CN113912685B - Protein for regulating and controlling dark respiration of plant leaves and application thereof - Google Patents

Protein for regulating and controlling dark respiration of plant leaves and application thereof Download PDF

Info

Publication number
CN113912685B
CN113912685B CN202010587199.8A CN202010587199A CN113912685B CN 113912685 B CN113912685 B CN 113912685B CN 202010587199 A CN202010587199 A CN 202010587199A CN 113912685 B CN113912685 B CN 113912685B
Authority
CN
China
Prior art keywords
lrk1
plant
gene
seq
polypeptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010587199.8A
Other languages
Chinese (zh)
Other versions
CN113912685A (en
Inventor
曲明南
陈根云
朱新广
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Center for Excellence in Molecular Plant Sciences of CAS
Original Assignee
Center for Excellence in Molecular Plant Sciences of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Center for Excellence in Molecular Plant Sciences of CAS filed Critical Center for Excellence in Molecular Plant Sciences of CAS
Priority to CN202010587199.8A priority Critical patent/CN113912685B/en
Publication of CN113912685A publication Critical patent/CN113912685A/en
Application granted granted Critical
Publication of CN113912685B publication Critical patent/CN113912685B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Analytical Chemistry (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a protein for regulating and controlling dark breath of plant leaves and application thereof. The present inventors have determined a leucine rich repeat receptor kinase (LRK 1) gene with novel functions, which LRK1 gene encodes a receptor-like kinase, which is a key gene controlling nocturnal dark breathing efficiency. When the expression of LRK1 gene is increased, the traits of plants can be significantly improved, including: (i) increasing the dark respiration rate of plant leaves, (ii) promoting plant growth, (iii) increasing plant yield, plant height or tillering, or (iv) increasing plant high temperature tolerance, etc. Therefore, the LRK1 gene can be used as a target for regulating plant traits and applied to plant breeding.

Description

Protein for regulating and controlling dark respiration of plant leaves and application thereof
Technical Field
The invention belongs to the fields of biotechnology and botanics, and particularly relates to a protein for regulating and controlling dark breath of plant leaves and application thereof.
Background
With the rapid growth of world population, the cultivated area is gradually reduced, and the safety problem of crops such as grains is increasingly serious. For example, rice is an important grain crop in China, and improvement of rice yield is considered as one of the most important factors for alleviating grain crisis. In addition to improving photosynthetic efficiency, factors that increase rice yield also allow for reduced respiration consumption. Respiration of plants is mainly achieved by oxygen consumption and CO2 release, which also plays a key role in maintaining global carbon balance. At the ecosystem level, CO2 released by plant respiration can account for 65% of the total CO2 in the atmosphere, with the remaining CO2 being derived from mineral soil respiration (Raich and Schlesinger, 1992). It is estimated that global terrestrial vegetation breathes with 64G tons of carbon released annually, more than 10 times more than CO2 release from fossil fuel and cement production environments (Schimel, 1995).
It is reported that 2/3 of the CO2 released to the atmosphere due to the photosynthetic process every day originates from dark respiration of plant leaves (Poorter et al 1990;Van der Werf et al, 1994; atkin et al 1996;Loveys et al, 2002). However, the respiration process of plant leaves is a very complex process, and can be summarized as respiration under light (including light respiration and dark respiration under light enhancement) and dark respiration under dark conditions. Among these, light and temperature are the main factors affecting dark breathing. During the day, due to photosynthesis, a large amount of ATP and reducing power are formed in chloroplasts for the progress of assimilation of carbon and nitrogen, and stored in cytoplasm as polysaccharide substances such as starch. In addition, these assimilates are subsequently transported into plant pool organs, such as kernels and form carbon backbones by glycolysis, tricarboxylic acid cycle and the oxidative pathways of electron transport chains, oxidative phosphorylation and Rubisco (photo respiration). In contrast, in dark conditions, cellular polysaccharides are broken down for growing respiration, sustaining respiration, and transport and nutrient assimilation, which consumes ATP inside the cells. Currently, researchers in the field are breeding with high light efficiency, improving photosynthetic efficiency, and simultaneously, often neglecting improvement of dark respiration. Mainly due to lack of understanding of molecular mechanisms of dark breathing efficiency, and lack of high throughput effective measurement means for functional gene mining. Two stages. Most researchers aim at improving photosynthetic efficiency only for a specific link, so that the improvement of the overall photosynthetic efficiency is not great.
Disclosure of Invention
The invention aims to provide a protein for regulating and controlling dark respiration of plant leaves and application thereof.
In a first aspect of the invention there is provided the use of LRK1 or an upregulating molecule thereof for: (a) improving a trait of a plant, (b) preparing a formulation or composition that improves a trait of a plant, or (c) preparing a plant with improved traits; wherein the improved trait comprises: (i) increasing the dark respiration rate of plant leaves, (ii) promoting plant growth, (iii) increasing plant yield, plant height or tillering, or (iv) increasing plant high temperature tolerance; wherein the LRK1 includes homologs thereof.
In a preferred embodiment, the composition comprises an agricultural composition.
In another preferred embodiment, the elevated temperature is above 25 ℃, preferably above 28 ℃, more preferably above 30 ℃ (e.g. above 32 ℃,34 ℃,35 ℃,36 ℃,38 ℃,40 ℃).
In another preferred embodiment, the up-regulating molecule comprises: an up-regulating molecule that interacts with LRK1, thereby increasing its expression or activity; an expression cassette or expression construct (e.g., an expression vector) that overexpresses LRK 1; or a site-directed mutagenesis agent targeting the-242 base upstream (promoter region) of the LRK1 gene (corresponding to position 1760 of the nucleotide sequence (promoter) shown in SEQ ID NO: 3), to mutate it to A.
In another aspect of the invention there is provided a method of improving a trait in a plant or preparing a plant with improved traits comprising: increasing expression or activity of LRK1 in plants; wherein the improved trait comprises: (i) increasing the dark respiration rate of plant leaves, (ii) promoting plant growth, (iii) increasing plant yield, plant height or tillering, or (iv) increasing plant high temperature tolerance; wherein the LRK1 includes homologs thereof.
In a preferred embodiment, said increasing the expression or activity of LRK1 comprises: overexpression of LRK1 in plants; or targeting the-242 position of LRK1 promoter with mutation reagent, and mutating it into base A.
In another aspect of the present invention, there is provided a plant cell expressing an expression cassette of exogenous LRK1 or a homolog thereof; preferably, the expression cassette comprises: a promoter, a gene encoding LRK1 or a homologue thereof, a terminator; preferably, the expression cassette is comprised in a construct or expression vector.
In a preferred embodiment, said plant is selected from the group consisting of the following or said LRK1 or homologue thereof is from the group consisting of: gramineous plants such as rice (Oryza sativa), millet (Setaria sativa), green bristlegrass (Setaria virdis), paniculate halelii var. Halelii, millet (Panicum miliaceum), dichanthelium oligosanthes, corn (Zea mays), sorghum (Sorghum bicolor), teff (Eragrostis curvula), barley (Hordeum vulgare), brachypodium distach (Brachypodium distachyon), wheat (Triticum aestivum); crucifers, such as arabidopsis thaliana (Arabidopsis thaliana); pineapple family plants such as pineapple (Ananas comosus); orchids, such as dendrobium (Dendrobium catenatum);
Palmaceae plants such as date palm (Phoenix dactylifera), oil palm (Elaeis guineensis); nymphaeaceae plants, such as Nelumbo nucifera; papaveraceae plants such as Macleaya cordata; plants of the Myrtaceae family, such as Syzygium oleosum; rubiaceae plants, such as Coffea canephora; plants of the Solanaceae family, such as potato (Solanum tuberosum), tobacco (Nicotiana tabacum), tobacco (Nicotiana sylvestris), gapsinam chilense; a plant of the phoenix family, such as cocoa (Theobroma cacao); leguminous plants such as peanuts (Arachis hypogaea); or a plant of the family Zosteraceae, such as Zostera marina (Zostera marina).
In another preferred embodiment, the LRK1 includes a cDNA sequence, a genomic sequence, or a combination thereof.
In another preferred embodiment, the rice is selected from the group consisting of: indica rice and japonica rice.
In another preferred embodiment, the amino acid sequence of the polypeptide of LRK1 is selected from the group consisting of: (i) a polypeptide having the amino acid sequence shown in SEQ ID NO. 2; (ii) The polypeptide which is formed by substituting, deleting or adding one or a plurality of (such as 1-20, 1-10, 1-5 and 1-3) amino acid residues of the amino acid sequence shown as SEQ ID NO. 2 and has the regulatory character function and is derived from (i); (iii) A polypeptide having the regulatory trait function, wherein the amino acid sequence has homology of not less than 85% (preferably not less than 90%, more preferably not less than 95%, still more preferably not less than 98%) with the amino acid sequence shown in SEQ ID NO. 2; (iv) An active fragment of a polypeptide of the amino acid sequence shown in SEQ ID NO. 2; or (v) a polypeptide comprising a tag sequence added to the N-terminus or the C-terminus of the polypeptide having the amino acid sequence shown in SEQ ID NO. 2, or a signal peptide sequence added to the N-terminus thereof.
In another preferred embodiment, the nucleotide sequence encoding LRK1 is selected from the group consisting of: (a) a polynucleotide encoding a polypeptide as set forth in SEQ ID NO. 2; (b) Polynucleotides of sequence SEQ ID NO. 1 (LOC_Os03g51440.1) or SEQ ID NO. 4; (c) A polynucleotide having a nucleotide sequence having a homology of 90% or more (preferably 95% or more, more preferably 98% or 99% or more) with the sequence shown in SEQ ID NO. 1 or SEQ ID NO. 4; (d) A polynucleotide truncated or added with 1 to 60 (preferably 1 to 30, more preferably 1 to 10) nucleotides at the 5 'and/or 3' end of the polynucleotide shown in SEQ ID NO. 1 or SEQ ID NO. 4; (e) A polynucleotide complementary to the polynucleotide of any one of (a) - (d).
In another preferred embodiment, the nucleotide sequence of the LRK1 gene or its promoter is A at position-242.
In another preferred embodiment, the promoter of the LRK1 gene comprises the nucleotide sequence shown as SEQ ID NO. 3, or a functionally equivalent fragment thereof.
In another aspect of the present invention, there is provided the use of an LRK1 gene as a molecular marker for identifying traits in plants; the traits include: (i) the dark respiration rate of plant leaves, (ii) the rate of plant growth and development, (iii) plant yield, plant height, or tillering, or (iv) plant high temperature tolerance; wherein the LRK1 gene includes homologs thereof.
In a preferred embodiment, the trait of the identified plant is determined by analyzing the expression level of the LRK1 gene in the plant; if the expression level of the LRK1 gene in the plant to be detected is equal to or higher than the average expression level of the LRK1 gene in the plant, the plant to be detected: (i) normal or high dark respiration rate of plant leaves, (ii) normal or fast growth and development of plants, (iii) normal or high plant yield, plant height or tillering, or (iv) normal or high temperature tolerance of plants; if the expression level of the LRK1 gene in the plant to be detected is equal to or lower than the average expression level of the LRK1 gene of the plant, the character is not ideal.
In another aspect of the invention, there is provided a method of targeted selection of plants with improved traits, comprising: analyzing the expression level of LRK1 gene in the plant; if the expression level of the LRK1 gene in the plant to be detected is higher than the average expression level of the LRK1 gene in the plant, the plant to be detected: (i) high dark respiration rate of plant leaves, (ii) fast plant growth and development, (iii) high plant yield, plant height or tillering, or (iv) good high temperature tolerance of plants, which are plants with improved traits; wherein the LRK1 gene includes homologs thereof.
In a preferred embodiment, the expression level of the LRK1 gene is identified by identifying the type of the base at the-242 position upstream of the LRK1 gene, wherein the A base at the-242 position indicates that the expression level of the LRK1 gene is normal or high, and the T base at the-242 position indicates that the expression level of the LRK1 gene is lower than normal.
In another aspect of the present invention, there is provided a method for identifying the level of expression of LRK1 gene in a plant, comprising: identifying the type of the base at the position-242 upstream of the LRK1 gene, if the base at the position-242 is A, the expression level of the LRK1 gene is normal or high, and if the base at the position-242 is T, the expression level of the LRK1 gene is lower than the normal value.
In another aspect of the present invention, there is provided a method for identifying a indica or japonica variety of a gramineous rice, the method comprising: the test plant LRK1 gene was identified for bases-242, 709, 1479, 1806, and 2621, and if the base-242 is a, 709 is a, 1479 is a, 1806 is G, and 2621 is G, the probability of being indica rice is high (higher than 90%, preferably higher than 92% or 94%).
Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.
Drawings
FIGS. 1A-D, investigate night dark respiration rate (R) in a climatic chamber and Shanghai Field environment (Field) using the natural small core population of rice (Mini ore) d ) And performing association analysis by using SNPs covered by the whole genome after 2.3M filtration to obtain R d Is a manhattan diagram of (c).
FIGS. 2A-B, SNP peak analysis in indoor and field conditions.
FIG. 2C, candidate genes are determined based on SNP peak analysis results.
FIG. 2D, the expression differences of 12 candidate genes in extreme phenotype individual material were analyzed by qPCR to determine the genes of interest.
FIG. 3A, sequence analysis of LRK1 gene and its upstream gene, identifies significant association SNP sites, which can be divided into 2 haplotypes.
FIG. 3B, statistics of the number of haplotype 1 (HApI) rice material and haplotype 2 (HApII) rice material in a minicore population.
FIG. 3C shows classification of various rice varieties according to haplotype 1 (HApI) and haplotype 2 (HApII). ADM: admix-wire (indica-japonica hybrid); ARO: aromatic (japonica rice); AUS: aus (indica type rice); IND: indica (indica); TEJ: temperate japonica (japonica rice); TRJ: tropical japonica (japonica rice).
FIG. 4, protein sequences encoded by LRK1 genes are conserved in different species.
FIG. 5A is a sequencing diagram of rice material targeted to knock out LRK1 gene using CRISPR technology.
FIG. 5B, LRK is a schematic diagram of the gene structure and gRNA recognition site.
FIG. 5C, phenotype of the gene knockout material lrk1 compared to wild type material in a room temperature climatic chamber at 25 ℃.
FIG. 5D, room temperature climatic chamber at 25℃night dark respiration Rate R of Gene knockout Material lrk1 compared to wild type Material d Significantly reduced.
FIG. 6A shows a comparison of the annual average temperatures of the growth environments of rice haplotype 1 and haplotype 2.
FIG. 6B shows the detection of LRK1 gene expression in rice by short term differential temperature regulation.
FIG. 6C phenotype of mutant material lrk1 compared to wild type material in a 35℃climatic chamber.
FIG. 6D, night dark breath Rd of mutant material lrk1 compared to wild type material in a 35℃climatic chamber.
Detailed Description
The present inventors have conducted intensive studies and screening work to screen for a leucine rich repeat receptor kinase (LRK 1) gene encoding a receptor-like kinase (referred to as LRK1 protein) for the first time. Through whole genome association analysis, the present inventors found that LRK1 gene is a key gene controlling nocturnal dark breathing efficiency. When the expression of LRK1 gene is increased, the traits of plants can be significantly improved, including: (i) increasing the dark respiration rate of plant leaves, (ii) promoting plant growth, (iii) increasing plant yield, plant height or tillering, or (iv) increasing plant high temperature tolerance, etc. Therefore, the LRK1 gene can be used as a target for regulating plant traits and applied to plant breeding.
In the early research, the inventor uses a high-precision LICOR-6400XT gas exchange measuring system to measure a mini rice population in a large scale, and the population has the characteristics of moderate sample size, high genetic polymorphism, wide geographic origin and the like. The present inventors found the LRK1 gene by measuring night dark breathing efficiency of mini ore populations using whole genome association analysis. And proves that a SNP locus is located 242bp upstream of the LRK1 gene promoter and is highly correlated with the expression level of the LRK1 gene. The CRISPR knocked-down rice material of the LRK1 gene has obviously reduced bright and dark respiration rate, especially after high temperature stress, the plant growth is slow, the yield is reduced, the dark respiration is only 30% of that of the wild type, which suggests that the gene can be used as an important improvement target for influencing the dark respiration efficiency and the economic yield. The invention solves the problem that the dark respiration rate of the leaves can be regulated and controlled by over-expressing the LRK1 gene of the rice, thereby increasing the high temperature resistance and the economic yield so as to provide an improvement scheme for high light efficiency rice breeding.
As used herein, an "LRK1 protein (polypeptide)" may be a protein (polypeptide) having the amino acid sequence shown in SEQ ID NO. 2, and a gene encoding the same may have the nucleotide sequence shown in SEQ ID NO. 1, and also include homologs thereof.
The invention also includes fragments, derivatives and analogues of the LRK1 protein. As used herein, the terms "fragment," "derivative" and "analog" refer to polypeptides that retain substantially the same biological function or activity of the LRK1 proteins of the invention. The polypeptide fragment, derivative or analogue of the present invention may be (i) a polypeptide having one or more (e.g., 1-50, 1-40, 1-30, 1-20, 1-10, 1-5, 1-3, 1-2) conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a polypeptide having a substituent group in one or more (e.g., 1-50, 1-40, 1-30, 1-20, 1-10, 1-5, 1-3, 1-2) amino acid residues, or (iii) a polypeptide formed by fusion of an additional amino acid sequence to such polypeptide sequence (e.g., a leader sequence or secretory sequence or a sequence for purifying such polypeptide or a proprotein sequence, or fusion protein). Such fragments, derivatives and analogs are within the purview of one skilled in the art in view of the definitions herein.
Any biologically active fragment of LRK1 may be used in the present invention. By biologically active fragment of LRK1 is meant herein as a polypeptide which is still capable of retaining all or part of the function of full length LRK 1. Typically, the biologically active fragment retains at least 50% of the activity of full length LRK 1. Under more preferred conditions, the active fragment is capable of retaining 60%, 70%, 80%, 90%, 95%, 99%, or 100% of the activity of full-length LRK 1.
In the present invention, LRK1 also includes a variant of the sequence SEQ ID NO. 2, which has the same function as LRK 1. These variants include (but are not limited to): deletion, insertion and/or substitution of several (usually 1 to 50, preferably 1 to 30, more preferably 1 to 20, most preferably 1 to 10, still more preferably 1 to 8, 1 to 5) amino acids, and addition or deletion of one or several (usually 1 to 50, preferably 1 to 30, more preferably 1 to 20, most preferably 1 to 10, still more preferably 1 to 8, 1 to 5) amino acids at the C-terminus and/or the N-terminus (especially the N-terminus). For example, in the art, substitution with amino acids of similar or similar properties does not generally alter the function of the protein. As another example, the addition or deletion of one or more amino acids at the C-terminus and/or N-terminus (especially N-terminus) generally does not alter the function of the protein.
A variety of proteins having high homology to the LRK1 (such as 60% or more, 70% or more, 80% or more, preferably 85% or more, more preferably 90% or more homology to the sequence shown in SEQ ID NO:1, such as 95%,98% or 99%) and having the same function as LRK1 are also included in the present invention. "homology" refers to the level of similarity (i.e., sequence similarity or identity) between two or more nucleic acids or polypeptides in terms of percentage of positional identity. In this context, variants of the gene may be obtained by inserting or deleting regulatory regions, performing random or site-directed mutations, and the like.
The results of the tree analysis according to the present inventors for different species of LRK1 gene show that the protein sequences encoded by LRK1 gene are widely present in different species and highly conserved (fig. 4). Thus, it is to be understood that although LRK1 of the present application is preferably obtained from rice, other polypeptides or genes obtained from other plants (particularly plants belonging to the same family or genus as rice) that are highly homologous (e.g., have 80% or more, such as 85%, 90%, 95%, 98%, even 99% sequence identity) to LRK1 in rice are also within the contemplation of the present application, as long as the polypeptide or gene can be conveniently isolated from other plants by one of skill in the art after reading the information provided in accordance with the present application. These polypeptides or genes are also known as "homologs" of LRK 1. Methods and tools for aligning sequence identity are also well known in the art, such as BLAST.
The application also relates to polynucleotide sequences encoding LRK1 or a conservatively variant polypeptide thereof of the application. The polynucleotide may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand. The coding region sequence encoding the mature polypeptide may be identical to the coding region sequence set forth in SEQ ID NO. 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence that encodes a protein having SEQ ID NO. 2, but differs from the coding region sequence set forth in SEQ ID NO. 1. Due to the degeneracy of the codons, the amino acid sequence shown as SEQ ID NO. 2 can be essentially encoded even though the identity with the base sequence of SEQ ID NO. 1 is low.
Polynucleotides encoding the mature polypeptide of SEQ ID NO. 2 include: a coding sequence encoding only the mature polypeptide; a coding sequence for a mature polypeptide and various additional coding sequences; the coding sequence (and optionally additional coding sequences) of the mature polypeptide, and non-coding sequences.
The term "polynucleotide encoding a polypeptide" may include polynucleotides encoding the polypeptide, as well as polynucleotides further comprising additional coding and/or non-coding sequences.
The invention also relates to vectors comprising said polynucleotides, and host cells genetically engineered with said vectors or LRK1 coding sequences.
Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. The transformed plants may be transformed by Agrobacterium or gene gun transformation, for example, spraying, leaf disc, embryo transformation, etc.
As used herein, a "plant" is a plant in which LRK1 or a homolog thereof is present. Preferably, the "plant" includes (but is not limited to): gramineous plants such as rice (Oryza sativa), millet (Setaria sativa), green bristlegrass (Setaria virdis), paniculate halelii var. Halelii, millet (Panicum miliaceum), dichanthelium oligosanthes, corn (Zea mays), sorghum (Sorghum bicolor), teff (Eragrostis curvula), barley (Hordeum vulgare), brachypodium distach (Brachypodium distachyon), wheat (Triticum aestivum); crucifers, such as arabidopsis thaliana (Arabidopsis thaliana); pineapple family plants such as pineapple (Ananas comosus); orchids, such as dendrobium (Dendrobium catenatum); palmaceae plants such as date palm (Phoenix dactylifera), oil palm (Elaeis guineensis); nymphaeaceae plants, such as Nelumbo nucifera; papaveraceae plants such as Macleaya cordata; plants of the Myrtaceae family, such as Syzygium oleosum; rubiaceae plants, such as Coffea canephora; plants of the Solanaceae family, such as potato (Solanum tuberosum), tobacco (Nicotiana tabacum), tobacco (Nicotiana sylvestris), gapsinam chilense; a plant of the phoenix family, such as cocoa (Theobroma cacao); leguminous plants such as peanuts (Arachis hypogaea); or a plant of the family Zosteraceae, such as Zostera marina (Zostera marina).
The present invention provides a method of improving a plant comprising increasing expression of LRK1 in the plant. The improved plant comprises: (i) increasing the dark respiration rate of plant leaves, (ii) promoting plant growth, (iii) increasing plant yield, plant height or tillering, and/or (iv) increasing plant high temperature tolerance. After the function of the LRK1 is known, various methods well known to those skilled in the art can be used to increase the expression of the LRK 1. For example, an expression unit carrying the LRK1 gene (e.g., an expression vector or virus, etc.) can be delivered to a target site by means known to those skilled in the art and allowed to express the active LRK1 protein.
As a preferred mode of the present invention, there is provided a method for producing a transgenic plant comprising: (1) Transferring the exogenous LRK1 encoding polynucleotide into plant tissue, organ or tissue to obtain plant tissue, organ or seed of the LRK1 encoding polynucleotide; and (2) regenerating a plant from the plant tissue, organ or seed obtained in step (1) into which the polynucleotide encoding the foreign LRK1 has been transferred.
Other methods for increasing the expression of the LRK1 gene or a homologue thereof are well known in the art. For example, the expression of the LRK1 gene or its homologous gene can be enhanced by driving with a strong promoter. Or by enhancing the expression of the LRK1 gene by an enhancer (e.g., rice wax gene first intron, action gene first intron, etc.). Strong promoters suitable for use in the methods of the invention include, but are not limited to: 35s promoter, ubi promoter of rice and corn, etc.
The methods may be carried out using any suitable conventional means, including reagents, temperature, pressure conditions, and the like.
The inventors found that the upstream 242bp of the promoter region of the LRK1 gene contained one significant association SNP, and that the first exon of the gene contained 2 significant association SNPs, at 709bp and 1479bp, respectively, and the first and third introns contained 1 SNP, at 1806 and 2621bp, respectively. These significantly associated SNPs can be divided into 2 haplotypes, including haplotype 1 (-242T, 709G, 1479G, 1806 a, 2621 a), haplotype 2 (-242 a, 709 a, 1479 a, 1806G, 2621G). Meanwhile, most (about 94.2% or more) of the rice material in haplotype 2 belongs to the indica type.
Based on the above studies by the present inventors, it was found that, in a preferred embodiment, when the plant is rice, the probability of the rice belonging to indica or japonica rice can be determined by identifying a specific position, i.e., a base sequence corresponding to positions-242, 709, 1479, 1806, 2621 in the LRK1 sequence; if the plant is indica rice, the probability is high (such as the probability is higher than 90%,91%,92%,93% or 94%) if the plant is-242A, 709A, 1479A, 1806G, 2621G.
The analysis of nucleic acid sequences may be performed by those skilled in the art using any of a variety of techniques known in the art or being developed, and such techniques are intended to be encompassed by the present invention. Such methods include, for example, but are not limited to: sequencing, PCR amplification, probe, hybridization, restriction analysis, allelic polymorphism analysis (e.g., dissolution profile), etc. The skilled artisan can design primers to identify the molecular markers, if desired.
After extensive research and analysis, the present inventors have further found that the SNP site at positions from the LRK1 gene and its upstream promoter region to 242 is highly correlated with the expression level of the LRK1 gene, and that the gene expression of LRK1 is greatly improved when the base is A compared with other types of bases. According to the finding, on one hand, the LRK1 gene expression condition of the corresponding plant can be judged by targeting and measuring the base condition of the SNP locus, so that the character of the plant is judged; the traits include: (i) the dark respiration rate of plant leaves, (ii) the rate of plant growth and development, (iii) plant yield, plant height or tillering, or (iv) plant high temperature tolerance. On the other hand, when it is found that the SNP site at position-242 is not A, the base type of the SNP site can be changed by means of site-directed mutagenesis to increase the expression of the LRK1 gene of the plant, or the expression of the LRK1 gene can be driven by using the promoter in which the SNP site at position-242 is A in the form of recombinant expression, thereby improving the properties of the plant, including increasing the dark respiration rate of leaves and improving the resistance to high temperature, etc.
In addition, the invention also relates to a trace marker for the offspring of the plant transformed by using LRK1 or a coding gene thereof as a gene. The invention also relates to the identification of the plant's traits by detecting the expression of LRK1 in the plant using LRK1 or its encoding gene as a molecular marker. When evaluating plants to be tested, the expression amount or the mRNA amount of LRK1 can be measured to determine whether the expression amount or the mRNA amount in the plants to be tested is higher than the average value of the plants, and if the expression amount or the mRNA amount in the plants to be tested is remarkably high, the plants to be tested have improved properties (including improvement of the dark respiration rate of leaves, improvement of high temperature resistance and the like).
After the molecular mechanism of the present invention and the genes or proteins involved in the molecular mechanism are known, substances that can be used to improve plant traits can be screened based on this new discovery. Methods for screening for substances that act on a target protein or a specific region thereof are well known to those skilled in the art and can be used in the present invention. The candidate substance may be selected from: peptides, polymeric peptides, peptidomimetics, non-peptide compounds, carbohydrates, lipids, antibodies or antibody fragments, ligands, small organic molecules, small inorganic molecules, nucleic acid sequences, and the like. Depending on the kind of substance to be screened, it is clear to the person skilled in the art how to select a suitable screening method. The detection of the interaction between proteins can be performed by a variety of techniques known to those skilled in the art, such as GST sedimentation (GST-Pull Down), two-molecule fluorescent complementation assay, yeast two-hybrid system or co-immunoprecipitation technique.
The main advantages of the invention include:
(1) The invention firstly screens an LRK1 gene which codes a receptor-like kinase and can regulate the night dark respiration rate so as to influence the high temperature resistance. The method can increase the resistance to adverse conditions such as high temperature by improving the night dark breathing efficiency, increasing the maintenance breathing proportion and increasing the resistance to adverse conditions, and has an important effect on cultivating rice varieties in the context of high temperature increase corresponding to global climate change. Meanwhile, the regulation does not affect the growth and development of plants under normal conditions.
(2) The invention discovers for the first time that the R of rice can be obviously improved by mutating the T of 223 rd to 1914 th (preferably 242 th) positions of a promoter region of an LRK1 gene promoter region as shown in SEQ ID NO. 3 into A d 。
The invention will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedures, which do not address the specific conditions in the examples below, are generally carried out according to conventional conditions such as those described in J.Sam Brookfield et al, molecular cloning guidelines, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.
General method
1. Determination of night dark respiration of plant leaves
In whole genome association analysis, a small core natural population of mini rice is used as a material, and the population contains 198 rice lines or varieties (purchased from the U.S. department of agriculture germplasm resource pool, USDA-Genetic Stocks Oryza) and is derived from 97 countries worldwide. The experiment was developed in the artificial climate chamber of the institute of computing biology, academy of sciences of China, sown in the middle 5 th 2018, the population grown under potting conditions with 3 plants per pot, 2 pots per line, and 2 times per week watering. Photosynthetic and dark breath assays were started 60 days after sowing. The measurement time of dark breath at night is 2 to 5 hours in the morning. The room temperature of the artificial climate chamber is controlled at 27 ℃, the illumination intensity is maintained at about 600PPFD, and the humidity is maintained at 65%. In the measurement, 4 portable photosynthetic apparatuses (LICOR-6400 XT) were used simultaneously. The leaf chamber temperature is 25 ℃,the illumination intensity is first 0PPFD, CO 2 400ppm. To reduce the external environmental error, the flow rate of the leaf chamber gas is reduced to 300 mu mol min before measurement -1 . Data points are continuously recorded by an automated program. Each measurement takes 2 minutes and the entire measurement is completed within 3 days. Each line was at least 4 biological replicates.
In addition, as a verification test, the mini ore population was simultaneously planted under field conditions (Songjiang base of Shanghai plant physiological and ecological institute). 49 plants (7×7 plants) of each strain, and row spacing is controlled at 20cm×20cm. Normal field management and weeding specifications. After 60 days, the intermediate plants of each cell were transferred to a pot and placed in an indoor incubator overnight, and the dark respiration rate was measured.
2. Whole genome association analysis and candidate Gene screening
2.3M SNPs were obtained in total for whole genome association analysis (GWAS) through quality control and SNP filtration. GWAS is implemented by GEMAA software (Zhou and Stephens, 2012) and uses a hybrid linear model algorithm for correlation analysis. The linkage disequilibrium distance of the highest SNP peak (3 m 29440628) was calculated by 200 random samplings, followed by defining a significance threshold for the association analysis (P value=6), followed by GCTA open source software (Jian Yang, university of Kunsland, http:// cgenomics. Com/software/GCTA/index. Html). Both manhattan and QQ diagrams are completed by open source software R (R3.2.1 GUI 1.66Mavericks build).
To deeply mine candidate genes, an extreme phenotype R is selected d The 12 candidate genes near the highest SNP were measured for each of the 6 lines (Table 1).
Selecting rice leaves 5 weeks after emergence of seedlings, and preserving samples by liquid nitrogen. RNA extraction was performed using TRIzol Plus RNA purification kit (Yingshi Jieshiki Life technologies Co.) according to the standard procedure of the specification. The reverse transcription cDNA was carried out using SuperScript VILO cDNA reverse transcription kit (Ind. Jieski Life technologies Co.). 2ug of total RNA was used for reverse transcription of cDNA. Quantitative PCR was performed using SYBR Green PCR reaction system (applied biosystems, USA) and ABI quantitative PCR instrument (StepOneGlus). The amplification reaction procedure was: 95℃10s,55℃20s,72℃20s. The housekeeping gene is an action. Three biological replicates and three technical replicates. The sequences of the newly developed primers are shown in Table 2.
TABLE 2 primer sequence listing for quantitative PCR (qPCR)
Construction of CRISPR-CAS9 vector System
The codon optimized hSpCas9 was co-linked to pCAMBIA1300 binary vector (purchased from NTCC collection-Biovector plasmid vector species cytoprotein antibody Gene Collection) with the maize Ubiquitin promoter (UBI). The vector backbone contains a hygromycin selection marker (HPT).
The primer screening sequences are as follows:
F：TCCTCGACATCTCCGGCT(SEQ ID NO:29)；
R：AGCTGCCCCGAGAGTAGATT(SEQ ID NO:30)。
the sgRNA sequence (for exon 1, "C" at position 508 of the genomic sequence of LRK1 deleted) is (recognition of positions 503 to 525 in SEQ ID NO: 4):
5’-TCACCACTCTCAACCTCGCGGGG-3’(SEQ ID NO:31)。
to construct the complete CRISPR/Cas9 binary vector pBGK032, an additional OsU promoter was introduced, the selectable marker gene kanamycin, with the BsaI restriction site and the sgRNA sequence from pX 260. The specific sequence for recognizing the CDS region of the LRK1 gene is completed by artificial synthesis. Finally, 10ng of the digested pBGK032 vector was ligated with 0.05mM oligo-binder, 10. Mu.l of the reaction system. After sequencing to confirm that no base mutation occurs, the next operation is carried out, including escherichia coli expression plasmid, agrobacterium tumefaciens-mediated rice transformation and callus regeneration system.
4. Agrobacterium-mediated transgene and mutant detection
The constructed CRISPR/Cas9 was expressed by heat shock in agrobacterium tumefaciens strain EHA105 (purchased from NTCC collection of classical cultures-Biovector plasmid vector species cell protein antibody gene collection). The transformation receptor is generally selected from mature embryo induced callus of wild rice (Zhonghua 11) (purchased from Shanghai Guangming seed Co., ltd.) seed, the embryo is sheared off after increasing or decreasing the induction medium for 2 weeks, and the culture is continued for 1 week, so that the callus with vigorous growth is selected as the transformation receptor. The EHA105 strain containing the two plasmid vectors was used to infect rice callus by Agrobacterium-mediated genetic transformation (Hiei et al 1994), and after co-cultivation for 3 days in the dark at 25℃it was cultivated on screening medium containing 120mg/LG 418. Resistant calli were selected and cultured on pre-differentiation medium containing 120mg/L for about 10 days. The pre-differentiated calli were transferred to differentiation medium and cultured under light conditions. And obtaining the resistant transgenic plant about 1 month.
Lrk1 sequence information
LRK1CDS sequence (> LOC_Os03g51440.1; SEQ ID NO: 1):
atggaggaggaggagatgatgcgggctggtggttgttgttgtggtggtggtggggtctgggcgcggctactgctgctcgtggcggtggtggcggcgcccggggcggtggtggcgcagcaggggaacctcacgtcgcgggcggatctctcggggctctacgcgctgcgcggctcgctcgggctgcgcgcgcgggactggccgcgccgcgccgacccctgcacggcgtgggccggggtgcgctgcagcggcggccgcgtcgtgtcggtcgacctcgccgggctgcgccgcacgcggctggggcgcctggcgccgcggttcgccgtcgacgggctgcgcaacctcacgcggctcgaggccttcagcgcgcccgggttcggcctgccaggctcccttccggcgtggctcggcgcggggctcgcgcccaccttccagctcctcgacatctccggctgcgccgtcacgggggagatccccgcctcggccatcgccggcctcagcaacctcaccactctcaacctcgcggggaatctactctcggggcagctccctggcagtgctctcgccgggctcgctcggctcaagactctcaacctctctggcaatgccttctcaggcgagctacccaaggcggtctggtcgctcccggagctgagcgttctcgatgtgtctcggaccaacctcaccggcgcattgccggatacagggctcgcgcttccatccaatgtacaggtggtggatctgtccgggaacctcttctatggtggcgtgccgggatcctttggccaacttttcggtaggacgaagctggccaatatctctgggaattacttcgacggcaaactgggtgtatccaatggtgatggtgggaatttctcatttgagttgaattgcttcgttgatgtcactggacagcgtagccaggcagaatgtcagcagttctatgctgcacgtggtttgccgtataatgtttcaggtcctgcacccacaccgcagcctgcgatgccagcttcaccgggaaggaaaaaggggcacaagaatttgaagtatatactgattggagccatttgcggcggtgtcctcttggtagctgtgattgctgccattttgtattgcttggtgtgctctgggagtaggaggaatgggagtaggaatgatcagcgggaaagtggcgtgcggaacacacagttgggagcgtctggaactggtgggggtgcagttactgctggcacgcaaccttctgcatcgcctgcaaacttggcaaaggtcggtgattcattcggttatgaccagctcgtcgaagccaccacggactttggagatgataggcttatcaagcatggtcactcaggtgatctttaccttggggcgctccatgatgggacctctgtggttgtgaagaggataacttccagcatggctaagaaagatgcttatatggcggagctagatttatttgccaaaggattgcatgaaaggctggtgccgatcatggggcattgccttgataaagaggaggagaaatttctcgtgtatatatttgtccggaatggcgacttatcaagtgcactgcacagaaagtcaggggaggaagaggaaggcctgcaatctttggactggataaagaggctgaaaattgcaacaggagtggcagaggcactatgctatctccaccacgagtgtaatccaccaatggttcacagggacgtgcaagctagcagtattcttcttgatgataaatttgatgtgcgccttgggagtttgagcgaggtgtgtcctcaagaaggggaaggccaccaaaatgtcatcacaaagctgttgagattttcatcgactgcggatcaaggatcttctggttctccatctgcatcatgttcatatgatgtctattgctttggaaaagttttgttggagctggtgactggaaggctaggtatcagtgcatcaaatgatgctgcaacgaatgagtggcttgatcacactctgcgctacattaatatttatgagaaagagctcatgagcaagatcattgatccatcacttataattgatgaggaccatctggaggaagtctgggcaatggcaattgttgcaaagtcctgcttgaatcctaggtcttctaaacggccgccgatgaaatatattctaaaagcactagagaatccgttgaaggtggtgagggaagataacggcggctctagctcagcccgtttgagagccacgtcatcacggggatcatggaatgctgcattcttcgggagttggcggcatagctcgtctgatataggtccttcaagggatgacaacttgttgaaacgctcagagacgatcaaatcatccggagggagcaatggtgaccattcttcctcccgcaggaggcaatcgaaggagatcttccctgagccatctggttcacgtgacaccgaggattaa
LRK1 protein sequence (> loc_os03g51440.1, SEQ ID NO: 2):
MEEEEMMRAGGCCCGGGGVWARLLLLVAVVAAPGAVVAQQGNLTSRADLSGLYALRGSLGLRARDWPRRADPCTAWAGVRCSGGRVVSVDLAGLRRTRLGRLAPRFAVDGLRNLTRLEAFSAPGFGLPGSLPAWLGAGLAPTFQLLDISGCAVTGEIPASAIAGLSNLTTLNLAGNLLSGQLPGSALAGLARLKTLNLSGNAFSGELPKAVWSLPELSVLDVSRTNLTGALPDTGLALPSNVQVVDLSGNLFYGGVPGSFGQLFGRTKLANISGNYFDGKLGVSNGDGGNFSFELNCFVDVTGQRSQAECQQFYAARGLPYNVSGPAPTPQPAMPASPGRKKGHKNLKYILIGAICGGVLLVAVIAAILYCLVCSGSRRNGSRNDQRESGVRNTQLGASGTGGGAVTAGTQPSASPANLAKVGDSFGYDQLVEATTDFGDDRLIKHGHSGDLYLGALHDGTSVVVKRITSSMAKKDAYMAELDLFAKGLHERLVPIMGHCLDKEEEKFLVYIFVRNGDLSSALHRKSGEEEEGLQSLDWIKRLKIATGVAEALCYLHHECNPPMVHRDVQASSILLDDKFDVRLGSLSEVCPQEGEGHQNVITKLLRFSSTADQGSSGSPSASCSYDVYCFGKVLLELVTGRLGISASNDAATNEWLDHTLRYINIYEKELMSKIIDPSLIIDEDHLEEVWAMAIVAKSCLNPRSSKRPPMKYILKALENPLKVVREDNGGSSSARLRATSSRGSWNAAFFGSWRHSSSDIGPSRDDNLLKRSETIKSSGGSNGDHSSSRRRQSKEIFPEPSGSRDTED*
LRK1 promoter region sequence (> Chr3:29432451..29430451,SEQ ID NO:3)
ggaacagcaccgagaggaatcatgaggattggtaatacaaggaaacatattgacagacatgccatgcatgaaacattgctaacagaatggactacggttcggtggatgggaatgggatacgcctccaccccgccgcggcgccggcgtccgaacgaacgaacgaacgaacgtgacgtgaagggtattgcgttgcgctgcgcctcgcctcgccttgtgcggttttgcgacgccggccgccgcctgtggtggtgggctcgcgcgacgtgccgcgctctcttctgttcgtttttattacctgacgcgtccgacctgggatccacccgtcgcgatggctccaccgcgtagtagtagtagtggcttgtccagtggccaccacaaactagacctgtcattactcattactgccgtgtcaaagccagccgggaaaagaagaaaaaaaagaaggaaaaatcaatggatgctatgaaacgcttgcgggtacagcagcagccaatgcattttgcaattcttctacaacatctcattcccagtccggcaaacctgcagggtgcaaatccagtaatacatcaattccatccgtttaaaaggagaaatcctacattcaatgctcacgtgctagctagcatgaggctggctgcctggctgtggttaattgacactacccctgcacgtaaacaactgtagaaacgaactgtcgtattttcgcctcctaaatgctgccgcccatcaaatgctcgtatcatatcatatcatatctatttagcccgttataatgtcctcccaaaataaagaaaaatatctctacgtgcacagcacacaacataaatctaacattgctctggattacaacacagattatacatccgactttcactcttatctgaagcacaaagaaaaaaagaaaattcaaaaatgaatcagaatcgacatctacgatggttagtggtgtatgaaactgacatagataaagattaaattggtgtttgaataattaagttttaattattataaacttgataaataaatatatttaatattttaaaataaattttacatagaaagttttttttacgaaatacactatttaataatttaaaaagcatgtcaacgaaaatcacgtaaaatctgaatttcaacccacccaaagataacgcgcacgacgcccgcgcccacggccctcgttgacccgcccgaaaaaccccaccaaaccccccctcctcgcaaccggccgtacgtgcagccaccacgcaccgaaccaaacccgccgcgagagcgagacccacccaccacgcgcggccgggttcactcaccctcaccctctcagtggcagccgccggcaattgagccccgcgcaccaggggcagcgccgtcaaaacgcaacgcagccagggagaaaaggcaagttgtgagtgagcgagccagccagtgcacagggaaatcggggaaatcgtcggggaaatcgcatgccatttcagcccggaagatttgatttcaaaaaaaacatttaacagcttccttaaacaaccgaaaccccccacgatatcagctctctctctctccctcctcccatctcctcgtcttcctcctcctgacctcctcgtcgtcgtcgtctctcttcgccggctccggcggcggcggctgctcgcacccggtggcgtgaccgcggcggcggtggagtggagtggaatttgggttcggatcggcggagagaggaggaggagagggggtaataattgggaggcagttgggggagtgtaactttgggcattgatggcggggtagagaaggtgagcccccaaggaggagggtggtggtggtggtggcttctgtacctgcgaccctgcgttgctctgcgcccctctcctttattgcgtttaatttccctcccaattccgtctctccgctgcctgcctggcttctccgcgattccatccatagtttggagtggggaggaatggggagtggcggcggcggcggaggtggtggtggtggtggtggtgg
LRK1 gene sequence (containing introns) (> Chr3:29430451..29426346,SEQ ID NO:4): atggaggaggaggagatgatgcgggctggtggttgttgttgtggtggtggtggggtctgggcgcggctactgctgctcgtggcggtggtggcggcgcccggggcggtggtggcgcagcaggggaacctcacgtcgcgggcggatctctcggggctctacgcgctgcgcggctcgctcgggctgcgcgcgcgggactggccgcgccgcgccgacccctgcacggcgtgggccggggtgcgctgcagcggcggccgcgtcgtgtcggtcgacctcgccgggctgcgccgcacgcggctggggcgcctggcgccgcggttcgccgtcgacgggctgcgcaacctcacgcggctcgaggccttcagcgcgcccgggttcggcctgccaggctcccttccggcgtggctcggcgcggggctcgcgcccaccttccagctcctcgacatctccggctgcgccgtcacgggggagatccccgcctcggccatcgccggcctcagcaacctcaccactctcaacctcgcggggaatctactctcggggcagctccctggcagtgctctcgccgggctcgctcggctcaagactctcaacctctctggcaatgccttctcaggcgagctacccaaggcggtctggtcgctcccggagctgagcgttctcgatgtgtctcggaccaacctcaccggcgcattgccggatacagggctcgcgcttccatccaatgtacaggtggtggatctgtccgggaacctcttctatggtggcgtgccgggatcctttggccaacttttcggtaggacgaagctggccaatatctctgggaattacttcgacggcaaactgggtgtatccaatggtgatggtgggaatttctcatttgagttgaattgcttcgttgatgtcactggacagcgtagccaggcagaatgtcagcagttctatgctgcacgtggtttgccgtataatgtttcaggtcctgcacccacaccgcagcctgcgatgccagcttcaccgggaaggaaaaaggggcacaagaatttgaagtatatactgattggagccatttgcggcggtgtcctcttggtagctgtgattgctgccattttgtattgcttggtgtgctctgggagtaggaggaatgggagtaggaatgatcagcgggaaagtggcgtgcggaacacacagttgggagcgtctggaactggtgggggtgcagttactgctggcacgcaaccttctgcatcgcctgcaaacttggcaaaggtcggtgattcattcggttatgaccagctcgtcgaagccaccacggactttggagatgataggcttatcaagcatggtcactcaggtgatctttaccttggggcgctccatgatgggacctctgtggttgtgaagaggataacttccagcatggctaagaaagatgcttatatggcggagctagatttatttgccaaaggattgcatgaaaggctggtgccgatcatggggcattgccttgataaagaggaggagaaatttctcgtgtatatatttgtccggaatggcgacttatcaagtgcactgcacagaaagtcaggggaggaagaggaaggcctgcaatctttggactggataaagaggctgaaaattgcaacaggagtggcagaggcactatgctatctccaccacgagtgtaatccaccaatggttcacaggtataaacttctttgtatttacatgaatacaaaatttatttcagttggatgtttgcttttcgggtataaacttctttgtatttatgtgaatgaaaaaattatttcagttggaatgctctggccacatatttaatgaatttggatattgctgaattactgctgtgtactaattatacgatccatagcttacttaaaccgaaaaaaatcagaatatgaacagcactgttttttgtttatccacctcgcgggaaatggagggcggttatgtagcattgttttttattggacgttgcaattctgatgagttggcatgctatgttcaggtatacttgctagatcctccatcttatatataggcacttctttattatcatgctattttatagtcaagttaaatctgaatatgtgtgatcaccttgtccgtaattcagttggtccaaatatccttttatgtgactttcaatgagatgtttctatgcactatattactaccaactagacaatgttaaagatttgagcacccctcctgatatcatgcaaatgcatcagaagttctttgttggcttcatttcgctaggaaagcattgttttggtattaaagtgaaacatgcagtaaaccatgtgagtaatcttggttgttgaactaatgagatcatgatctgccacagggacgtgcaagctagcagtattcttcttgatgataaatttgatgtgcgccttgggagtttgagcgaggtgtgtcctcaagaaggggaaggccaccaaaatgtcatcacaaagctgttgagattttcatcgtaagttttaacttttagcactgcatactctgtttcttagctctacgtgtaagactcgaatatccataaaatgcttgattgcacttcgctgttcagttcatcatgcctattcattttgctaacatttgaattaaacttgtgctttgagttccgaatatatattagtcaattatactatattatccttcctctcccatgtattgagggtgcagctaagcaaattccaaattggtttctatatgcacaggacaaaaatagtgctagtaggcccgttggtagcgaaagtaattggaaactttctcctagcatttcagatcctgatatggctcatgttctgctgccagtttattttatgtaatttctttttgctgcactgaatgaaattcgtctcattttctaatgttgtgttgttttctgggaaatgtaggactgcggatcaaggatcttctggtaagtccatgcatccatgcttgctttcatttctttcaagtgttagctgcctaatgtttgaaactgatgatgacactgttaaattgtgttgtataactgtatctatagatgttttaggttcatggatgcaagtgcattgacaaacctctaatttaaccaggttctccatctgcatcatgttcatatgatgtctattgctttggaaaagttttgttggagctggtgactggaaggctaggtatcagtgcatcaaatgatgctgcaacgaatgagtggcttgatcacactctgcgctacattaatatttatgagaaagagctcatgagcaagatcattgatccatcacttataattgatgaggaccatctggaggaagtctgggcaatggcaattgttgcaaagtcctgcttgaatcctaggtcttctaaacggccgccgatgaaatatattctaaaagcactagagaatccgttgaaggtggtgagggaagataacggcggctctagctcagcccgtttgagagccacgtcatcacggggatcatggaatgctgcattcttcgggagttggcggcatagctcgtctgatataggtccttcaagggatgacaacttgttgaaacgctcagagacgatcaaatcatccggagggagcaatggtgaccattcttcctcccgcaggaggcaatcgaaggagatcttccctgagccatctggttcacgtgacaccgaggattaaggagctttcttttgtcttgtgacccttttagtgcaaagagaagtccatgaagggtggcagctgtcgaagcgctgctgctaccttgtgattgaattctttcagctgacagatcgaagcgtgaatttcctgcatgtcattgacttcacaggcagcatactggcatcaggggtaccatttttcggggtggactgggaagcgatcgtatagtggattagtggttggtgcccaatgcatgatctggacaaatggcttggcaatgttgttatttttctttcccctcttgattaaaaagaaagaatggcgagctgattctttttcttcttccctactgtaattgattgtttcattgttgatcatagcagaaatgttcgttccattcacgcctggcagtgcctggtttctgtgctgcttttcagaatc
Example 1, stomatal switch phenotype Whole genome association analysis (GWAS) and Gene preliminary screening
The present inventors investigated the night dark respiration rate (R) at 2 sites (artificial climate chamber (GR) and Shanghai Field environment (Field)) by years of multiple experiments using 217 copies of the natural small core population (mini ore) of rice from 97 countries worldwide d ) And performing association analysis by using SNPs covered by the whole genome after 2.3M filtration to obtain R d Is shown in fig. 1A and 1B.
The highest SNP peak (3 m 29440628) located on chromosome III at P-value of 2.5E-08 (FIG. 2A-B) in indoor and field conditions. The linkage disequilibrium distance (ld=50kb) of the highest SNP peak was calculated using GCTA software. Around 50KB upstream and downstream of this peak, a total of 12 candidate genes were found (fig. 2C). Select the extreme R d The level of phenotype was 6 material-wise, and the difference in expression of 12 candidate genes in individual material with extreme phenotype was analyzed by qPCR (table 1). From these candidate genes obtained, the present inventors screened for LRK1 gene (pair-wise t-test P value=0.0003).
Example 2, phylogenetic tree analysis of different species of LRK1 genes
By NCBI protein sequence alignment, the protein sequences encoded by the LRK1 gene were found to be widely present in different species and highly conserved (fig. 4). The similarity to the LRK1 gene in arabidopsis is highest (98%), while the similarity to other major food crops including corn, sorghum is slightly lower, but still in the same subpopulation.
EXAMPLE 3 haplotype analysis of LRK1 Gene
The present invention found that the upstream 242bp of the promoter region of the LRK1 gene contained one significant association SNP, and that the first exon of the gene contained 2 significant association SNPs, at 709bp and 1479bp, respectively, and the second and fourth exons contained 1 SNP, at 1806 and 2621bp, respectively (FIG. 3A). These significantly associated SNPs can be divided into 2 haplotypes. In the minicore population, haplotype 1 (HApI) contained 171 rice materials and haplotype 2 (HApII) contained 35 rice materials (fig. 3B). Most (94.2%) of the rice material in haplotype 2 was of the indica type, while haplotype 1 contained a different rice sub-population type (FIG. 3C).
Example 4 functional verification of candidate Gene
The invention uses CRISPR technique to knock out the 1 st exon of LRK1 gene, the 509 th (SEQ ID NO:4 509 th) C deletion on the genomic sequence position of LRK 1; that is, the 171 th (SEQ ID NO: 2. Sup. 171 th) amino acid mutation and 180 th termination code were caused, and thus were designated as lrk1 (FIGS. 5A-B).
The phenotype of the knocked-out material under normal conditions (room temperature climatic chamber at 25 ℃) is not greatly different from that of the wild type (middle flower 11, which belongs to haplotype 1) (FIG. 5C); but dark breathing rate at night R d A significant decrease (fig. 5D) indicated that there was a direct link between LRK1 gene and nocturnal dark respiration rate.
Example 5 evaluation of high temperature resistance of LRK1 Gene Rice mutant
To demonstrate the ability of the LRK1 gene to respond to changes in dark breathing at night and high temperatures, the inventors first compared 2 haplotypes to the original geographical climate of origin (annual average temperature) of the minicore population, and found that the growing environment described for 35 rice materials in haplotype 2 had a significantly higher annual average temperature relative to haplotype 1 (fig. 6A). Further analysis by the present inventors suggested that position-242 plays a critical role for A in haplotype 2. The transformation of T at position-242 into A can greatly up-regulate the gene expression of LRK 1.
The inventor detects the expression of LRK1 gene in rice through short-term different temperature regulation, and discovers that the expression level of LRK1 gene is obviously stimulated by temperature and is up-regulated along with the rising of the temperature(FIG. 6B). After 20 days of high temperature treatment in a 35 ℃ artificial climate chamber (additionally provided with a heat-relieving device), the mutant material lrk1 has slow growth and development speed, yield, plant height and tillering number reduction (figure 6C) and simultaneously has dark breathing R at night d The reduced performance was more pronounced (fig. 6D), only about 30% of the wild type (middle flower 11), demonstrating that the LRK1 gene is involved in the molecular regulation of the temperature response. Whereas wild type plants with LRK1 gene expression higher than mutant material LRK1 breathe darkly at night d And the high temperature tolerance is more ideal than that of the lrk1, and the growth and development speed, the yield, the plant height and the tillering number are more ideal than that of the mutant material lrk 1.
EXAMPLE 6 overexpression of LRK1 Gene to increase leaf dark respiration Rate and high temperature tolerance
Establishment of LRK1 gene overexpression plants: and (3) taking pCAMBIA1301 as an over-expression vector, inserting a CDS sequence of the LRK1 gene into a multiple cloning site of the pCAMBIA1301, and constructing a recombinant plasmid for driving the over-expression of the LRK1 gene by 35S. The plasmid carries GFP tag protein and hygromycin resistance gene for later screening and protein purification. The rice is transformed by an agrobacterium method, so that the expression of LRK1 in an over-expression plant is increased, the night dark respiration efficiency is obviously improved, and the high temperature tolerance is improved.
EXAMPLE 7 modification of LRK1 promoter region sequence alone to improve leaf dark breathing efficiency and high temperature resistance
pCAMBIA1301 is used as an over-expression vector, 2 types of promoters (SEQ ID NO: 3) (carrying different SNPs at 242bp upstream) are respectively connected with an LRK1 gene (LRK 1CDS sequence (SEQ ID NO: 1)) and inserted into the expression vector, and a recombinant plasmid for driving the over-expression of the LRK1 gene by using the LRK1 gene promoters is established.
Transgenic plants were prepared against the mutant material lrk1 as background and the dark respiration rates of transgenic progeny materials were compared. The result suggests that the promoter with the site A at the-242 can obviously up-regulate the gene expression of LRK1, thereby improving the dark respiration rate of transgenic offspring materials.
All documents mentioned in this disclosure are incorporated by reference in this disclosure as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the application as defined in the appended claims.
Sequence listing
<110> molecular plant science Excellent innovation center of China academy of sciences
<120> protein for regulating and controlling dark respiration of plant leaves and application thereof
<130> 202259
<160> 31
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2430
<212> DNA
<213> Rice (Oryza sativa L)
<400> 1
atggaggagg aggagatgat gcgggctggt ggttgttgtt gtggtggtgg tggggtctgg 60
gcgcggctac tgctgctcgt ggcggtggtg gcggcgcccg gggcggtggt ggcgcagcag 120
gggaacctca cgtcgcgggc ggatctctcg gggctctacg cgctgcgcgg ctcgctcggg 180
ctgcgcgcgc gggactggcc gcgccgcgcc gacccctgca cggcgtgggc cggggtgcgc 240
tgcagcggcg gccgcgtcgt gtcggtcgac ctcgccgggc tgcgccgcac gcggctgggg 300
cgcctggcgc cgcggttcgc cgtcgacggg ctgcgcaacc tcacgcggct cgaggccttc 360
agcgcgcccg ggttcggcct gccaggctcc cttccggcgt ggctcggcgc ggggctcgcg 420
cccaccttcc agctcctcga catctccggc tgcgccgtca cgggggagat ccccgcctcg 480
gccatcgccg gcctcagcaa cctcaccact ctcaacctcg cggggaatct actctcgggg 540
cagctccctg gcagtgctct cgccgggctc gctcggctca agactctcaa cctctctggc 600
aatgccttct caggcgagct acccaaggcg gtctggtcgc tcccggagct gagcgttctc 660
gatgtgtctc ggaccaacct caccggcgca ttgccggata cagggctcgc gcttccatcc 720
aatgtacagg tggtggatct gtccgggaac ctcttctatg gtggcgtgcc gggatccttt 780
ggccaacttt tcggtaggac gaagctggcc aatatctctg ggaattactt cgacggcaaa 840
ctgggtgtat ccaatggtga tggtgggaat ttctcatttg agttgaattg cttcgttgat 900
gtcactggac agcgtagcca ggcagaatgt cagcagttct atgctgcacg tggtttgccg 960
tataatgttt caggtcctgc acccacaccg cagcctgcga tgccagcttc accgggaagg 1020
aaaaaggggc acaagaattt gaagtatata ctgattggag ccatttgcgg cggtgtcctc 1080
ttggtagctg tgattgctgc cattttgtat tgcttggtgt gctctgggag taggaggaat 1140
gggagtagga atgatcagcg ggaaagtggc gtgcggaaca cacagttggg agcgtctgga 1200
actggtgggg gtgcagttac tgctggcacg caaccttctg catcgcctgc aaacttggca 1260
aaggtcggtg attcattcgg ttatgaccag ctcgtcgaag ccaccacgga ctttggagat 1320
gataggctta tcaagcatgg tcactcaggt gatctttacc ttggggcgct ccatgatggg 1380
acctctgtgg ttgtgaagag gataacttcc agcatggcta agaaagatgc ttatatggcg 1440
gagctagatt tatttgccaa aggattgcat gaaaggctgg tgccgatcat ggggcattgc 1500
cttgataaag aggaggagaa atttctcgtg tatatatttg tccggaatgg cgacttatca 1560
agtgcactgc acagaaagtc aggggaggaa gaggaaggcc tgcaatcttt ggactggata 1620
aagaggctga aaattgcaac aggagtggca gaggcactat gctatctcca ccacgagtgt 1680
aatccaccaa tggttcacag ggacgtgcaa gctagcagta ttcttcttga tgataaattt 1740
gatgtgcgcc ttgggagttt gagcgaggtg tgtcctcaag aaggggaagg ccaccaaaat 1800
gtcatcacaa agctgttgag attttcatcg actgcggatc aaggatcttc tggttctcca 1860
tctgcatcat gttcatatga tgtctattgc tttggaaaag ttttgttgga gctggtgact 1920
ggaaggctag gtatcagtgc atcaaatgat gctgcaacga atgagtggct tgatcacact 1980
ctgcgctaca ttaatattta tgagaaagag ctcatgagca agatcattga tccatcactt 2040
ataattgatg aggaccatct ggaggaagtc tgggcaatgg caattgttgc aaagtcctgc 2100
ttgaatccta ggtcttctaa acggccgccg atgaaatata ttctaaaagc actagagaat 2160
ccgttgaagg tggtgaggga agataacggc ggctctagct cagcccgttt gagagccacg 2220
tcatcacggg gatcatggaa tgctgcattc ttcgggagtt ggcggcatag ctcgtctgat 2280
ataggtcctt caagggatga caacttgttg aaacgctcag agacgatcaa atcatccgga 2340
gggagcaatg gtgaccattc ttcctcccgc aggaggcaat cgaaggagat cttccctgag 2400
ccatctggtt cacgtgacac cgaggattaa 2430
<210> 2
<211> 809
<212> PRT
<213> Rice (Oryza sativa L)
<400> 2
Met Glu Glu Glu Glu Met Met Arg Ala Gly Gly Cys Cys Cys Gly Gly
1 5 10 15
Gly Gly Val Trp Ala Arg Leu Leu Leu Leu Val Ala Val Val Ala Ala
20 25 30
Pro Gly Ala Val Val Ala Gln Gln Gly Asn Leu Thr Ser Arg Ala Asp
35 40 45
Leu Ser Gly Leu Tyr Ala Leu Arg Gly Ser Leu Gly Leu Arg Ala Arg
50 55 60
Asp Trp Pro Arg Arg Ala Asp Pro Cys Thr Ala Trp Ala Gly Val Arg
65 70 75 80
Cys Ser Gly Gly Arg Val Val Ser Val Asp Leu Ala Gly Leu Arg Arg
85 90 95
Thr Arg Leu Gly Arg Leu Ala Pro Arg Phe Ala Val Asp Gly Leu Arg
100 105 110
Asn Leu Thr Arg Leu Glu Ala Phe Ser Ala Pro Gly Phe Gly Leu Pro
115 120 125
Gly Ser Leu Pro Ala Trp Leu Gly Ala Gly Leu Ala Pro Thr Phe Gln
130 135 140
Leu Leu Asp Ile Ser Gly Cys Ala Val Thr Gly Glu Ile Pro Ala Ser
145 150 155 160
Ala Ile Ala Gly Leu Ser Asn Leu Thr Thr Leu Asn Leu Ala Gly Asn
165 170 175
Leu Leu Ser Gly Gln Leu Pro Gly Ser Ala Leu Ala Gly Leu Ala Arg
180 185 190
Leu Lys Thr Leu Asn Leu Ser Gly Asn Ala Phe Ser Gly Glu Leu Pro
195 200 205
Lys Ala Val Trp Ser Leu Pro Glu Leu Ser Val Leu Asp Val Ser Arg
210 215 220
Thr Asn Leu Thr Gly Ala Leu Pro Asp Thr Gly Leu Ala Leu Pro Ser
225 230 235 240
Asn Val Gln Val Val Asp Leu Ser Gly Asn Leu Phe Tyr Gly Gly Val
245 250 255
Pro Gly Ser Phe Gly Gln Leu Phe Gly Arg Thr Lys Leu Ala Asn Ile
260 265 270
Ser Gly Asn Tyr Phe Asp Gly Lys Leu Gly Val Ser Asn Gly Asp Gly
275 280 285
Gly Asn Phe Ser Phe Glu Leu Asn Cys Phe Val Asp Val Thr Gly Gln
290 295 300
Arg Ser Gln Ala Glu Cys Gln Gln Phe Tyr Ala Ala Arg Gly Leu Pro
305 310 315 320
Tyr Asn Val Ser Gly Pro Ala Pro Thr Pro Gln Pro Ala Met Pro Ala
325 330 335
Ser Pro Gly Arg Lys Lys Gly His Lys Asn Leu Lys Tyr Ile Leu Ile
340 345 350
Gly Ala Ile Cys Gly Gly Val Leu Leu Val Ala Val Ile Ala Ala Ile
355 360 365
Leu Tyr Cys Leu Val Cys Ser Gly Ser Arg Arg Asn Gly Ser Arg Asn
370 375 380
Asp Gln Arg Glu Ser Gly Val Arg Asn Thr Gln Leu Gly Ala Ser Gly
385 390 395 400
Thr Gly Gly Gly Ala Val Thr Ala Gly Thr Gln Pro Ser Ala Ser Pro
405 410 415
Ala Asn Leu Ala Lys Val Gly Asp Ser Phe Gly Tyr Asp Gln Leu Val
420 425 430
Glu Ala Thr Thr Asp Phe Gly Asp Asp Arg Leu Ile Lys His Gly His
435 440 445
Ser Gly Asp Leu Tyr Leu Gly Ala Leu His Asp Gly Thr Ser Val Val
450 455 460
Val Lys Arg Ile Thr Ser Ser Met Ala Lys Lys Asp Ala Tyr Met Ala
465 470 475 480
Glu Leu Asp Leu Phe Ala Lys Gly Leu His Glu Arg Leu Val Pro Ile
485 490 495
Met Gly His Cys Leu Asp Lys Glu Glu Glu Lys Phe Leu Val Tyr Ile
500 505 510
Phe Val Arg Asn Gly Asp Leu Ser Ser Ala Leu His Arg Lys Ser Gly
515 520 525
Glu Glu Glu Glu Gly Leu Gln Ser Leu Asp Trp Ile Lys Arg Leu Lys
530 535 540
Ile Ala Thr Gly Val Ala Glu Ala Leu Cys Tyr Leu His His Glu Cys
545 550 555 560
Asn Pro Pro Met Val His Arg Asp Val Gln Ala Ser Ser Ile Leu Leu
565 570 575
Asp Asp Lys Phe Asp Val Arg Leu Gly Ser Leu Ser Glu Val Cys Pro
580 585 590
Gln Glu Gly Glu Gly His Gln Asn Val Ile Thr Lys Leu Leu Arg Phe
595 600 605
Ser Ser Thr Ala Asp Gln Gly Ser Ser Gly Ser Pro Ser Ala Ser Cys
610 615 620
Ser Tyr Asp Val Tyr Cys Phe Gly Lys Val Leu Leu Glu Leu Val Thr
625 630 635 640
Gly Arg Leu Gly Ile Ser Ala Ser Asn Asp Ala Ala Thr Asn Glu Trp
645 650 655
Leu Asp His Thr Leu Arg Tyr Ile Asn Ile Tyr Glu Lys Glu Leu Met
660 665 670
Ser Lys Ile Ile Asp Pro Ser Leu Ile Ile Asp Glu Asp His Leu Glu
675 680 685
Glu Val Trp Ala Met Ala Ile Val Ala Lys Ser Cys Leu Asn Pro Arg
690 695 700
Ser Ser Lys Arg Pro Pro Met Lys Tyr Ile Leu Lys Ala Leu Glu Asn
705 710 715 720
Pro Leu Lys Val Val Arg Glu Asp Asn Gly Gly Ser Ser Ser Ala Arg
725 730 735
Leu Arg Ala Thr Ser Ser Arg Gly Ser Trp Asn Ala Ala Phe Phe Gly
740 745 750
Ser Trp Arg His Ser Ser Ser Asp Ile Gly Pro Ser Arg Asp Asp Asn
755 760 765
Leu Leu Lys Arg Ser Glu Thr Ile Lys Ser Ser Gly Gly Ser Asn Gly
770 775 780
Asp His Ser Ser Ser Arg Arg Arg Gln Ser Lys Glu Ile Phe Pro Glu
785 790 795 800
Pro Ser Gly Ser Arg Asp Thr Glu Asp
805
<210> 3
<211> 2001
<212> DNA
<213> Rice (Oryza sativa L)
<400> 3
ggaacagcac cgagaggaat catgaggatt ggtaatacaa ggaaacatat tgacagacat 60
gccatgcatg aaacattgct aacagaatgg actacggttc ggtggatggg aatgggatac 120
gcctccaccc cgccgcggcg ccggcgtccg aacgaacgaa cgaacgaacg tgacgtgaag 180
ggtattgcgt tgcgctgcgc ctcgcctcgc cttgtgcggt tttgcgacgc cggccgccgc 240
ctgtggtggt gggctcgcgc gacgtgccgc gctctcttct gttcgttttt attacctgac 300
gcgtccgacc tgggatccac ccgtcgcgat ggctccaccg cgtagtagta gtagtggctt 360
gtccagtggc caccacaaac tagacctgtc attactcatt actgccgtgt caaagccagc 420
cgggaaaaga agaaaaaaaa gaaggaaaaa tcaatggatg ctatgaaacg cttgcgggta 480
cagcagcagc caatgcattt tgcaattctt ctacaacatc tcattcccag tccggcaaac 540
ctgcagggtg caaatccagt aatacatcaa ttccatccgt ttaaaaggag aaatcctaca 600
ttcaatgctc acgtgctagc tagcatgagg ctggctgcct ggctgtggtt aattgacact 660
acccctgcac gtaaacaact gtagaaacga actgtcgtat tttcgcctcc taaatgctgc 720
cgcccatcaa atgctcgtat catatcatat catatctatt tagcccgtta taatgtcctc 780
ccaaaataaa gaaaaatatc tctacgtgca cagcacacaa cataaatcta acattgctct 840
ggattacaac acagattata catccgactt tcactcttat ctgaagcaca aagaaaaaaa 900
gaaaattcaa aaatgaatca gaatcgacat ctacgatggt tagtggtgta tgaaactgac 960
atagataaag attaaattgg tgtttgaata attaagtttt aattattata aacttgataa 1020
ataaatatat ttaatatttt aaaataaatt ttacatagaa agtttttttt acgaaataca 1080
ctatttaata atttaaaaag catgtcaacg aaaatcacgt aaaatctgaa tttcaaccca 1140
cccaaagata acgcgcacga cgcccgcgcc cacggccctc gttgacccgc ccgaaaaacc 1200
ccaccaaacc ccccctcctc gcaaccggcc gtacgtgcag ccaccacgca ccgaaccaaa 1260
cccgccgcga gagcgagacc cacccaccac gcgcggccgg gttcactcac cctcaccctc 1320
tcagtggcag ccgccggcaa ttgagccccg cgcaccaggg gcagcgccgt caaaacgcaa 1380
cgcagccagg gagaaaaggc aagttgtgag tgagcgagcc agccagtgca cagggaaatc 1440
ggggaaatcg tcggggaaat cgcatgccat ttcagcccgg aagatttgat ttcaaaaaaa 1500
acatttaaca gcttccttaa acaaccgaaa ccccccacga tatcagctct ctctctctcc 1560
ctcctcccat ctcctcgtct tcctcctcct gacctcctcg tcgtcgtcgt ctctcttcgc 1620
cggctccggc ggcggcggct gctcgcaccc ggtggcgtga ccgcggcggc ggtggagtgg 1680
agtggaattt gggttcggat cggcggagag aggaggagga gagggggtaa taattgggag 1740
gcagttgggg gagtgtaact ttgggcattg atggcggggt agagaaggtg agcccccaag 1800
gaggagggtg gtggtggtgg tggcttctgt acctgcgacc ctgcgttgct ctgcgcccct 1860
ctcctttatt gcgtttaatt tccctcccaa ttccgtctct ccgctgcctg cctggcttct 1920
ccgcgattcc atccatagtt tggagtgggg aggaatgggg agtggcggcg gcggcggagg 1980
tggtggtggt ggtggtggtg g 2001
<210> 4
<211> 4105
<212> DNA
<213> Rice (Oryza sativa L)
<400> 4
atggaggagg aggagatgat gcgggctggt ggttgttgtt gtggtggtgg tggggtctgg 60
gcgcggctac tgctgctcgt ggcggtggtg gcggcgcccg gggcggtggt ggcgcagcag 120
gggaacctca cgtcgcgggc ggatctctcg gggctctacg cgctgcgcgg ctcgctcggg 180
ctgcgcgcgc gggactggcc gcgccgcgcc gacccctgca cggcgtgggc cggggtgcgc 240
tgcagcggcg gccgcgtcgt gtcggtcgac ctcgccgggc tgcgccgcac gcggctgggg 300
cgcctggcgc cgcggttcgc cgtcgacggg ctgcgcaacc tcacgcggct cgaggccttc 360
agcgcgcccg ggttcggcct gccaggctcc cttccggcgt ggctcggcgc ggggctcgcg 420
cccaccttcc agctcctcga catctccggc tgcgccgtca cgggggagat ccccgcctcg 480
gccatcgccg gcctcagcaa cctcaccact ctcaacctcg cggggaatct actctcgggg 540
cagctccctg gcagtgctct cgccgggctc gctcggctca agactctcaa cctctctggc 600
aatgccttct caggcgagct acccaaggcg gtctggtcgc tcccggagct gagcgttctc 660
gatgtgtctc ggaccaacct caccggcgca ttgccggata cagggctcgc gcttccatcc 720
aatgtacagg tggtggatct gtccgggaac ctcttctatg gtggcgtgcc gggatccttt 780
ggccaacttt tcggtaggac gaagctggcc aatatctctg ggaattactt cgacggcaaa 840
ctgggtgtat ccaatggtga tggtgggaat ttctcatttg agttgaattg cttcgttgat 900
gtcactggac agcgtagcca ggcagaatgt cagcagttct atgctgcacg tggtttgccg 960
tataatgttt caggtcctgc acccacaccg cagcctgcga tgccagcttc accgggaagg 1020
aaaaaggggc acaagaattt gaagtatata ctgattggag ccatttgcgg cggtgtcctc 1080
ttggtagctg tgattgctgc cattttgtat tgcttggtgt gctctgggag taggaggaat 1140
gggagtagga atgatcagcg ggaaagtggc gtgcggaaca cacagttggg agcgtctgga 1200
actggtgggg gtgcagttac tgctggcacg caaccttctg catcgcctgc aaacttggca 1260
aaggtcggtg attcattcgg ttatgaccag ctcgtcgaag ccaccacgga ctttggagat 1320
gataggctta tcaagcatgg tcactcaggt gatctttacc ttggggcgct ccatgatggg 1380
acctctgtgg ttgtgaagag gataacttcc agcatggcta agaaagatgc ttatatggcg 1440
gagctagatt tatttgccaa aggattgcat gaaaggctgg tgccgatcat ggggcattgc 1500
cttgataaag aggaggagaa atttctcgtg tatatatttg tccggaatgg cgacttatca 1560
agtgcactgc acagaaagtc aggggaggaa gaggaaggcc tgcaatcttt ggactggata 1620
aagaggctga aaattgcaac aggagtggca gaggcactat gctatctcca ccacgagtgt 1680
aatccaccaa tggttcacag gtataaactt ctttgtattt acatgaatac aaaatttatt 1740
tcagttggat gtttgctttt cgggtataaa cttctttgta tttatgtgaa tgaaaaaatt 1800
atttcagttg gaatgctctg gccacatatt taatgaattt ggatattgct gaattactgc 1860
tgtgtactaa ttatacgatc catagcttac ttaaaccgaa aaaaatcaga atatgaacag 1920
cactgttttt tgtttatcca cctcgcggga aatggagggc ggttatgtag cattgttttt 1980
tattggacgt tgcaattctg atgagttggc atgctatgtt caggtatact tgctagatcc 2040
tccatcttat atataggcac ttctttatta tcatgctatt ttatagtcaa gttaaatctg 2100
aatatgtgtg atcaccttgt ccgtaattca gttggtccaa atatcctttt atgtgacttt 2160
caatgagatg tttctatgca ctatattact accaactaga caatgttaaa gatttgagca 2220
cccctcctga tatcatgcaa atgcatcaga agttctttgt tggcttcatt tcgctaggaa 2280
agcattgttt tggtattaaa gtgaaacatg cagtaaacca tgtgagtaat cttggttgtt 2340
gaactaatga gatcatgatc tgccacaggg acgtgcaagc tagcagtatt cttcttgatg 2400
ataaatttga tgtgcgcctt gggagtttga gcgaggtgtg tcctcaagaa ggggaaggcc 2460
accaaaatgt catcacaaag ctgttgagat tttcatcgta agttttaact tttagcactg 2520
catactctgt ttcttagctc tacgtgtaag actcgaatat ccataaaatg cttgattgca 2580
cttcgctgtt cagttcatca tgcctattca ttttgctaac atttgaatta aacttgtgct 2640
ttgagttccg aatatatatt agtcaattat actatattat ccttcctctc ccatgtattg 2700
agggtgcagc taagcaaatt ccaaattggt ttctatatgc acaggacaaa aatagtgcta 2760
gtaggcccgt tggtagcgaa agtaattgga aactttctcc tagcatttca gatcctgata 2820
tggctcatgt tctgctgcca gtttatttta tgtaatttct ttttgctgca ctgaatgaaa 2880
ttcgtctcat tttctaatgt tgtgttgttt tctgggaaat gtaggactgc ggatcaagga 2940
tcttctggta agtccatgca tccatgcttg ctttcatttc tttcaagtgt tagctgccta 3000
atgtttgaaa ctgatgatga cactgttaaa ttgtgttgta taactgtatc tatagatgtt 3060
ttaggttcat ggatgcaagt gcattgacaa acctctaatt taaccaggtt ctccatctgc 3120
atcatgttca tatgatgtct attgctttgg aaaagttttg ttggagctgg tgactggaag 3180
gctaggtatc agtgcatcaa atgatgctgc aacgaatgag tggcttgatc acactctgcg 3240
ctacattaat atttatgaga aagagctcat gagcaagatc attgatccat cacttataat 3300
tgatgaggac catctggagg aagtctgggc aatggcaatt gttgcaaagt cctgcttgaa 3360
tcctaggtct tctaaacggc cgccgatgaa atatattcta aaagcactag agaatccgtt 3420
gaaggtggtg agggaagata acggcggctc tagctcagcc cgtttgagag ccacgtcatc 3480
acggggatca tggaatgctg cattcttcgg gagttggcgg catagctcgt ctgatatagg 3540
tccttcaagg gatgacaact tgttgaaacg ctcagagacg atcaaatcat ccggagggag 3600
caatggtgac cattcttcct cccgcaggag gcaatcgaag gagatcttcc ctgagccatc 3660
tggttcacgt gacaccgagg attaaggagc tttcttttgt cttgtgaccc ttttagtgca 3720
aagagaagtc catgaagggt ggcagctgtc gaagcgctgc tgctaccttg tgattgaatt 3780
ctttcagctg acagatcgaa gcgtgaattt cctgcatgtc attgacttca caggcagcat 3840
actggcatca ggggtaccat ttttcggggt ggactgggaa gcgatcgtat agtggattag 3900
tggttggtgc ccaatgcatg atctggacaa atggcttggc aatgttgtta tttttctttc 3960
ccctcttgat taaaaagaaa gaatggcgag ctgattcttt ttcttcttcc ctactgtaat 4020
tgattgtttc attgttgatc atagcagaaa tgttcgttcc attcacgcct ggcagtgcct 4080
ggtttctgtg ctgcttttca gaatc 4105
<210> 5
<211> 21
<212> DNA
<213> Primer (Primer)
<400> 5
cctggttcac acggaagatg a 21
<210> 6
<211> 19
<212> DNA
<213> Primer (Primer)
<400> 6
ctgccgacgc agtccatga 19
<210> 7
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 7
acattcgttg gcccgagatt 20
<210> 8
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 8
gaaaccgtac ctgcccttca 20
<210> 9
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 9
ccatgatggg acctctgtgg 20
<210> 10
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 10
catgatcggc accagccttt 20
<210> 11
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 11
caagtgacag aacacgacgc 20
<210> 12
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 12
attgctcaat ggccgcaatg 20
<210> 13
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 13
ctgttccaaa gaacccagcc 20
<210> 14
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 14
ggaggcatgg atgaactcgt 20
<210> 15
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 15
gcatcaagga caagttccgc 20
<210> 16
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 16
aactgcagca tccttgacca 20
<210> 17
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 17
ctgacacatc cttcggtgct 20
<210> 18
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 18
tgtccagtac agattggccg 20
<210> 19
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 19
gacggcgtcg tgtatctcat 20
<210> 20
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 20
cgacacaaac tcgcaagtcg 20
<210> 21
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 21
gatacaacac cttgcccgga 20
<210> 22
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 22
ccacaatctc ccaacacgga 20
<210> 23
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 23
aagcaaggac agagcgtgaa 20
<210> 24
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 24
gcaaagttgt gcacccgatt 20
<210> 25
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 25
tgttcaagta tgtgcgccct 20
<210> 26
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 26
tcctcgacca gcaaaaggtc 20
<210> 27
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 27
ccgaaaacca cctgcgattc 20
<210> 28
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 28
gctggtggta gctcaggaac 20
<210> 29
<211> 18
<212> DNA
<213> Primer (Primer)
<400> 29
tcctcgacat ctccggct 18
<210> 30
<211> 20
<212> DNA
<213> Primer (Primer)
<400> 30
agctgccccg agagtagatt 20
<210> 31
<211> 23
<212> DNA
<213> guide RNA (sgRNA)
<400> 31
tcaccactct caacctcgcg ggg 23

Claims (12)

1. Use of LRK1, wherein up-regulating LRK1 is used to:
(a) The characteristics of the plants are improved,
(b) Preparation of preparations or compositions for improving plant traits, or
(c) Preparing plants with improved characters;
wherein the improved trait comprises: (i) Increasing the dark respiration rate of plant leaves, or (ii) increasing the high temperature tolerance of plants;
wherein the polypeptide of LRK1 is the polypeptide of the amino acid sequence shown in SEQ ID NO. 2; or a polypeptide formed by adding a tag sequence to the N or C terminal of the polypeptide having the amino acid sequence shown in SEQ ID NO. 2 or adding a signal peptide sequence to the N terminal thereof;
wherein the plant is rice.
2. The use of claim 1, wherein the molecule that up-regulates LRK1 comprises:
interact with LRK1, thereby increasing its expression or activity; or (b)
An expression cassette or expression construct that overexpresses LRK 1.
3. The use according to claim 1, wherein the agent comprising said site-directed mutation that upregulates LRK1 is targeted toLRK1A promoter upstream of the gene,the nucleotide sequence of the promoter is shown as SEQ ID NO. 3, and the 1760 th site of the nucleotide sequence of the promoter is mutated into A.
4. Use according to claims 1-3, wherein the polynucleotide encoding LRK1 is selected from the group consisting of:
(a) A polynucleotide as shown in SEQ ID NO. 1 or SEQ ID NO. 4;
(b) A polynucleotide that is fully complementary to the polynucleotide of (a).
5. A method of improving a plant trait or preparing a plant with improved trait comprising: increasing expression or activity of LRK1 in plants;
wherein the amino acid sequence of the polypeptide of LRK1 is the polypeptide of the amino acid sequence shown in SEQ ID NO. 2; or a polypeptide formed by adding a tag sequence to the N or C terminal of the polypeptide having the amino acid sequence shown in SEQ ID NO. 2 or adding a signal peptide sequence to the N terminal thereof;
wherein the improved trait comprises: (i) Increasing the dark respiration rate of plant leaves, or (ii) increasing the high temperature tolerance of plants;
wherein the plant is rice.
6. The method of claim 5, wherein said increasing expression or activity of LRK1 comprises:
overexpression of LRK1 in plants; or (b)
Targeting with mutating agentsLRK1The nucleotide sequence of the promoter is shown as SEQ ID NO. 3, and the 1760 th site of the nucleotide sequence of the promoter is mutated into a base A.
7. The method comprises the following steps ofLRK1The use of the gene as a molecular marker for identifying traits of plants; the traits include: (i) Dark respiration rate of plant leaves, or (ii) plant high temperature tolerance; wherein the saidLRK1The amino acid sequence of the polypeptide coded by the gene is the polypeptide with the amino acid sequence shown in SEQ ID NO. 2; or is shown in SEQ ID NO. 2A polypeptide comprising an amino acid sequence and a tag sequence added to the N-terminus or the C-terminus of the polypeptide, or a signal peptide sequence added to the N-terminus of the polypeptide; wherein the plant is rice.
8. The use according to claim 7, wherein the plant is obtained by analysis of the plantLRK1Determining and identifying the characters of the plants by the expression quantity of the genes; if in the plant to be testedLRK1The expression level of the gene is equal to or higher than that of the plantLRK1Average expression level of a gene, then: (i) The dark respiration rate of the plant leaves is normal or high, or (ii) the high temperature tolerance of the plant is normal or high; if in the plant to be tested LRK1The expression level of the gene is lower than that of the plantsLRK1The average expression level of the gene is not ideal.
9. A method of directionally selecting plants with improved traits comprising: analysis of plantsLRK1The expression level of the gene; if in the plant to be testedLRK1The expression level of the gene is higher than that of the plantLRK1Average expression level of a gene, then: (i) The plant leaves have high dark respiration rate, or (ii) the plant has good high temperature tolerance, which is a plant with improved properties; wherein the saidLRK1The polypeptide coded by the gene is the polypeptide with the amino acid sequence shown in SEQ ID NO. 2; or a polypeptide formed by adding a tag sequence to the N or C terminal of the polypeptide having the amino acid sequence shown in SEQ ID NO. 2 or adding a signal peptide sequence to the N terminal thereof; wherein the plant is rice.
10. The method of claim 9, wherein the identification is performed by identifyingLRK1Identification of the type of base at position 1760 of the Gene upstream promoterLRK1The expression level of the gene is described by the case where the base at 1760 is ALRK1The normal or high expression level of the gene is indicated by the fact that the base at 1760 is TLRK1The expression level of the gene is lower than the normal value; wherein the nucleotide sequence of the promoter is shown as SEQ ID NO. 3.
11. Identification in plants LRK1A method for increasing or decreasing the expression level of genes,comprising the following steps: authenticationLRK1The type of the base at position 1760 of the gene upstream promoter is described when the base at position 1760 is ALRK1The normal or high expression level of the gene is indicated by the fact that the base at 1760 is TLRK1The expression level of the gene is lower than the normal value; wherein the nucleotide sequence of the promoter is shown as SEQ ID NO. 3; wherein the plant is rice.
12. A method of identifying indica or japonica varieties of rice which is a gramineous plant, the method comprising: identification of test plantsLRK1At position 1760 of the gene upstream promoter,LRK1bases 709, 1479, 1806 and 2621 of the gene, and if the 1760 of the upstream promoter is A,LRK1the 709 th site of the gene is A, 1479 th site is A, 1806 th site is G, 2621 th site is G, and the probability of the plant being indica rice is high; the saidLRK1The nucleotide sequence of the gene is shown as SEQ ID NO. 4; wherein the plant is rice.
CN202010587199.8A 2020-06-24 2020-06-24 Protein for regulating and controlling dark respiration of plant leaves and application thereof Active CN113912685B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010587199.8A CN113912685B (en) 2020-06-24 2020-06-24 Protein for regulating and controlling dark respiration of plant leaves and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010587199.8A CN113912685B (en) 2020-06-24 2020-06-24 Protein for regulating and controlling dark respiration of plant leaves and application thereof

Publications (2)

Publication Number Publication Date
CN113912685A CN113912685A (en) 2022-01-11
CN113912685B true CN113912685B (en) 2023-09-15

Family

ID=79231217

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010587199.8A Active CN113912685B (en) 2020-06-24 2020-06-24 Protein for regulating and controlling dark respiration of plant leaves and application thereof

Country Status (1)

Country Link
CN (1) CN113912685B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103571869A (en) * 2012-07-21 2014-02-12 复旦大学 Method for improving fertility of indica-japonica rice hybrids by virtue of LRK1 gene transformation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103571869A (en) * 2012-07-21 2014-02-12 复旦大学 Method for improving fertility of indica-japonica rice hybrids by virtue of LRK1 gene transformation

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
4个水稻逆境诱导基因的克隆和功能鉴定;王艳丽;《中国优秀硕士学位论文全文数据库》;A006-62 *
Over-expression of the rice LRK1 gene improves quantitative yield components;Zha, Xiaojun等;《PLANT BIOTECHNOLOGY JOURNAL 》;第7卷(第7期);第611-620页 *
probable LRR receptor-like serine/threonine-protein kinase At2g16250 [Oryza sativa Japonica Group]， NCBI Reference Sequence: XP_015632675.1;UNKNOWN;《NCBI》;全文 *

Also Published As

Publication number Publication date
CN113912685A (en) 2022-01-11

Similar Documents

Publication Publication Date Title
US9663794B2 (en) Heat-resistance rice gene OsZFP, screening marker and separation method thereof
CN111763682B (en) Application of ZmSBP12 gene in regulation of drought resistance, plant height and spike height of corn
CN110079534B (en) Gene and promoter for regulating and controlling flowering period of corn and application of gene and promoter
AU2007223053A1 (en) Compositions and methods for increasing plant tolerance to high population density
CN108864266B (en) Protein SSH1 related to rice graininess and grain type as well as encoding gene and application thereof
CN116253784B (en) Wheat leaf rust resistance protein, and coding gene and application thereof
CN111087457A (en) Protein NGR5 for improving nitrogen utilization rate and crop yield, and coding gene and application thereof
US20100319083A1 (en) Method of producing plants having enhanced transpiration efficiency and plants produced therefrom
CN111826391B (en) Application of NHX2-GCD1 double gene or protein thereof
CN107326035B (en) Deubiquitinating enzyme gene UBP5 for regulating rice grain shape and leaf color and application thereof
CN109913468B (en) Wheat tillering character related gene TaTAC1, expression product thereof, expression vector thereof and application
CN108484741B (en) Protein for controlling grain weight of crop seeds and application thereof
CN113912685B (en) Protein for regulating and controlling dark respiration of plant leaves and application thereof
CN112646016B (en) Gene and method for changing flowering period of corn
CN112646820B (en) Gene and method for changing flowering period of corn
CN106995490B (en) Method for regulating and controlling activity of plant proteasome
CN114958867A (en) Corn ear grain weight and yield regulation gene KWE2, and encoding protein, functional marker, expression vector and application thereof
CN110452914B (en) Gene BnC04BIN2-like1 for regulating brassinolide signal transduction and application thereof
CN110343154B (en) Clone of key gene SEM1 for controlling rice sink source flow and application thereof
US20050188435A1 (en) Method of increasing the GGT activity in plants, plants with increased GGT activity, and a method of producing such plants
CN113621036A (en) Rice nitrogen metabolism regulation protein ARE4 and application of coding gene thereof
CN111533807A (en) Application of AET1-RACK1A-eIF3h complex in plant environmental temperature adaptability
CN113462661B (en) SIZ1 protein separated from corn, encoding gene thereof and application thereof in variety improvement
US11859196B2 (en) Modulating drought tolerance in Brassicaceae using the Kanghan gene family
CN114196679B (en) Application of copper ion transport protein gene OsCOPT7 in rice breeding

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant