CN113913430A - Promoter for specific expression of plant overground part tissue and application thereof - Google Patents
Promoter for specific expression of plant overground part tissue and application thereof Download PDFInfo
- Publication number
- CN113913430A CN113913430A CN202111332408.5A CN202111332408A CN113913430A CN 113913430 A CN113913430 A CN 113913430A CN 202111332408 A CN202111332408 A CN 202111332408A CN 113913430 A CN113913430 A CN 113913430A
- Authority
- CN
- China
- Prior art keywords
- dna molecule
- promoter
- plant
- expression
- target gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a promoter for specific expression of overground part tissues of plants and application thereof. The promoter provided by the invention is shown in the following 1) or 2) or 3): 1) the nucleotide sequence is a DNA molecule shown in a sequence 1 in a sequence table; 2) a DNA molecule which is hybridized with the DNA molecule defined in 1) under strict conditions and has the function of a promoter; 3) a DNA molecule having a homology of 90% or more with the DNA molecule defined in 1) and having a promoter function. The promoter provided by the invention can specifically improve the characteristics of photosynthesis, pest resistance and the like of overground tissues such as stems, leaves and the like through genetic engineering under the condition of not influencing gene expression in roots and seeds so as to improve the biological safety of transgenic crops, and has wide application prospect in plant genetic engineering research.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a promoter for specific expression of overground part tissues of plants and application thereof.
Background
The promoter (promoter) is an important component of an expression vector, and serves as an important regulatory element in a DNA sequence, contains core regulatory information of gene expression. The development and utilization of the efficient and specific promoter have important research significance and application value for plant genetic engineering breeding. Commonly used promoters can be divided into 3 classes: constitutive, tissue-specific and inducible promoters. The constitutive promoter drives the gene to continuously express at all tissue parts and all development stages, is not induced by space-time limitation and induction factors, is easy to induce the gene expression level to be too high to influence the growth and development of plants, and is an obstacle encountered when the constitutive strong promoter is combined with a functional gene to improve the quality of crops at present. Tissue-specific promoters can be classified into specific promoters for vegetative organ expression and reproductive organ expression according to plant tissues and organs. The expression product of the target gene can be accumulated in a certain organ or tissue part, the regional expression quantity is increased, unnecessary waste of plant nutrition can be avoided, the tissue specific promoter is always a research hotspot in the biological field as a control element with the most prospect in plant engineering, and the promoter is applied to development biology research and plant genetic engineering.
At present, widely applied tissue-specific promoters include tissue-specific expression promoters of leaves, roots, phloem, vascular bundles, floral organs, fruits, seeds and the like, and overground tissue-specific promoters are rarely reported. Zhoujunli et al disclosed a promoter (CN 102876710A) capable of tissue-specific expression in plants above ground. The promoter is mainly expressed in the overground tissue specificity of monocotyledon rice.
Disclosure of Invention
In view of the above, the main objective of the present invention is to provide a promoter for specific expression of the overground part tissue of a plant and an application thereof.
The promoter provided by the invention is obtained from a rubber tree and is shown in the following 1) or 2) or 3:
1) the nucleotide sequence is a DNA molecule shown in a sequence 1 in a sequence table;
2) a DNA molecule which is hybridized with the DNA molecule defined in 1) under strict conditions and has the function of a promoter;
3) a DNA molecule having a homology of 90% or more with the DNA molecule defined in 1) and having a promoter function.
The stringent conditions may be hybridization and membrane washing at 65 ℃ in a solution of 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS.
The recombinant vector, the expression cassette, the transgenic cell line or the recombinant strain containing the promoter belong to the protection scope of the invention.
The recombinant vector is obtained by inserting the promoter into a multiple cloning site or a recombination site of a plant expression vector.
The plant expression vector may be specifically the vector pCAMBIA 1305. The recombinant vector can be specifically a recombinant plasmid obtained by inserting the promoter into recombination sites of a plant expression vector pCAMBIA 1305.
The recombinant vector can be specifically a recombinant plasmid obtained by substituting the promoter for a 35S promoter fragment between a Pst I site and an Nco I site of a plant expression vector pCAMBIA 1305.
Primer pairs for amplifying the full length of the promoter or any fragment thereof also belong to the protection scope of the invention. The primer pair can be composed of a single-stranded DNA molecule shown in a sequence 2 of a sequence table and a single-stranded DNA molecule shown in a sequence 3 of the sequence table.
The invention also protects the application of the promoter in promoting the expression of target genes.
The target gene expression is the specific expression of the target gene.
The plant may be a monocot or a dicot; the dicotyledonous plant can be a crucifer; the cruciferous plant may be arabidopsis thaliana.
The target gene may be a GUS gene.
The invention also provides a method for cultivating the transgenic plant, which is to use the DNA molecule to start the expression of the target gene in the original plant to obtain the transgenic plant expressing the target gene.
The expression of the target gene is "specific expression of the target gene in the overground tissue of the plant".
The starting plant can be a monocotyledon or a dicotyledon; the dicotyledonous plant can be a crucifer; the cruciferous plant may be arabidopsis thaliana.
The target gene may be a GUS gene.
In the method, a specific DNA molecule can be introduced into the starting plant, so that the promoter is used for promoting the expression of a target gene in the starting plant; the specific DNA molecule sequentially comprises the promoter and the target gene from upstream to downstream. The specific DNA molecule can be specifically introduced into the starting plant through a recombinant expression vector containing the specific DNA molecule. The recombinant expression vector may be any of the above recombinant vectors.
The invention provides a dicotyledon overground tissue specific promoter, which can specifically improve the characteristics of photosynthesis, pest and disease resistance and the like of overground tissues such as stems, leaves and the like through gene engineering under the condition of not influencing gene expression in roots and seeds so as to improve the biological safety of transgenic crops, and has wide application prospect in plant gene engineering research.
Drawings
For purposes of illustration and not limitation, the present invention will now be described in accordance with its preferred embodiments, particularly with reference to the accompanying drawings, in which:
FIG. 1 is a schematic diagram of a promoter expression vector constructed completely.
FIG. 2 shows the expression of GUS gene in transgenic plants.
Detailed Description
Example 1 cloning of promoters for specific expression in aerial tissues of plants
(I) extraction of rubber Tree DNA
1) And (3) putting fresh rubber tree leaves into a centrifugal tube with steel balls, quickly freezing by using liquid nitrogen, and treating for 100 seconds by using a sample quick grinding instrument of 55Hz until the leaves are completely broken.
2) Adding 600 μ L CTAB extractive solution (containing 2% beta-mercaptoethanol), mixing, and water bath at 65 deg.C for 30-60 min.
3) Adding equal volume of chloroform isoamyl alcohol (24: l), mixing by mild inversion, and standing for 10 min; centrifuging at 12000rpm for 10 min at 4 ℃;
4) transferring the supernatant into a new centrifuge tube, adding 2 times of anhydrous ethanol, reversing and uniformly mixing, and standing at-20 ℃ for more than 30 minutes;
5) centrifuging at 12000rpm for 10 min, and discarding the supernatant; adding 700 mu L of 75% ethanol, rinsing and precipitating;
6) repeatedly rinsing, removing supernatant, blowing in a fume hood, dissolving the precipitate in 50-100 μ L water after the centrifuge tube is dried, and storing at-20 deg.C for use.
(II) cloning of promoter sequence for specific expression of aerial tissue of plant
Taking rubber tree genome DNA as a template, firstly amplifying by using an outer primer pair, wherein the outer primer pair is shown as SEQ ID NO.2 and SEQ ID NO. 3:
SEQ ID NO.2：GTTAAACTCTAGGCACGTT，
SEQ ID NO.3：TGAAGAAAAGAAGCAGTTTTGA；
and carrying out agarose gel electrophoresis detection on the amplification product to obtain a promoter sequence of about 2000 bp. Connecting a pMD18-T vector (purchased from Takara Bio-engineering (Dalian) Co., Ltd., product catalog number 6011) after recovery to obtain a recombinant vector, transforming Escherichia coli DH5 alpha (purchased from CD101 of Beijing all-type gold biotechnology Co., Ltd.), selecting clones for PCR detection, and sending positive clones to sequencing verification; the sequence is a specific expression promoter of the overground part tissue of the plant, and the sequence is shown as a sequence 1 in a sequence table.
Example 2 plant expression vector construction
Selecting strains with correct sequencing in example 1 to extract plasmids, and amplifying the plasmids by using a subclone primer pair shown as SEQ ID NO.4 and SEQ ID NO. 5: SEQ ID NO. 4: TCCTCTAGAGTCGACCTGCAGGTTAAACTCTAGGCACGTT, respectively; SEQ ID No. 5: AACTAGTCAGATCTACCATGGTGAAGAAAAGAAGCAGTTTTGA are provided.
And carrying out agarose gel electrophoresis detection on the amplification product, and recovering. The empty pCAMBIA1305 plasmid (non-patent literature describing the pCAMBIA1305 plasmid is: Wang, X. -C., Wu, J., Guan, M. -L., ZHao, C. -H.,. Geng, P.and ZHao, Q. (2020), Arabidopsis MYB4 plants in flying biosyntheses. plant J,101:637-652.https:// doi.org/10.1111/tpj.14570) was double-digested with Pst I and Nco, respectively, and subjected to agarose gel electrophoresis to recover large fragments.
Carrying out homologous recombination on the PCR recovery product and a pCAMBIA1305 enzyme digestion product, transforming escherichia coli DH5 alpha (purchased from Beijing all-type gold biotechnology, Inc.), selecting a clone for PCR detection, and carrying out sequencing verification on a positive clone;
the constructed promoter expression vector is shown in FIG. 1. The GFP and GUS genes in FIG. 1 can be substituted for other genes as needed for different experimental purposes.
Example 3 analysis of promoter-driven GUS Gene tissue expression in Arabidopsis thaliana
The strain with the correct sequencing in example 2 was selected and the plasmid was extracted for subsequent agrobacterium transformation. mu.L of the recombinant plasmid was added to 100. mu.L of Agrobacterium GV3101 competent cells (purchased from Shanghai Weidi Biotechnology Ltd., product No. AC1001), gently mixed, and allowed to stand on ice for 30 minutes. After 3 minutes of liquid nitrogen treatment, the mixture is immediately heat-shocked at 37 ℃ for 10 minutes and then ice-bathed for 1-3 minutes. Adding 800 mu L LB non-resistance liquid culture medium (Solebao L1015), and culturing for 3-5 hours at 28 ℃ by shaking table 180 r/min. Centrifuging at 4000rpm for 1 min, removing most of supernatant, suspending the thallus, uniformly coating the thallus on a solid LB plate added with 50mg/L kanamycin (holo-type gold GG201) resistance, culturing in an incubator at 28 ℃ for 2-3 days. Selecting monoclonal bacteria to carry out PCR amplification detection.
After the positive agrobacterium clones were selected for activation culture, they were inoculated into 500m L LB medium containing 50mg/L kanamycin at a ratio of 1:100, cultured overnight at 28 ℃ until OD600 became 0.6, centrifuged at 4000rpm for 10 minutes to collect the cells, and then resuspended in Arabidopsis thaliana transformation buffer, i.e., 1/2MS medium (Ku Lai Bo PM1061), 5% sucrose, 0.02% silwet-77 to obtain a transformation solution. An Arabidopsis plant with good growth and more buds about five weeks is selected, and the buds are immersed in the transformation solution for about 30 seconds. Dark culture is carried out for one day. Culturing under normal culture condition, and collecting T0 generation seeds after the seeds are mature.
