CN113106059B

CN113106059B - High-migration mesenchymal stem cells, and preparation method and application thereof

Info

Publication number: CN113106059B
Application number: CN202110370692.9A
Authority: CN
Inventors: 吴耀炯; 莫妙华
Original assignee: Shenzhen International Graduate School of Tsinghua University
Current assignee: Shenzhen International Graduate School of Tsinghua University
Priority date: 2021-04-07
Filing date: 2021-04-07
Publication date: 2023-08-15
Anticipated expiration: 2041-04-07
Also published as: CN113106059A; WO2022213704A1

Abstract

The invention provides a high-migration mesenchymal stem cell, a preparation method and application thereof. The preparation method of the high-migration mesenchymal stem cells comprises the following steps: and (3) inoculating and suspending the mesenchymal stem cells in a mesenchymal stem cell culture solution, carrying out flowing liquid culture in a cell culture rotating bottle or a stirring type fermentation tank, and collecting cell spheres after the culture is finished without adding microcarriers, and flushing and digesting to form single cells, thereby obtaining the high-migration mesenchymal stem cells. The high-migration mesenchymal stem cells prepared by the invention have small volume and average diameter of 11-14 mu m, the expression rate of CXCR4 on the cell surface is up to more than 30%, the cell migration capability is strong, the pulmonary retention phenomenon is basically not generated by intravenous injection, and the number of the cells reaching ischemic cardiac muscle is obviously increased.

Description

High-migration mesenchymal stem cells, and preparation method and application thereof

Technical Field

The invention belongs to the technical field of stem cells, and particularly relates to a high-migration mesenchymal stem cell, a preparation method and application thereof.

Background

Mesenchymal stem cells (mesenchymal stem cells, or mesenchymal stromal cells, MSC) are adult stem cells with the capacity of multidirectional differentiation, can differentiate into various tissue cells, participate in constituting a tissue regeneration microenvironment by secreting a large amount of growth and immunoregulatory factors, and promote tissue injury repair. Mesenchymal stem cells are widely present in various tissues of the body, but their number decreases significantly with age. A large number of researches prove that the mesenchymal stem cells can be supplemented to promote regeneration and repair of various tissues.

The mesenchymal stem cells are widely available and can be separated from placenta, umbilical cord, bone marrow and other tissues. Because the mesenchymal stem cells have special low immunogenicity, the allogeneic mesenchymal stem cell transplantation does not cause immune rejection, does not need tissue matching, is particularly suitable for repairing tissue injury (such as treating cerebral infarction, myocardial infarction and the like) and treating various degenerative diseases (such as diabetes, parkinson's disease and the like), and is a main mesenchymal stem cell transplantation way by intravenous injection.

The mesenchymal stem cells obtained from the tissues have a small quantity, and can meet the clinical treatment requirement after in vitro amplification culture. Currently, a two-dimensional (2D) adherent culture method is generally adopted for mesenchymal stem cells, and microcarrier addition is generally required to co-culture in a culture process based on a bioreactor, for example: GE microcarriers (Cytopore, cytodex, cytoline), gelatin microcarriers, etc., to which cells are attached, are also 2D cultures in nature. In the 2D culture process, cells undergo epigenetic changes while proliferating, which causes abnormal expression of a plurality of genes, which is manifested by increased cell volume and abnormal expression of molecules related to surface migration, such as CXCR4 (C-X-C Motif Chemokine Receptor 4) which is obviously reduced, and up to more than 90% of cells are blocked in pulmonary microvasculature after intravenous injection, wherein most of the cells die in 24 hours due to ischemia, and the extrapulmonary injury tissue is difficult to reach. Three-dimensional (3D) hanging drop cultures are also used, for example: WO2009134532A2 discloses a hanging drop culture method which is capable of forming cell aggregates, but the method is a static culture method, and the obtained mesenchymal stem cell CXCR4 expression level and the targeted migration capability to ischemic tissues still have the defects.

Disclosure of Invention

Based on the defects existing in the prior art, a first object of the invention is to provide a preparation method of high-migration mesenchymal stem cells; the second purpose of the invention is to provide the high-migration mesenchymal stem cells prepared by the preparation method; the third object of the invention is to provide the application of the high-migration mesenchymal stem cells in preparing medicaments for treating tissue injury repair, degenerative diseases, immune rejection after organ transplantation, organ function decline, ischemia and inflammation of organs and tissues.

The aim of the invention is achieved by the following technical means:

in one aspect, the invention provides a method for preparing high-migration mesenchymal stem cells, comprising the following steps:

and (3) inoculating and suspending the mesenchymal stem cells in a mesenchymal stem cell culture solution, carrying out flowing liquid culture in a cell culture rotating bottle or a stirring type fermentation tank, and collecting cell spheres after the culture is finished without adding microcarriers, and flushing and digesting to form single cells, thereby obtaining the high-migration mesenchymal stem cells.

The inventor creatively adopts a culture method based on three-dimensional (3D) dynamic cells, the method comprises the steps of inoculating and suspending mesenchymal stem cells in a mesenchymal stem cell culture solution, carrying out flowing liquid culture in a cell culture rotating bottle (with a stirring device) or a stirring fermentation tank, and reducing the volume of the mesenchymal stem cells and improving the migration capability of the mesenchymal stem cells in blood circulation and migration capability to damaged tissues without adding any microcarriers in the culture process; in addition, the inventors creatively found in experiments that cells flow with liquid and gradually form cell aggregates (cytoballs), and that the shearing force generated by the liquid flow caused by stirring can further remarkably increase the migration capacity of mesenchymal stem cells and remarkably increase the expression level of mesenchymal stem cell surface migration related receptor CXCR 4; the dual action of shear forces formed at cell aggregation and flowing fluids promotes mesenchymal stem cell CXCR4 expression and targeted migration to ischemic tissue.

In the above preparation method, preferably, the mesenchymal stem cells have an seeding density of (0.5 to 10) ×10 ⁵ Individual cells/mL.

In the above preparation method, preferably, the mesenchymal stem cell culture solution comprises a low glucose DMEM culture solution containing 1% -20% (V/V) fetal bovine serum or 0.5% -10% (V/V) human platelet lysate or serum substitute (e.g., PALL ultra G). The low glucose DMEM broth may be a commercially available low glucose DMEM broth (e.g., from Thermo Fisher Scientific). The mesenchymal stem cell culture solution of the present invention may also be other conventional cell basal culture solutions.

In the above preparation method, preferably, 0.1% -5% (W/V, final concentration) of human serum albumin, 1-100 nmol/L (final concentration) of yeast Gu Junsu a, 1-50 μg/mL (W/V, final concentration) of human fibronectin, and 1-40 ng/mL (W/V, final concentration) of bFGF (basic fibroblast growth factor ) are further added to the mesenchymal stem cell culture solution. By adding the mesenchymal stem cell culture solution of human serum albumin, yeast Gu Junsu A, human fibronectin and bFGF, the cell can be ensured to ball and survive in a suspension flowing system.

In the above preparation method, preferably, the conditions for performing the flowing liquid culture in the cell culture spinner flask or the stirred tank are as follows: 37 ℃ and 5% CO ₂ Under the condition that the stirring speed is 5-200 rpm and the culture time is 5-200 h.

In the above preparation method, preferably, the method of collecting the cell pellet after the end of the culture includes centrifugation, filtration or natural sedimentation.

In the above preparation method, preferably, the step of washing and digesting to form single cells comprises: the collected cell pellet was washed with phosphate buffer and then digested with trypsin to form single cells.

In the above preparation method, preferably, the phosphate buffer is a phosphate buffer without calcium and magnesium ions.

In the above preparation method, preferably, the trypsin is EDTA-containing trypsin.

On the other hand, the invention also provides a high-migration mesenchymal stem cell which is prepared by adopting the preparation method.

The average diameter of the high-migration mesenchymal stem cells is 11-14 mu m, and the expression rate of the receptor CXCR4 for expressing cell migration on the surface is more than 30%.

In still another aspect, the invention also provides an application of the high-migratory mesenchymal stem cells in preparing a medicament for treating diseases such as tissue injury repair, degenerative diseases, immune rejection after organ transplantation, organ function decline, ischemia and inflammation of organs and tissues, and the like.

In the above application, preferably, the tissue injury includes tissue injury caused by cerebral infarction or myocardial infarction, and the like; the degenerative diseases comprise diabetes, parkinson's disease, senile dementia or degenerative joint disease and the like; the immune diseases comprise systemic lupus erythematosus, psoriasis, rheumatoid arthritis and the like; the post-organ transplant immune rejection includes host-to-graft rejection or graft-to-host rejection; the organ dysfunction includes ovarian or gonadal dysfunction; the organ and tissue ischemia includes heart, brain or lower limb ischemia, etc.; the inflammation includes inflammatory reaction after mechanical injury or chemical injury, immune inflammation or chemical stimulation inflammation, etc.

The high-migration mesenchymal stem cells of the invention basically do not generate a pulmonary retention phenomenon after intravenous injection, and do not block pulmonary blood vessels.

The invention has the beneficial effects that:

(1) The high-migration mesenchymal stem cells prepared by the invention have small volume, the diameter is generally below 15 mu m, the size is uniform, and the average diameter is 11-14 mu m.

(2) The cell surface of the high-migration mesenchymal stem cell prepared by the invention can express a high-level cell migration related receptor CXCR4, and the expression rate is as high as more than 30%.

(3) The high-migration mesenchymal stem cells prepared by the method have strong cell migration capability, and compared with the mesenchymal stem cells obtained by common two-dimensional adherent culture, common three-dimensional hanging drop culture and the like, the high-migration mesenchymal stem cells obtained by the three-dimensional carrier-free dynamic culture of the invention have obviously enhanced migration capability.

(4) The lung retention of the prepared high-migration mesenchymal stem cells after intravenous injection is greatly reduced, and the lung retention phenomenon is basically avoided.

(5) The high-migration mesenchymal stem cells prepared by the invention have strong targeted migration capability to ischemic tissues, and the number of the cells reaching ischemic cardiac muscle after intravenous injection is obviously increased.

Drawings

FIG. 1 is a graph showing comparison of expression levels of CXCR4 on the surface of human placental mesenchymal stem cells of the present invention in comparative example 1 using a flow cytometer to determine the adherent culture primary (P0) and the 5 th generation (P5).

FIG. 2 is a graph showing comparison of mRNA expression levels of CXCR4 of human placental mesenchymal stem cells of the 5 th generation of the present invention, which were measured by Real-Time PCR, in comparative example 1, in adherent culture (2D MSC), in comparative example 2, in hanging drop culture (3D MSC-H), and in example 1, in spin flask culture (3D MSC-S).

FIG. 3 is a graph showing comparison of cell surface expression levels of CXCR4 of human placental mesenchymal stem cells of the present invention at the 5 th generation analyzed by flow cytometry in the adherent culture (2D MSC), the hanging drop culture (3D MSC-H) of comparative example 2, and the spin bottle culture (3D MSC-S) of example 1.

FIG. 4 is a graph showing the comparison of the migration ability of mesenchymal stem cells (3D-S-B) obtained by measuring the surface area of a Transwell cell in accordance with the present invention in comparative example 1 (2D), in comparative example 2 hanging drop culture (3D-H), in example 1 rotating flask culture (3D-S) and rotating flask culture after CXCR4 function interruption (A in the graph is a graph showing the comparison of the number of migrating cells after DAPI staining; and B in the graph is a graph showing the comparison of the number of counted multi-field average cells).

FIG. 5 is a graph comparing lung retention of mice injected intravenously with mesenchymal stem cells of comparative example 1, i.e., adherent culture (2D MSC), comparative example 2, i.e., hanging drop culture (3D MSC-H), and inventive example 1, i.e., rotating bottle culture (3D MSC-S) for 24 hours.

FIG. 6 is a graph comparing the number of mesenchymal stem cells reaching ischemic myocardium after intravenous injection for the same number of comparative example 1 adherent cultures (2D MSCs), comparative example 2 hanging drop cultures (3D MSC-H), and rotating flask cultures (3D MSC-S) of example 1 of the present invention.

Detailed Description

The technical solution of the present invention will be described in detail below for a clearer understanding of technical features, objects and advantageous effects of the present invention, but should not be construed as limiting the scope of the present invention. The reagent materials used in the following examples are commercially available and conventional unless otherwise specified.

Example 1:

the embodiment provides a preparation method of a high-migration mesenchymal stem cell, which specifically comprises the following steps:

(1) Adopting a cell culture rotary bottle rotary culture method to mix the human placenta-derived mesenchymal stem cells according to the ratio of 3×10 ⁵ The inoculation density of individual cells/mL was suspended in a mesenchymal stem cell culture medium, and the culture medium was placed in a cell spin flask at 37℃with 5% CO ₂ The culture medium was continuously cultured in a flowing state in an incubator at a stirring speed of 60rpm for 60 hours under stirring conditions, and mesenchymal stem cells were aggregated to form uniform-sized cell spheres having a diameter of about 200. Mu.m. After the culture is finished, collecting cell balls in a centrifugal mode;

wherein the mesenchymal stem cell culture solution contains 5% human Platelet Lysate (PLUS) ^TM Human Platelet Lysate) low glucose DMEM (Dulbecco's Modified Eagle Medium); the culture solution also comprises the following additives: 1% human serum albumin, 6.25nmol/L yeast Gu Junsu A (Trichostatin A, TSA), 5 μg/mL human fibronectin (fibronectin) and 5ng/mL bFGF (basic fibroblast growth factor ).

Wherein, the mesenchymal stem cells from human placenta are mesenchymal stem cell single-cell suspension formed by harvesting and digesting 5 generations of conventional 2D adherent culture.

(2) Adding 5mL of DPBS (phosphate buffer without calcium and magnesium ions) into a centrifuge tube with the concentration of 15mL of the collected mesenchymal stem cell spheres for one time; then adding proper amount of 0.25% trypsin solution (containing 0.02% EDTA) for digestion for about 3min, and lightly blowing to disperse the cells into single cell suspension after the cell balls become loose; then adding an equal volume of DMEM medium containing 10% of fetal bovine serum to stop trypsin action, centrifuging for 5min at 1300r/min, discarding the supernatant, and finally adding a phosphate buffer containing 1% of Bovine Serum Albumin (BSA) to re-suspend the cells to form single-cell suspension, thus obtaining the high-migration mesenchymal stem cell suspension.

1. RNA extraction and real-time quantitative PCR to measure CXCR4 gene expression levels:

(1) Directly using the above cultured cell pellet, removing cell culture solution from the collected cell pellet, washing with phosphate buffer once, and adding 1.0mLThe cells were lysed by pipetting, transferred to 1.5mL tubes.

(2) The mixture was washed once more with phosphate buffer and 1.0mL of the mixture was addedThe pellet was blown down until complete digestion, transferred to a 1.5mL tube, and the cells were thoroughly lysed.

(3) 0.2mL of chloroform was added, and after mixing, the mixture was centrifuged at room temperature for 15min, at which time delamination occurred in the centrifuge tube: RNA is in the upper aqueous phase, while denatured protein is in the lower organic phase or between the two layers;

(4) Transferring the supernatant to a new 1.5mL tube, adding equal volume of isopropanol to precipitate nucleic acid, mixing, standing at 4deg.C for 30min, and centrifuging for 15min; the supernatant was discarded, the precipitate was washed with 75% ethanol, and after drying the precipitate, 20. Mu.L of DNase/RNase-free water was added for dissolution.

(5) After RNA concentration was measured by Nanodrop, reverse transcription was performed. 1. Mu.g of RNA was used as a template, and the reverse transcription kit PrimeScript was used according to the reagent instructions ^TM RT reagent Kit with gDNA Eraser (TaKaRa) further removes residual genomic DNA, and high purity RNA is obtained for reverse transcription, and the obtained cDNA is used for real-time quantitative PCR reaction.

(6) Fluorescent quantitative PCR reaction is carried out by using a TaKaRa SYBR premix Ex Taq kit, and the real-time fluorescent PCR amplification program is as follows: 95 ℃ for 45 seconds; 95 ℃ for 5 seconds; 60 ℃ for 31 seconds; 45 cycles were repeated, three replicates were performed simultaneously for each test sample. According to the Ct value fed back by the instrument, a 2-delta Ct method is applied, and Gapdh is taken as an internal reference to quantify the expression quantity of the CXCR4 gene in the sample.

The primers used were:

CXCR4-F：ATCCCTGCCCTCCTGCTGACTATTC(SEQ ID NO:1)；

CXCR4-R：GAGGGCCTTGCGCTTCTGGTG(SEQ ID NO:2)；

Gapdh-F：CGTGGAAGGACTCATGACCA(SEQ ID NO:3)；

Gapdh-R：TCCAGGGGTCTTACTCCTTG(SEQ ID NO:4)。

2. flow cytometry determines cell surface CXCR4 expression levels:

(1) Taking 100 mu L of high-migration mesenchymal stem cell suspension, respectively placing into 3 EP tubes, wherein one tube is blank control, the second tube is isotype control (isotype IgG marked by PE), the third tube is antibody (anti-CXCR 4 streaming antibody marked by PE), incubating on ice for 30min, and avoiding light.

(2) 1mL of phosphate buffer was added to each EP tube, centrifuged at 1300rpm for 5min, the supernatant was discarded, the cells were resuspended in 0.5mL of phosphate buffer containing 1% bovine serum albumin, the expression of sample CXCR4 was measured by BD flow cytometer, and the measurement result was analyzed by BD Csample software, setting the expression of CXCR4 of isotype control cells to be 0.5% or less.

Comparative example 1:

the comparative example provides 2D adherent culture of human placental mesenchymal stem cells of different generations, comprising the following specific steps:

(1) Human placenta-derived mesenchymal stem cells were 2D-attached subcultured in low glucose DMEM containing 10% fetal bovine serum or 5% human platelet lysate at 37deg.C under 5% CO ₂ When the cell fusion degree (conflux) reaches 80% -90%, the method is as follows: 3 or 1:4, carrying out passage and continuous culture for 5 generations.

(2) After the 5 th generation of cells are cultured and the cell culture solution is removed, a part of the cells are washed once by a phosphate buffer solution, cells are cracked in a culture dish, and the lysate is collected for extracting RNA, so that gene expression real-time quantitative PCR analysis is carried out; after another portion of the cells were digested with trypsin (EDTA-containing), the cells were resuspended in phosphate buffer containing 1% bovine serum albumin to form a single mesenchymal stem cell suspension (starting human placenta-derived mesenchymal stem cells for spin-flask spin culture of example 1 above and hanging-drop culture of comparative example 2 below).

After passage in 2D adherent culture using mesenchymal stem cells, the expression level of CXCR4 on the cell surface was reduced from 35% of primary (P0) to less than 1% of generation 5 (P5) by flow cytometry (as shown in fig. 1).

Comparative example 2:

the comparative example provides a method for obtaining mesenchymal stem cells by 3D hanging drop culture, which comprises the following specific steps:

(1) Regulating human placenta-derived mesenchymal stem cell concentration to 0.6X10 with mesenchymal stem cell culture solution (low glucose DMEM containing 5% human platelet lysate) ⁶ Individual cells/mL.

(2) The cell suspension was uniformly added to the upper cover of a 10cm dish at a volume of 35. Mu.L per drop, the number of hanging drops per plate was controlled to about 40 drops, the cover was carefully inverted, placed in an incubator at 37℃with 5% CO ₂ Culturing under the condition for 36h, collecting cell ball, placing in a culture dish without adhesion, and culturing at 37deg.C with 5% CO ₂ Culturing was continued for 60h under the conditions.

(3) Cell pellets were collected, RNA was extracted, and subjected to Real-Time quantitative (Real-Time) PCR analysis of gene expression, or the cell pellets were trypsinized to form a single cell suspension, photographed under a fiberscope to determine cell size, and subjected to flow cytometry to analyze surface protein expression, as described in example 1 above.

The mesenchymal stem cells obtained by culturing in example 1, comparative example 1 and comparative example 2 described above were subjected to Real-Time PCR and flow cytometry analysis experiments, which showed that:

(1) The single cell suspension of the 5 th generation human placenta mesenchymal stem cells is subjected to 2D adherence culture in comparative example 1, and the average diameter is 22.4 mu m, and the diameter range is 15-41 mu m; comparative example 2 hanging drop cultured human placental mesenchymal stem cell single cell suspension of the same generation times, the average diameter is 12.1 μm, and the diameter range is 8-15 μm; example 1, the single cell suspension of human placental mesenchymal stem cells cultured in a spinner flask of the same generation number, the average diameter thereof is 12.3 μm, and the diameter ranges from 8 to 14 μm.

(2) Regarding expression of CXCR4 by mesenchymal stem cells, both hanging-drop culture of comparative example 2 and rotating bottle culture of inventive example 1 significantly increased the gene expression level of CXCR4, but rotating bottle culture of inventive example 1 increased more significantly, with mRNA expression levels more than 2-fold that of hanging-drop culture (as shown in fig. 2).

(3) Flow cytometry analysis shows that the expression rate of the mesenchymal stem cells CXCR4 of the 2D adherence culture 5 generations of comparative example 1 is about 1%; the expression rate of CXCR4 of the mesenchymal stem cells cultured in hanging drop of comparative example 2 was 14.7%, while the expression rate of CXCR4 of the mesenchymal stem cells cultured in the spinner flask of example 1 of the present invention was 42.8% (as shown in fig. 3).

The results in summary show that: the mesenchymal stem cells are in a flowing state, so that the CXCR4 expression level on the surface of the mesenchymal stem cells is greatly improved.

Comparative example 3:

this comparative example compares the effect of the medium additives on cell pelleting and viability under the same culture conditions, and is specifically designed to: the mesenchymal stem cell culture medium was not supplemented with human serum albumin, koji Gu Junsu a, human fibronectin and bFGF in example 1, and the other procedures were the same as in example 1.

Experimental results show that after 10 hours of culture, the mesenchymal stem cells of example 1 have a balling rate of 90% or more, while the mesenchymal stem cells of comparative example 3 have a balling rate of 40% or less; after 60 hours of culture, the mesenchymal stem cells of example 1 had a survival rate and recovery rate of 90% or more, whereas the mesenchymal stem cells of comparative example 3 had a survival rate of less than 50% and a recovery rate of less than 30%.

Example 2: comparative experiments of the effect of different culture methods on the migratory capacity of mesenchymal stem cells and the effect of CXCR4 therein

The migration ability of mesenchymal stem cells cultured in the different methods of example 1, comparative example 1 and comparative example 2 was measured using a Transwell chamber of a 24-well plate having a pore size of 8. Mu.m. The method comprises the following steps:

600. Mu.L of 0.5% BSA-DMEM or 50% mouse myocardial infarction tissue extract-DMEM (mouse acute myocardial infarction 24h, infarction and ischemia myocardial hydrolysate) is added into the lower chamber of the orifice plate, 100. Mu.L of mesenchymal stem cell suspension subjected to different treatments is added into the chamber, and cell density is 2×10 ⁵ Individual cells/mL.

Mesenchymal stem cells were grouped as follows: the mesenchymal stem cells of the 5 th generation of human placenta which are subjected to 2D adherence culture, the mesenchymal stem cells which are subjected to hanging drop culture for 60 hours and the mesenchymal stem cells which are subjected to rotating bottle culture for 60 hours are digested by trypsin to form single cell suspension, washed by phosphate buffer solution and resuspended by DMEM containing 1% BSA to form the density of 2 multiplied by 10 ⁵ Single cell suspension of individual cells/mL; 5. Mu.g/mL CXCR4 function blocking antibodies (R) were added to each of the mesenchymal stem cell suspensions cultured in a spin flask for 60h&Dsystems, clone #44717, cat# MAB 173), or equivalent amounts of non-immune isotype control IgG (control), incubated for 30min at 37 ℃. After adding mesenchymal stem cells in the upper chamber, transwell was performed at 37℃with 5% CO ₂ Incubating for 6h in an incubator, taking out the cell, firstly wiping off the thin cotton balls attached to the upward surface of the cell membrane, then fixing the membrane with 4% paraformaldehyde, staining with DAPI, observing and photographing the cells attached to the lower surface of the membrane under a fluorescence microscope, and randomly selecting 10 visual fields per hole. 3 wells were set up for each group and Image J was used to calculate the number of cells per field.

The results show that the mesenchymal stem cells of comparative example 1, comparative example 2, and inventive example 1, spin bottle, were not differentiated in the number of randomly moving cells of DMEM in the lower chamber, while the number of cells moving through the membrane of infarcted myocardial extract in the lower chamber and adhering to the underside of the membrane through the membrane micropores, wherein the spin bottle, while the blocking of CXCR4 significantly reduced their migration to the infarcted myocardial extract (as shown in fig. 4), thus the surface that the spin bottle, inventive example 1, improved CXCR4 expression on the surface of the mesenchymal stem cells was an important cause of increased migration ability.

Example 3: comparative experiments of pulmonary obstruction of mesenchymal Stem cell intravenous mice with different culture methods

The human placenta mesenchymal stem cells of the 5 th generation of the adherent culture of comparative example 1 were subjected to luciferase lentivirus (pLV-Luc) transfection, wherein a part of the cells were further subjected to the spin flask culture of example 1 for 60 hours and the hanging drop culture of comparative example 2 for 60 hours; the mesenchymal stem cells cultured by the three methods form single cell suspension after being digested by trypsin, and the cell density is 1 multiplied by 10 ⁶ Individual cells/200 μl. Will be 1X 10 ⁶ The mesenchymal stem cells cultured by the above different methods were slowly injected into BALB/C mice via tail vein (8 weeks, 18-22 g body weight). After 24h mice were anesthetized and injected intraperitoneally with fluorescein (D-luciferin, 150 mg/kg), and the Bruker small animal imaging system collected the luminescence signals from the mice for 10min.

The results showed that the adherent cultured mesenchymal stem cells of comparative example 1 were largely retained in the lung after intravenous injection, and the hanging drop culture of comparative example 2 was also relatively retained in the lung, whereas the rotating bottle cultured mesenchymal stem cells of example 1 of the present invention showed little to no intrapulmonary retention after intravenous injection (n=3 (3 mice per group), as shown in fig. 5); from this, it was shown that the mesenchymal stem cells cultured using the spin bottle of the present invention did not undergo pulmonary obstruction after intravenous injection.

Example 4: comparative experiments of the ability of mesenchymal Stem cells of mice with acute myocardial infarction by tail vein injection to migrate to ischemic myocardium by different culture methods

The mesenchymal stem cells of the 5 th generation human placenta, the mesenchymal stem cells of the 2 nd generation and the mesenchymal stem cells of the 60h rotating bottle are respectively digested by trypsin to form single cell suspension, washed by phosphate buffer solution and resuspended by normal saline to form the density of 1 multiplied by 10 ⁶ Individual cells/200 μl of single cell suspension. 1X 10 ⁶ The individual mesenchymal stem cells are slowly injected through tail vein after 24 hours of acute myocardial infarction of mice, the mice are sacrificed after 72 hours of injection, DNA is extracted from myocardial ischemia parts (infarct border parts), primers specific to human DNA sequences are used, and the quantity of the human mesenchymal stem cells in the myocardium is quantitatively detected by real-time quantitative PCR. The specific method comprises the following steps:

(1) Mouse myocardial infarction model: BABL/c mice at 8 weeks of age, 1% pentobarbital sodium (200 μl per 20g of mice) was injected intraperitoneally, the anesthetized mice were supine on the operating plate, and the fixed breasts were dehaired; separating subcutaneous tissue with blunt force, exposing trachea, cutting cannula by trachea, and connecting to respirator; horizontally opening chest between the left and fourth intercostals, and ligating anterior descending branches of left coronary artery after exposing heart; the heart is reset, the operation incision is sutured, and the trachea cannula is pulled out until the small animal wakes up.

(2) Extraction of tissue and cellular DNA: mice were sacrificed 72h after intravenous injection of mesenchymal stem cells, myocardial tissue of the same weight as each mouse was placed in a glass grinder, ground to homogeneity by adding an appropriate amount of phosphate buffer, sucked into an EP tube, added with extraction buffer (10 mmol/L Tris-HCl,0.1mol/L EDTA,0.5% SDS) to 1mL, added with 5. Mu.L trypsin, 20. Mu.g/mL trypsin, and water-bath at 37℃for 1h. Then 10. Mu.L of proteinase K was added to each EP tube and the tubes were water-bath at 52℃for 2h. 1mL of phenol-chloroform isopropanol was added to each tube, and after shaking vigorously for 1min and centrifuging at 12000rpm for 15min, the colorless transparent liquid layer above the EP tube was transferred to a new 2-mL EP tube, and an equal volume of phenol-chloroform isopropanol was again added for extraction, and the above procedure was repeated once. Transferring the colorless transparent liquid layer above into a 1.5-mL EP tube after centrifugation, adding isopropanol with equal volume and sodium acetate solution with 3mol/L of one tenth volume, centrifuging at 10000rpm for 15min after uniform mixing, discarding supernatant, leaving white precipitate (DNA), washing DNA with 80% ethanol, adding TE solution, and storing in a refrigerator at 4deg.C for use.

Quantitative real-time fluorescent quantitative PCR (polymerase chain reaction) detection of human mesenchymal stem cells in mouse cardiac muscle: the number of human mesenchymal stem cells migrating to the infarcted heart after intravenous injection was detected by fluorescent quantitative PCR method, and the primers were specific sequences Alu (F: CATGGTGAAACCCCGTCTCTA (SEQ ID NO: 5); R: GCCTCAGCCTCCCGAGTAG (SEQ ID NO: 6)) in human genomic DNA, which was widely used in the prior studies. The PCR was performed using a Taqman Universal PCR Master Mix probe-based fluorescent quantitative PCR kit, and 900nmol/L of primer, 200ng of sample genomic DNA, and 250nmol/L of probe (TaqMan probe:5'-FAM-ATTAGCCGGGCGTGGTGGCG-TAMRA-3' (SEQ ID NO: 7)) were added to each reaction, and the amplification procedure was: the first step: 50 ℃ for 2min; and a second step of: 95 ℃ for 10min; and a third step of: the cycle was repeated 40 times at 95℃for 15s,60℃for 60 s. Each sample was provided with 3 duplicate wells. And (3) preparing a standard curve by taking the logarithm of the amount of the human genome DNA in the sample and the corresponding CT value as parameters to obtain the amount of the human genome DNA corresponding to the CT value. According to previous studies, the amount of DNA contained per diploid nucleus was about 5pg. By quantifying the amount of genomic DNA contained in each cell, the number of cells corresponding to the amount of genomic DNA in the sample can be obtained.

The results show that the number of mesenchymal stem cells cultured in the spin bottle of example 1 of the present invention reached ischemic myocardium after intravenous injection was significantly greater than that of the mesenchymal stem cells cultured in the wall-attached culture of comparative example 1 and that of the mesenchymal stem cells cultured in the hanging drop culture of comparative example 2 (n=6 (6 mice per group), P <0.01, fig. 6); therefore, the mesenchymal stem cells cultured by the rotary bottle provided by the invention have obviously improved migration capability to ischemic cardiac muscle.

Example 5: comparative experiments of the ability of mesenchymal Stem cells in Tail vein injection into cerebral infarction rats to migrate to ischemic brain tissue by different culture methods

The same detection method as in example 4 is used to quantitatively analyze the migration of the high-migration mesenchymal stem cells to the ischemic brain tissue, and the study adopts a rat middle cerebral artery occlusion 1h reperfusion cerebral infarction model, and the injection of the cerebral infarction model is carried out by tail vein injection 1X 10 after 24h and 48h respectively ⁶ Individual cells/200 μl of mesenchymal stem cells, wherein 6 of the adherent cultured mesenchymal stem cell groups of comparative example 1, 6 of the hanging drop cultured mesenchymal stem cell groups of comparative example 2, and 6 of the spin bottle cultured mesenchymal stem cell groups of example 1. Animals were sacrificed 72h after the first cell injection, infarcted peripheral brain tissue was taken, and the number of human mesenchymal stem cells in the tissue was determined by real-time fluorescent quantitative PCR method. The results showed that the number of mesenchymal stem cells cultured in the spin flask of example 1 of the present invention reached ischemic brain tissue 9.6 times that of the mesenchymal stem cells cultured in the adherence of comparative example 1, 2.5 times that of the mesenchymal stem cells cultured in the hanging drop of comparative example 2.

In conclusion, the high-migration mesenchymal stem cells prepared by the invention have small volume and average diameter of 11-14 mu m, the expression rate of CXCR4 on the cell surface is as high as more than 30%, the cell migration capability is strong, the pulmonary retention phenomenon is basically not generated by intravenous injection, and the number of the cells reaching ischemic cardiac muscle is obviously increased.

Sequence listing

<110> Shenzhen International research institute at Qinghua university

<120> a high-migration mesenchymal stem cell, and preparation method and application thereof

<130> GAI21CN2224

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 1

atccctgccc tcctgctgac tattc 25

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 2

gagggccttg cgcttctggt g 21

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 3

cgtggaagga ctcatgacca 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 4

tccaggggtc ttactccttg 20

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 5

catggtgaaa ccccgtctct a 21

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> primer

<400> 6

gcctcagcct cccgagtag 19

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Probe

<400> 7

attagccggg cgtggtggcg 20

Claims

1. The application of the high-migration mesenchymal stem cells in preparing a medicament for treating myocardial infarction is provided, wherein the high-migration mesenchymal stem cells are prepared by a preparation method comprising the following steps:

inoculating and suspending the mesenchymal stem cells in a mesenchymal stem cell culture solution, carrying out flowing liquid culture in a cell culture rotating bottle, collecting cell spheres after the culture is finished without adding microcarriers, flushing and digesting to form single cells, obtaining the high-migration mesenchymal stem cells,

wherein the inoculation density of the mesenchymal stem cells is 3×10 ⁵ Individual cells/mL，

The mesenchymal stem cell culture solution comprises a low glucose DMEM culture solution containing 5% of human platelet lysate, and is also added with 1% of human albumin, 6.25nmol/L of yeast Gu Junsu A, 5 mu g/mL of human fibronectin and 5ng/mL of bFGF,

the expression rate of the receptor CXCR4 for expressing cell migration on the surface of the high-migration mesenchymal stem cells is more than 30%, wherein the conditions for carrying out flowing liquid culture in a cell culture rotating bottle are as follows: 37 ℃ and 5% CO ₂ Under the conditions, the stirring speed was 60rpm, and the culturing time was 60 hours.

2. The use according to claim 1, wherein the method of collecting the cell pellet after the end of the culture comprises centrifugation, filtration or natural sedimentation;

the step of washing and digesting to form single cells comprises:

washing the collected cell spheres with phosphate buffer, and then digesting the cell spheres with trypsin to form single cells;

the phosphate buffer solution is a phosphate buffer solution without calcium and magnesium ions;

the trypsin is EDTA-containing trypsin.

3. The use according to claim 1, wherein the mean diameter of the high-migrating mesenchymal stem cells is 11-14 μm.