.5% or less.

Comparative example 1:

the comparative example provides 2D adherent culture of human placental mesenchymal stem cells of different generations, comprising the following specific steps:

(1) human placenta-derived mesenchymal stem cells in the form of oligo-glucose containing 10% fetal bovine serum or 5% human platelet lysateSubculturing 2D adherent in glucose DMEM at 37 deg.C under 5% CO₂When the cell fusion degree (confluence) reaches 80% -90%, the ratio of 1: 3 or 1: 4, subculturing and continuously culturing for 5 generations.

(2) After removing the cell culture solution from the 5 th generation of cells, washing one part of the cells by using phosphoric acid buffer solution, cracking the cells in a culture dish, collecting the cracking solution for extracting RNA, and performing real-time quantitative PCR analysis on gene expression; after another portion of the cells were digested with trypsin (containing EDTA), the cells were resuspended in phosphate buffer containing 1% bovine serum albumin to form a single cell suspension of mesenchymal stem cells (starting human placenta-derived mesenchymal stem cells used in the spinner flask culture of example 1 above and the hanging drop culture of comparative example 2 below).

After passage of 2D adherent culture using mesenchymal stem cells, the expression level of CXCR4 on the cell surface was reduced from 35% in primary (P0) to less than 1% in passage 5 (P5) using flow cytometry (the same procedure as described in example 1 above) (see fig. 1).

Comparative example 2:

the comparative example provides a method for obtaining mesenchymal stem cells by 3D hanging drop culture, which comprises the following specific steps:

(1) the concentration of human placenta-derived mesenchymal stem cells was adjusted to 0.6X 10 by using a mesenchymal stem cell culture solution (low glucose DMEM containing 5% human platelet lysate)⁶Individual cells/mL.

(2) Adding cell suspension into the upper cover of a 10cm culture dish with a volume of 35 μ L per drop, controlling the number of hanging drops in each plate to be about 40 drops, carefully inverting the culture cover, placing in an incubator at 37 deg.C and 5% CO₂Culturing for 36h under the condition, collecting cell balls, placing in non-adherent culture dish, and culturing at 37 deg.C with 5% CO₂The culture is continued for 60h under the condition.

(3) The cell pellet was collected, RNA was extracted, and Real-Time PCR analysis of gene expression was performed, or the cell pellet was trypsinized to form a single cell suspension, and the cell size was determined by taking a photograph under a fiberscope, and surface protein expression was analyzed by flow cytometry, according to the method described in example 1 above.

The results of Real-Time PCR and flow cytometry analysis experiments on the mesenchymal stem cells obtained by culturing in the above example 1, comparative example 1 and comparative example 2 show that:

(1) the single cell suspension of the 5 th generation of human placental mesenchymal stem cells cultured by the 2D adherent culture of the comparative example 1 has the average diameter of 22.4 mu m and the diameter range of 15-41 mu m; the single cell suspension of the human placenta mesenchymal stem cells cultured by the hanging drop culture of the comparative example 2 with the same generation has the average diameter of 12.1 mu m and the diameter range of 8-15 mu m; the single cell suspension of the human placental mesenchymal stem cells cultured in the same generation of the rotating bottle in example 1 has an average diameter of 12.3 μm and a diameter range of 8-14 μm.

(2) Regarding the expression of CXCR4 by mesenchymal stem cells, the gene expression level of CXCR4 was significantly increased by both the hanging drop culture of comparative example 2 and the spinner flask culture of example 1 of the present invention, but the increase was more significant by the spinner flask culture of example 1 of the present invention, and the mRNA expression level was more than 2 times that of the hanging drop culture (as shown in fig. 2).

(3) Flow cytometry analysis shows that the expression rate of the mesenchymal stem cell CXCR4 of the 2D adherent culture 5 generations in the comparative example 1 is about 1%; the expression rate of the mesenchymal stem cell CXCR4 in the hanging drop culture of comparative example 2 was 14.7%, while the expression rate of the mesenchymal stem cell CXCR4 in the spinner flask culture of example 1 of the present invention was 42.8% (as shown in fig. 3).

The results show that: the expression level of CXCR4 on the surface of the mesenchymal stem cells is greatly improved in a flowing state.

Comparative example 3:

this comparative example compares the effect of medium additions on cell balling and survival under the same culture conditions and is specifically designed to: the mesenchymal stem cell culture solution was prepared in the same manner as in example 1 except that the human serum albumin, trichostatin A, human fibronectin and bFGF in example 1 were not added.

The experimental result shows that after 10 hours of culture, the balling rate of the mesenchymal stem cells of the example 1 is more than 90 percent, and the balling rate of the mesenchymal stem cells of the comparative example 3 is less than 40 percent; after 60 hours of culture, the survival rate and the recovery rate of the mesenchymal stem cells of the example 1 are both more than 90 percent, while the survival rate of the mesenchymal stem cells of the comparative example 3 is less than 50 percent, and the recovery rate is less than 30 percent.

Example 2: comparative experiment of effects of different culture methods on migration capacity of mesenchymal stem cells and effects of CXCR4 in mesenchymal stem cells

The migration ability of the mesenchymal stem cells cultured in the different methods of the above example 1, comparative example 1 and comparative example 2 was measured using a Transwell chamber of a 24-well plate having a pore size of 8 μm. The method specifically comprises the following steps:

adding 600 μ L of 0.5% BSA-DMEM or 50% mouse myocardial infarction tissue extract-DMEM (mouse acute myocardial infarction 24h, infarction and ischemic myocardial hydrolysate) into the lower chamber of the pore plate, respectively, adding 100 μ L of differently processed mesenchymal stem cell suspension into the small chamber, respectively, wherein the cell density is 2 × 10⁵Individual cells/mL.

The mesenchymal stem cells are grouped and processed as follows: 2D adherent culture of 5 th generation human placenta mesenchymal stem cells, suspension drop culture of 60h mesenchymal stem cells and rotary bottle culture of 60h mesenchymal stem cells, forming single cell suspension after trypsinization, washing with phosphate buffer solution, resuspending with 1% BSA-containing DMEM to form 2 × 10 density suspension⁵Single cell suspension per mL; adding 5 mug/mL CXCR4 function blocking antibody (R) into the mesenchymal stem cell suspension cultured in the rotary bottle for 60h&D Systems, Clone #44717, cat # MAB173), or equivalent amounts of non-immune isotype control IgG (control), incubated at 37 ℃ for 30 min. After addition of mesenchymal stem cells to the upper chamber, Transwell was placed in a chamber at 37 ℃ with 5% CO₂And (3) incubating in an incubator for 6h, taking out the cell, firstly wiping the fine particles attached to the upward surface of the cell membrane by using a cotton ball, then fixing the membrane by using 4% paraformaldehyde, dyeing by using DAPI (Dairy & International organization pi), observing the cells attached to the lower surface of the cell membrane under a fluorescence microscope, photographing, and randomly selecting 10 visual fields per hole. For each group, 3 multiple wells were set, and the number of cells per field was counted using Image J.

The results show that there is no difference in the number of randomly moving cells of DMEM toward the lower chamber and the number of cells moving toward the membrane of the infarcted myocardium extract and adhering to the lower surface of the membrane through the membrane micropores in the lower chamber among the 2D anchorage-cultured mesenchymal stem cells of comparative example 1, the hanging drop-cultured mesenchymal stem cells of comparative example 2 and the mesenchymal stem cells of inventive example 1 cultured in the spinner flask, in which the mesenchymal stem cells cultured in the spinner flask are significantly increased compared to the other two groups, while the CXCR4 block significantly reduces their migration to the infarcted myocardium extract (as shown in fig. 4), thereby indicating that the spinner flask culture of inventive example 1 improves the expression of CXCR4 on the surface of the mesenchymal stem cells as an important reason for the increase in its migratory ability.

Example 3: comparative experiment of lung obstruction of mesenchymal stem cell intravenous injection mice by different culture methods

The human placental mesenchymal stem cells of the 5 th generation of adherent culture of the comparative example 1 were subjected to luciferase lentivirus (pLV-Luc) transfection, wherein a portion of the cells were further subjected to spinner flask culture of example 1 for 60h and hanging drop culture of the comparative example 2 for 60 h; the mesenchymal stem cells cultured by the three methods form single cell suspension after being digested by trypsin, and the cell density is 1 multiplied by 10⁶Cells/200. mu.L. Will be 1 × 10⁶The mesenchymal stem cells cultured by the different methods are slowly injected into a BALB/C mouse body through a tail vein (8 weeks, 18-22 g of body weight). After 24h, the mice were anesthetized, injected with fluorescein (D-luciferin, 150mg/kg) intraperitoneally, and the Bruker small animal imaging system collected the body luminescence signals of the mice for 10 min.

The results showed that the mesenchymal stem cells cultured adherently in comparative example 1 were largely retained in the lung after intravenous injection, the hanging drop culture in comparative example 2 was also relatively retained in the lung, and the mesenchymal stem cells cultured in the spinner flask in example 1 of the present invention were hardly detected in the intrapulmonary retention after intravenous injection (n ═ 3 (3 mice per group), as shown in fig. 5); therefore, the mesenchymal stem cells cultured by the rotary bottle do not cause lung obstruction after intravenous injection.

Example 4: contrast experiment of migration ability to ischemic myocardium of mesenchymal stem cell tail vein injection acute myocardial infarction mouse by different culture methods

Comparative example 1 adherent culture of 5 th generation human placental mesenchymal stem cells, comparative example 2 hanging drop culture of 60hThe mesenchymal stem cells and the mesenchymal stem cells cultured in the rotary bottle for 60h in the embodiment 1 of the invention are respectively digested by trypsin to form single cell suspension, washed by phosphate buffer solution and re-suspended by normal saline to form the mesenchymal stem cells with the density of 1 multiplied by 10⁶Individual cells/200. mu.L of single cell suspension. 1X 10⁶The mesenchymal stem cells are slowly injected through tail veins after 24 hours of mouse acute myocardial infarction, the mouse is killed after 72 hours of injection, myocardial ischemia parts (infarction edge parts) are taken to extract DNA, and the number of the human mesenchymal stem cells in the myocardium is quantitatively detected by a real-time quantitative PCR method by using primers specifically aiming at human DNA sequences. The specific method comprises the following steps:

(1) mouse myocardial infarction model: 8 weeks old BABL/c mice, intraperitoneal injection of 1% sodium pentobarbital (200 u L per 20g mice), anesthesia of the mice on the back in the operating plate, fixation of the chest hair removal; separating subcutaneous tissue with blunt property, exposing trachea, cutting trachea, inserting tube, and connecting with respirator; horizontally opening the chest between the left fourth rib and ligating the anterior descending branch of the left coronary artery after exposing the heart; the heart was repositioned and the surgical incision was sutured and the tracheal cannula was withdrawn until the animal was awakened.

(2) Extraction of tissue and cell DNA: the mice were sacrificed 72h after intravenous injection of mesenchymal stem cells, the infarcted border tissue (or the normal myocardial tissue of the corresponding site) of the heart was taken, the myocardial tissue of the same weight of each mouse was put into a glass grinder, an appropriate amount of phosphate buffer was added to grind it to a homogenate, it was inhaled into an EP tube, an extraction buffer (containing 10mmol/L Tris-HCl, 0.1mol/L EDTA, 0.5% SDS) was added to 1mL, 5. mu.L, 20. mu.g/mL trypsin was added, and water bath at 37 ℃ was carried out for 1 h. Then 10. mu.L of proteinase K was added to each EP tube and water bath was carried out at 52 ℃ for 2 h. Adding 1mL of phenol chloroform isopropanol into each tube, violently shaking for 1min, centrifuging at 12000rpm for 15min, transferring the colorless transparent liquid layer above the EP tube into a new 2-mL EP tube, adding the phenol chloroform isopropanol with the same volume again for extraction, and repeating the operation once. And after centrifugation, transferring the upper colorless and transparent liquid layer into a 1.5-mL EP tube, adding isopropanol with the same volume and 3mol/L sodium acetate solution with one tenth volume, uniformly mixing, centrifuging at 10000rpm for 15min, discarding supernatant, leaving white precipitate (DNA), washing the DNA with 80% ethanol, adding TE solution, and storing in a refrigerator at 4 ℃ for later use.

Quantitatively detecting human mesenchymal stem cells in the myocardium of the mouse by a real-time fluorescent quantitative PCR method: the number of the human mesenchymal stem cells migrating to the infarcted heart after intravenous injection is detected by a fluorescent quantitative PCR method, and primers are specific to a special sequence Alu (F: CATGGTGAAACCCCGTCTCTA (SEQ ID NO: 5); R: GCCTCAGCCTCCCGAGTAG (SEQ ID NO:6)) in human genome DNA, and the method is widely applied to the conventional research. PCR Using Taqman Universal PCR Master Mix Probe fluorescent quantitative PCR kit, 900nmol/L primer, 200ng sample genomic DNA and 250nmol/L probe were added for each reaction (TaqMan probe: 5 '-FAM-ATTAGCCGGGCGTGGTGGCG-TAMRA-3' (SEQ ID NO:7)), and the amplification procedure was: the first step is as follows: 50 ℃ for 2 min; the second step is that: 95 deg.C for 10 min; the third step: the cycle was repeated 40 times at 95 ℃ for 15s, 60 ℃ for 60 s. Each sample was provided with 3 multiple wells. And (3) taking the logarithm of the human genome DNA quantity in the sample and the corresponding CT value as parameters to prepare a standard curve, and obtaining the human genome DNA quantity corresponding to the CT value. According to previous studies, each diploid nucleus contains approximately 5pg of DNA. By quantifying the amount of genomic DNA contained in each cell, the number of cells corresponding to the amount of genomic DNA in the sample can be obtained.

The results show that the number of mesenchymal stem cells cultured in the spinner flask of example 1 of the present invention reached ischemic myocardium after intravenous injection was significantly more than that of the adherent cultured mesenchymal stem cells of comparative example 1 and that of the hanging drop cultured mesenchymal stem cells of comparative example 2 (n ═ 6 (6 mice per group), P <0.01, fig. 6); therefore, the migration capability of the mesenchymal stem cells cultured by the rotary bottle to ischemic myocardium is obviously improved.

Example 5: contrast experiment of migration ability of mesenchymal stem cell tail vein injection cerebral infarction rat to ischemic brain tissue by different culture methods

The migration of the highly migrated mesenchymal stem cells to ischemic brain tissue was quantitatively analyzed by the same detection method as in example 4, and the study adopted a rat middle cerebral artery occlusion 1h reperfusion cerebral infarction model, and after 24h and 48h infarction respectively, 1X 10 injection via tail vein⁶Mesenchymal stem cells per 200. mu.L, whichThe adherent culture mesenchymal stem cell group of the comparative example 1 is 6, the hanging drop culture mesenchymal stem cell group of the comparative example 2 is 6, and the rotary bottle culture mesenchymal stem cell group of the example 1 is 6. Animals were sacrificed 72h after the first cell injection, infarcted limbal brain tissue was taken and the number of human mesenchymal stem cells in the tissue was determined by real-time fluorescent quantitative PCR. The results show that the number of mesenchymal stem cells cultured in the spinner flask of example 1 of the present invention reached the ischemic brain tissue was 9.6 times that of the adherent culture of comparative example 1 and 2.5 times that of the hanging drop culture of comparative example 2.

In conclusion, the high migration mesenchymal stem cells prepared by the method have small volume, the average diameter is 11-14 μm, the expression rate of CXCR4 on the cell surface is up to more than 30%, the cell migration capability is strong, the pulmonary retention phenomenon is basically not generated by intravenous injection, and the number of the cells reaching ischemic myocardium is obviously increased.

Sequence listing

<110> Shenzhen International institute for graduate of Qinghua university

<120> high migration mesenchymal stem cell and preparation method and application thereof

<130> GAI21CN2224

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 1

atccctgccc tcctgctgac tattc 25

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 2

gagggccttg cgcttctggt g 21

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 3

cgtggaagga ctcatgacca 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 4

tccaggggtc ttactccttg 20

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 5

catggtgaaa ccccgtctct a 21

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 6

gcctcagcct cccgagtag 19

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Probe

<400> 7

attagccggg cgtggtggcg 20

Claims

1. A preparation method of high migration mesenchymal stem cells comprises the following steps:

2. The method according to claim 1, wherein the mesenchymal stem cell is seeded at a density of (0.5 to 10) x 10⁵Individual cells/mL.

3. The preparation method of claim 1, wherein the mesenchymal stem cell culture fluid comprises low glucose DMEM culture fluid containing 1-20% fetal bovine serum or 0.5-10% human platelet lysate.

4. The method according to claim 3, wherein the mesenchymal stem cell culture solution further comprises 0.1 to 5% human serum albumin, 1 to 100nmol/L of trichostatin A, 1 to 50 μ g/mL of human fibronectin, and 1 to 40ng/mL of bFGF.

5. The method according to claim 1, wherein the conditions for the fluid culture in the cell culture spinner flask or the stirred fermenter are: 37 ℃ and 5% CO₂Under the condition, the stirring speed is 5-200 rpm, and the culture time is 5-200 h.

6. The method according to claim 1, wherein the method for collecting the cell pellet after completion of the culture comprises a centrifugation method, a filtration method or a natural sedimentation method;

preferably, the step of washing and digesting to form single cells comprises:

washing the collected cell balls by using a phosphate buffer solution, and then digesting the cell balls by using trypsin to form single cells;

preferably, the phosphate buffer is a phosphate buffer without calcium and magnesium ions;

preferably, the trypsin is EDTA-containing trypsin.

7. A highly migrating mesenchymal stem cell, which is prepared by the preparation method according to any one of claims 1 to 6.

8. The highly migrating mesenchymal stem cell according to claim 7, wherein the highly migrating mesenchymal stem cell has an average diameter of 11 to 14 μm and an expression rate of CXCR4, which is an acceptor expressed on the surface of the highly migrating mesenchymal stem cell, of 30% or more.

9. Use of the highly migrating mesenchymal stem cells according to claim 7 or 8 for the preparation of a medicament for the treatment of tissue damage repair, degenerative diseases, immunological diseases, immune rejection after organ transplantation, organ function deterioration, organ and tissue ischemia, inflammation.

10. The use of claim 9, wherein the tissue damage comprises tissue damage caused by cerebral or myocardial infarction; the degenerative disease comprises diabetes, Parkinson's disease, senile dementia or degenerative joint disease; the immune disease comprises systemic lupus erythematosus, psoriasis or rheumatoid arthritis; the post-organ transplant immune rejection comprises host-to-graft rejection or graft-to-host rejection; the organ failure comprises ovarian or gonadal failure; the ischemia of organs and tissues comprises heart, brain or lower limb ischemia; the inflammation includes an inflammatory response after mechanical or chemical injury, immune inflammation, or chemically stimulated inflammation.