T0 generation seeds are sown on 25mg/L hygromycin resistant MS culture medium by an aseptic sowing method, and after about 1 week, resistant plants are transplanted into a plug tray for culture. And (4) continuing culturing for 1-2 weeks, extracting the arabidopsis DNA, and performing PCR verification to obtain a positive plant, namely a T1 generation plant. Harvesting seeds of T1 generations (T2 generations), continuously sowing and screening, and repeating until T3 generations to obtain pure lines.
Pure transgenic arabidopsis thaliana is sown on an MS culture medium, GUS staining is carried out on different growth periods and different tissues respectively, 100% alcohol is decolorized for 3 times (30 min/time), and the promoter expression activity is observed under a microscope. As shown in FIG. 2, the expression of GUS gene was substantially only expressed in the above-ground tissues of the plant, such as epicotyl, cotyledon, leaf, stem, flower and pod, and no significant expression activity was detected in other tissues and organs, such as radicle, root and seed, showing strong above-ground tissue expression specificity.
Example 4: artificial synthesis of promoter
According to the nucleotide sequence of the promoter, firstly, 8 segments are respectively synthesized into single-stranded oligonucleotide fragments with the length of about 150-200 bp and sticky ends according to the sequence of a positive strand and a negative strand. 8 complementary single-stranded oligonucleotide fragments, corresponding one-to-one to each of the plus and minus strands, were annealed separately to form 8 double-stranded oligonucleotide fragments with cohesive ends. The double-stranded oligonucleotide fragments are mixed and assembled into a complete promoter through catalysis of T4DNA ligase. The synthesized DNA fragment contains a nucleotide sequence of 1-2000 sites in SEQ ID NO 1.
The above-described embodiments should not be construed as limiting the scope of the invention. Those skilled in the art will appreciate that various modifications, combinations, sub-combinations, and substitutions can occur, depending on design requirements and other factors. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> rubber institute of tropical agricultural academy of sciences of China
<120> promoter for specific expression of overground part tissue of plant and application thereof
<130> SPI21317
<160> 5
<170> PatentIn version 3.5
<210> 1
<211> 1748
<212> DNA
<213> rubber tree
<400> 1
gttaaactct aggcacgttt tatgttgcat tcacaactgt taaagtgcca tgtatgttgt 60
tgtggtaatt tggagcagtg tgcgtgcgtt ggcgtgcgtg tgatgtggtg ttgactatgg 120
acaggacggg tagacacggc ttgcgatctt cgctgggacc cggtccttcg ggggtagtca 180
cggcttgagt tcttcgctag gaccccgatt tggtttatta agcgaaagtc cgacttgagt 240
tcttcgctgg cacaggttag atttaagaga gctgtatagg ggatcaactc ccatatatta 300
tgattgatat tactggggtg tgaatgctcc aaattacctt tttgctgtta tgatgtgaaa 360
atattgctga tgttgcattt cactctacag ggtgcattag ttttagataa ttatagagat 420
tatggttaaa attgatattt tactctctga gtcgaacgct cacttctgtt caatattttt 480
tcaagccaca ggaggatatt ttgaggttaa cctacttttc tccttcgcag tcgttattaa 540
tttttgtata taaaactgtt aactcttaga atttctgtta gatgtgttag aaatatttat 600
ttgaattggg ttgtaatata aattgttatt ttggacttgt aaacttatta ttttatgcat 660
gttgatggac tggatgagag agctgagctc ccatttattt ttatgttgta tgagtatgtg 720
gagggtgagc tgagctccca atttattata tactgtgttt acaagtcggg tgagtcaaaa 780
atttcccatt gaaaggtcca tattatggcc ggactctgtt cggttgattt cttgaaattg 840
ggcccaatga gcctttgagt tgggttgagg aatagttagg cttactacgg acctcggggg 900
ctttaggctg gcccaggtcc tagtgccgat ccggcccata ggttaggtcg tgacaaatgt 960
ggtctttcca ttttacacta cacaatattg aaaacgagac aaagtcggga aaaatagatt 1020
tgaatgtgga cagaattagt tagaatccaa aacaattaat atctctatta aattttggta 1080
ctcctccaca tttaattttg cgtccatccc tattatatta tacaaaagct cataaaaaaa 1140
aaaaagttac caattagaca aattagactc ttttttttta taaattgaac taaaaatcaa 1200
atttaaaaaa aaaatatgaa tgatgttaaa tcaaattaac caataaataa attaaaaaaa 1260
aaaccaaaca aaaacaattc aattccattt ttcaattata ataaattttg ctcactcttg 1320
gataacaaag ctaagtaaaa agtgcaaggt aggaattgta gaaaaaaaaa tggtaaaata 1380
agtttgcata tattaatata agataacaat tatattaata tttataataa atcattatta 1440
accgctgatt atgacgcgat gtggttgtaa tgggctaaag tctatcagac atttctaatt 1500
taagcatcat ataactgaaa caacacataa cacaaacccc ataagtgagg acaaaggaga 1560
aaagactaca gaaagccgct tatagacggc cactagaact catcatcttc ttctctagcc 1620
ggctttcctc tgtatctccc attaaagaaa agctctctct tttgctttcc ttttaaaccc 1680
ctctcattgg atacatgacc tagtccttcc cttttcatca ttctcttcaa aactgcttct 1740
tttcttca 1748
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> primer 1
<400> 2
gttaaactct aggcacgtt 19
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> primer 2
<400> 3
tgaagaaaag aagcagtttt ga 22
<210> 4
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223> primer 3
<400> 4
tcctctagag tcgacctgca ggttaaactc taggcacgtt 40
<210> 5
<211> 43
<212> DNA
<213> Artificial Sequence
<220>
<223> primer 4
<400> 5
aactagtcag atctaccatg gtgaagaaaa gaagcagttt tga 43
Claims (10)
1. A DNA molecule which is shown as 1) or 2) or 3) as follows
1) The nucleotide sequence is a DNA molecule shown in a sequence 1 in a sequence table;
2) a DNA molecule which is hybridized with the DNA molecule defined in 1) under strict conditions and has the function of a promoter;
3) a DNA molecule having a homology of 90% or more with the DNA molecule defined in 1) and having a promoter function.
2. A recombinant vector, expression cassette, transgenic cell line or recombinant bacterium comprising the DNA molecule of claim 1.
3. The recombinant vector according to claim 2, wherein: the recombinant vector is obtained by inserting the DNA molecule of claim 1 into a multiple cloning site or a recombination site of a plant expression vector.
4. A primer pair for amplifying the full length of the DNA molecule of claim 1.
5. Use of the DNA molecule of claim 1 for promoting expression of a gene of interest.
6. Use according to claim 5, characterized in that: the target gene expression is the specific expression of the target gene.
7. Use according to claim 6, characterized in that: the specific expression is the specific expression of the overground part tissue of the plant.
8. A method for producing a transgenic plant, wherein the DNA molecule of claim 1 is used to promote the expression of a target gene in a starting plant, thereby obtaining a transgenic plant expressing the target gene.
9. The method of claim 8, wherein: the target gene is expressed by specifically expressing the target gene in the overground part tissue of the plant.
10. The method according to claim 8 or 9, characterized in that: the plant is Arabidopsis thaliana.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111332408.5A CN113913430B (en) | 2021-11-11 | 2021-11-11 | Promoter for specific expression of plant overground tissues and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111332408.5A CN113913430B (en) | 2021-11-11 | 2021-11-11 | Promoter for specific expression of plant overground tissues and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113913430A true CN113913430A (en) | 2022-01-11 |
| CN113913430B CN113913430B (en) | 2023-04-25 |
Family
ID=79246127
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111332408.5A Active CN113913430B (en) | 2021-11-11 | 2021-11-11 | Promoter for specific expression of plant overground tissues and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113913430B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101280313A (en) * | 2008-05-21 | 2008-10-08 | 中国农业大学 | Root specific promoter and recombinant expression vector thereof |
| CN103243096A (en) * | 2012-02-13 | 2013-08-14 | 中国农业科学院作物科学研究所 | Plant tissue specific expression promoter and application of plant tissue specific expression promoter |
| KR101875836B1 (en) * | 2018-03-30 | 2018-07-06 | 한국생명공학연구원 | Laticiferous tissue-specific PEP16 gene promoter from Hevea brasiliensis and uses thereof |
-
2021
- 2021-11-11 CN CN202111332408.5A patent/CN113913430B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101280313A (en) * | 2008-05-21 | 2008-10-08 | 中国农业大学 | Root specific promoter and recombinant expression vector thereof |
| CN103243096A (en) * | 2012-02-13 | 2013-08-14 | 中国农业科学院作物科学研究所 | Plant tissue specific expression promoter and application of plant tissue specific expression promoter |
| KR101875836B1 (en) * | 2018-03-30 | 2018-07-06 | 한국생명공학연구원 | Laticiferous tissue-specific PEP16 gene promoter from Hevea brasiliensis and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113913430B (en) | 2023-04-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110628808B (en) | Arabidopsis AtTCP5 gene and application thereof in regulating plant height | |
| CN109797157B (en) | Abiotic stress resistant transcription factor PbrbHLH92, primer thereof, encoded protein and application | |
| CN109423492B (en) | Application of SlTOE1 gene in regulation and control of flowering time and yield of tomatoes | |
| CN107630020A (en) | Cotton GhTCP4 genes and its application in cotton fiber length is improved | |
| CN104611348A (en) | Cotton fiber predominantly-expressed gene, expression vector and applications thereof, and preparation method of transgenic cotton containing gene | |
| CN107012147B (en) | Drought and/or high-salt induction promoter SlWRKY8P from tomato and application thereof | |
| CN110204600B (en) | BnSPL14 gene, protein and application thereof in controlling cabbage type rape plant type | |
| CN108277224B (en) | Specific promoter GhS for reproductive organ and glandular hair tissue and application thereof | |
| CN107557384B (en) | Genetic transformation system for inducing plant dwarfing and construction and application thereof | |
| Cao et al. | Extremely simplified cut-dip-budding method for genetic transformation and gene editing in Taraxacum kok-saghyz | |
| CN115851823A (en) | Cymbidium goeringii CgARF18 gene and application thereof | |
| CN113913430B (en) | Promoter for specific expression of plant overground tissues and application thereof | |
| CN111218472B (en) | Fusion gene for improving cotton yield, plant expression vector, transformant and application | |
| CN110951771B (en) | Chinese cymbidiummiR390aApplication in controlling plant root system development | |
| CN110904106B (en) | Application of cymbidium goeringii miR159b in enhancing plant cold sensitivity | |
| CN107573411A (en) | Application of the wheat TaZIM1 7A albumen in crop heading stage is regulated and controled | |
| WO2007061146A1 (en) | A method for producing chinese cabbage transformant using tissues of flower stalk and a transformant with promoted soft rot resistance obtained from the method | |
| CN108588069B (en) | Precursor gene of mulberry miR171a and application thereof in enhancing salt tolerance of plants | |
| CN107267513B (en) | Promoter HLP2 induced by pathogenic bacteria | |
| CN106755070B (en) | Method for creating heat-resistant cabbage mustard germplasm | |
| CN110423753B (en) | Root knot specific promoter T106-P induced by root knot nematode and application | |
| CN110904110B (en) | Application of OsHAP3C gene expression reduction in rice variety with shortened heading period and prolonged growth period | |
| CN110194791B (en) | Application of SPL3 protein in regulation and control of plant inflorescence or carpopodium development | |
| CN110982921B (en) | Application of cymbidium miR159a in accelerating plant life cycle | |
| CN116606855B (en) | Rice green tissue specific promoter pOsRBBI3 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |