CN113881676B - Paracoccus denitrificans nitrate inducible promoter - Google Patents
Paracoccus denitrificans nitrate inducible promoter Download PDFInfo
- Publication number
- CN113881676B CN113881676B CN202111257340.9A CN202111257340A CN113881676B CN 113881676 B CN113881676 B CN 113881676B CN 202111257340 A CN202111257340 A CN 202111257340A CN 113881676 B CN113881676 B CN 113881676B
- Authority
- CN
- China
- Prior art keywords
- nitrate
- paracoccus denitrificans
- inducible promoter
- gene
- recombinant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43595—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from coelenteratae, e.g. medusae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Gastroenterology & Hepatology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Microbiology (AREA)
- Toxicology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a paracoccus denitrificans nitrate-inducible promoter, and belongs to the field of synthetic biology. The invention uses genetic engineering means to amplify the genome of the paracoccus denitrificans to obtain 7 nitrate-pair promoter sequences, and the reporter gene with the promoter is successfully expressed in the paracoccus denitrificans in a joint transfer mode, so that the expression intensity of the protein can be improved by 6-27 times, the expression efficiency of the protein can be improved, and the gene expression control element can be used for finely controlling gene expression and finely controlling metabolic pathways, and simultaneously provides a new thought and method for controlling denitrification pathways, thereby having wide application prospects.
Description
Technical Field
The invention relates to a paracoccus denitrificans nitrate-inducible promoter, and belongs to the field of synthetic biology.
Background
Environmental protection has been paid more attention to in recent decades, and the pollution of rivers, lakes and the like cannot be effectively restrained due to the increasing force of the country, so that the pollution load of the water is continuously increased, the eutrophication problem is still serious, and the safety of drinking water is still threatened. The nitrogen pollution is difficult to control and the solution of the nitrogen pollution is quite difficult due to the reasons of wide sources of the nitrogen pollutants, complex pollution paths and processes, low treatment effect of the traditional denitrification technology, difficulty in realizing large-scale application of the new denitrification technology and the like. Biological denitrification is the most commonly used and effective method in the sewage denitrification treatment at present, and the selection of the strain with the denitrification function is the basis of biological denitrification.
Denitrification is one of the important branches of the global nitrogen cycle driven by microorganisms, and is currently the denitrification processIs controlled by regulating NO 3 - 、O 2 And pH value, and can provide a new idea and method for regulating and controlling denitrification path if the microbial denitrification process can be known from molecular level. Aerobic denitrifying bacteria are receiving attention because they can use both nitrate and oxygen as electron donor acceptors. With a thorough understanding of denitrifying microorganisms, researchers have found that there is a coupling process of heterotrophic nitrification and aerobic denitrification in some denitrifying bacteria, which are called heterotrophic nitrification-aerobic denitrification bacteria (heterotrophic nitrifying and aerobic denitrifying bacteria, HN-AD). The discovery of HN-AD bacteria provides a foundation for a single-stage denitrification process, and breaks through the traditional denitrification process of co-culturing nitrifying bacteria and denitrifying bacteria for denitrification. The paracoccus denitrificans (Paracoccus denitrificans) has the functions of nitrifying and aerobic denitrifying, and thus becomes a denitrification mode strain.
Tests have proved that the paracoccus denitrificans has good treatment effect on nitrate through denitrification under aerobic conditions. For example, kucera et al used paracoccus denitrificans in membrane reactors to remove nitrate from water, and the results showed that after 10 hours of testing, the removal rate of nitrate was as high as 95% without accumulation of nitrite. Meanwhile, research shows that the paracoccus denitrificans can perform denitrification under both aerobic and anaerobic conditions. In addition, researchers have also proposed that paracoccus denitrificans not only can perform aerobic denitrification, but also can convert ammonia nitrogen into nitrite nitrogen, and has heterotrophic nitrification function. The nitrification and aerobic denitrification of the paracoccus denitrificans provide theoretical basis for treating nitrogen pollution of domestic water by using the paracoccus denitrificans. However, the lack of an efficient genetic transformation system in p.dentrifics greatly limits the use of genetic engineering to degrade ammonia nitrogen in p.dentrifics. Therefore, it is necessary to establish a highly efficient genetic transformation system. Wherein the vector is the core part of the genetic transformation system, and the promoter is the key element for the efficient expression of the vector. Therefore, by utilizing the advantages of the aerobic denitrification of the P.Denitrification, the nitrate-induced promoter of the paracoccus denitrificans is fully excavated, which is helpful for establishing a genetic transformation system with high efficiency suitable for the P.Denitrification and improving the ammonia nitrogen degradation efficiency of the P.Denitrification.
Disclosure of Invention
The invention provides a nitrate inducible promoter, which has nucleotide sequences shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 or SEQ ID NO.7, can start the transcription of genes in paracoccus denitrificans when being stimulated by nitrate, and greatly improves the gene transcription level.
In one embodiment, the nitrate is present in a concentration of 1mg/L to 2g/L, or 10mg/L to 2g/L, or 100mg/L to 2g/L, or 200mg/L to 2g/L.
The present invention also provides a recombinant expression vector containing the nitrate-inducible promoter, which is capable of allowing insertion of a gene of interest and allowing the gene of interest to express a protein in bacteria.
In one embodiment, the carrier includes, but is not limited to PIND 4 。
In one embodiment, the bacteria include, but are not limited to: rhodobacter sphaeroides (Rhodobacter sphaeroides), paracoccus denitrificans (Paracoccus denitrificans) PD1222; the Paracoccus denitrificans PD1222 is disclosed in paper (purification of acid urease and identification and analysis of producing bacteria).
The invention also provides a recombinant microbial cell containing the recombinant expression vector.
In one embodiment, the host of the recombinant microbial cell is an aerobic denitrifying paracoccus DYTN-1, and the strain is disclosed in paper "efficient removal of total nitrogen in sewage by paracoccus DYTN-1" published in 2019.
The present invention also provides a method of expressing a foreign protein, the method comprising: transferring the recombinant expression vector into a microbial cell, and culturing the microbial cell in the nitrate environment.
In one embodiment, the method comprises: transferring the recombinant expression vector into a donor strain, uniformly mixing the donor strain and an acceptor strain according to a certain proportion, enabling the donor strain and the acceptor strain to be in direct contact, and driving the recombinant vector to migrate into the acceptor to finish joint transfer in the process by the auxiliary strain.
The invention also provides application of the nitrate-inducible promoter, the recombinant expression vector, the recombinant microorganism cell or the method in regulating and controlling target protein expression.
In one embodiment, the use is to culture the microbial cells in a nitrate-containing medium.
In one embodiment, the use is to add nitrate to induce gene expression after culturing the microbial cells in a medium for a period of time.
In one embodiment, the use is to culture the microbial cells in a nitrate-containing M9 medium at 30-37 ℃ for at least 48 hours.
In one embodiment, the nitrate is present in a concentration of 1mg/L to 2g/L, or 10mg/L to 2g/L, or 100mg/L to 2g/L, or 200mg/L to 2g/L.
In one embodiment, the protein of interest includes, but is not limited to, a marker protein; the marker protein may be a fluorescent protein, in particular a green fluorescent protein.
The beneficial effects are that: the invention successfully screens 7 promoters with different expression intensities induced by nitrate in paracoccus denitrificans in a joint mode, which are respectively P 0893 、P 4237 、P nir 、P 1845 、P 3636 、P 2411 And P 1746 The method has better expression in the paracoccus denitrificans, can improve the expression intensity of the protein by 6-27 times in the environment where nitrate exists, improves the expression efficiency of the protein, can be used as a gene expression regulating element for finely regulating gene expression and finely regulating metabolic pathways, provides a new thought and method for regulating denitrification pathways, and has wide application prospect.
Drawings
Fig. 1: recombinant expression vector PIND 4 -Pp.den-sfGFP schematic structure.
Fig. 2: comparison of response intensity performance of different nitrate-inducible promoters.
Fig. 3:P 1845 and P 0893 Fluorescence response at different nitrate concentrations.
Detailed Description
Restriction enzymes and DNA polymerases were purchased from the company Simerfei and Takara, respectively. Multifunctional microplate reader BioTek HT plate reader (Winooski, VT, USA) is used to detect the fluorescence intensity of the sample. Coli JM109 was used for molecular cloning, E.coli S17-1. Lambda. Pir as an auxiliary strain for the conjugation transfer of Paracoccus denitrificans DYTN-1, and Paracoccus denitrificans DYTN-1 for protein expression.
EXAMPLE 1 construction of Gene recombination vector
1. Cloning of the sfGFP Gene containing NcoI and HindIII cleavage sites from the sfGFP-containing vector pJKR-H-cdaR (from adedge) using primers F: ccatggtgcgtataggtgaagaactg and R: aagcttagaactggcatgcatctttg, the desired gene sfGFP and plasmid PIND were digested with the restriction enzymes NcoI and HindIII 4 (obtained from the national academy of sciences of military medicine, disclosed in the paper "expression of sorbose dehydrogenase in Paracoccus denitrificans") were digested separately to construct PIND 4 -sfGFP recombinant expression vector. sfGFP gene fragment and PIND 4 Enzyme digestion reaction system: 10 XQuickcut Buffer 5. Mu.L, restriction enzymes NcoI and HindIII 1. Mu.L each, sfGFP or PIND 4 The total amount was 1. Mu.g, with dd H 2 O is added to the total volume of 50 mu L, the mixture is put into a metal bath at 37 ℃ for enzyme digestion for 1h, inactivated at 80 ℃ for 15min, and the enzyme digestion result is detected by 1% agarose gel electrophoresis.
2. Purifying and recovering the gene fragment: experimental procedures refer to the instructions for use of the purification recovery kit by the manufacturer Sangon Biotech DNA.
DNA ligation: determination of the target Gene sfGFP and plasmid PIND after cleavage purification recovery 4 Is mixed at a molar ratio of 4:1, 1. Mu.LT 4 ligase, 2.5. Mu.L 10×T DNA Ligase Buffer, and dd H is added 2 O was made up to 25. Mu.L in total and was connected at 16℃for 20h.
4. Conversion: thawing competent cells E.coli JM109 taken out from-80deg.C refrigerator on ice for 10min, adding 25 μl of the ligation product, mixing, ice-bathing for 15min, heating in a constant temperature water bath at 42deg.C for 90s, and rapidly returning to ice water bath for 2minn, adding 1000 mu L of LB culture medium (without antibiotics) into the mixture, fully mixing the mixture, resuscitating the mixture for 1h at 37 ℃ and 220r/min, finally, taking 100 mu L of resuscitated bacterial liquid, coating the resuscitated bacterial liquid on LB solid culture medium containing 50 mu g/mL kanamycin antibiotics, culturing the mixture for 12h at 37 ℃, taking out single colony after the single colony grows on a flat plate, picking the single colony, carrying out colony PCR (polymerase chain reaction) verification, and screening positive transformants to obtain a carrier PIND 4 -sfGFP。
5. The p.den-0893, p.den-4237, p.den-nir, p.den-1845, p.den-3636, p.den-2411 and p.den-1746 genes were searched for by searching the genome sequence of Paracoccus denitrificans in the kegg (https:// www.kegg.jp /) database and analyzed 0893 、P 4237 、P nir 、P 1845 、P 3636 、P 2411 And P 1746 The promoter sequence comprises a core region, a 5' -non-coding region (UTR) and an RBS region, can be directly connected to the upstream of a CDS region of a target gene for gene expression, and has nucleotide sequences shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7 respectively. Extracting genome DNA of the paracoccus denitrificans DYTN-1 by using a genome kit of the Shanghai worker bacteria. Primers were synthesized by Jin Weizhi Biotechnology Inc., and information on the primers is shown in Table 1.
Table 1 Paracoccus denitrifican promoter primer sequence information
6. With plasmid PIND 4 Preparation of linearized vector PIND using sfGFP as template and primers F atggtgcgtataggtgaagaactg and R gcgcaacgcaattaatgtaagttag 4 50. Mu.L of the system for PCR amplification of sfGFP, 25. Mu.L of 2X PrimeSTAR Max DNA polymerase, 1. Mu.L of each primer F/R (10. Mu. Mol/L), 1. Mu.L of DNA template, 22. Mu.Ldd H 2 O. The amplification procedure is shown in Table 2. The PCR product is detected by 1% agarose gel electrophoresis, and the target fragment is recovered by cutting gel according to the specification of the DNA purification recovery kit.
TABLE 2 PCR amplification procedure
DNA ligation: the concentration of the purified and recovered promoter fragment and linear vector was measured, and the concentration was mixed in a molar ratio of 3:1, and 5. Mu.L of ABclonal ligase was added thereto, followed by use of dd H 2 O was made up to a total volume of 10. Mu.L and was connected at 50℃for 15 mm.
8. Conversion: thawing competent cells E.coli JM109 taken out of a refrigerator at-80 ℃ for 10min on ice, adding 15 mu L of a connection product into the mixture, uniformly mixing the mixture, carrying out ice bath for 15min, putting the mixture into a constant temperature water bath kettle at 42 ℃ for hot shock for 90s, quickly putting the mixture back into the ice water bath for 2min, adding 1000 mu L of LB culture medium (without antibody) into the mixture, fully mixing the mixture, resuscitating the mixture for 1h at 37 ℃ and 220r/min, finally, taking 100 mu L of resuscitated bacterial liquid, coating the resuscitated bacterial liquid on LB solid culture medium containing 50 mu g/mL of kanamycin antibiotic, culturing the mixture for 12h at 37 ℃, taking single bacterial colony out on a flat plate, picking the single bacterial colony, carrying out bacterial colony PCR (polymerase chain reaction) verification, and screening positive transformants to obtain a carrier PIND 4 -Pp.den-sfGFP。
EXAMPLE 2 Paracoccus denitrificans conjugation transformation
(1) The recombinant plasmid constructed in example 1 was transformed into E.coli S17-1 lambda pir competent cells by heat shock method, respectively, cultured on 50. Mu.g/mL kanamycin-resistant LB medium for 24 hours, single colonies were picked up for colony verification, positive clones were transferred to LB medium and cultured at 200rpm,37℃for 12 hours to extract plasmids for sequencing verification.
(2) E.coli S17-1 lambda pir containing recombinant plasmid constructed in the step (1) is used as a donor strain, paracoccus denitrificans DYTN-1 is used as an acceptor strain, and is respectively inoculated into 2 test tubes containing 5mL of LB culture medium, and is cultured overnight at 37 ℃ to respectively obtain the bacterial body with the quantity of 10 8 cfu/mL of bacterial liquid. Both were then combined according to 3:10 are transferred into the same test tube to mix the donor and acceptor bacteria in the test tube uniformly, and the mixed culture of the donor and acceptor bacteria is placed at 37 ℃ for 30min. For and receiveAfter the incubation of the somatic cell mixed culture for 30min, the test tube was vigorously shaken to allow sexual cells Mao Duankai between the donor and recipient cells, thereby stopping the gene dispatch transfer. Absorbing 0.1mL of bacterial liquid, coating the bacterial liquid on a corresponding resistance flat plate for two days, picking a single colony for PCR verification, transferring positive clones to LB culture medium, culturing at 200rpm and 37 ℃ for 12 hours, extracting plasmids, and carrying out sequencing verification to obtain positive clones.
EXAMPLE 3 Paracoccus denitrificans nitrate-inducible promoter to regulate GFP expression
The recombinant vector-containing Paracoccus denitrificans strain was shake-cultured in M9 medium at 30℃and 200 rpm.
M9 Medium, glycerol 4g/L, KNO 3 2.0g/L，NaCl 0.5g/L，KH 2 PO 4 3.0g/L，Na 2 HPO 4 6.78g/L，CaCl 2 0.115g/L，MgSO 4 0.24g/L. To replace KNO in the culture medium 3 2.0g/L peptone was used as a control at 1.0g/L peptone.
After the positive colonies obtained in the step (2) of example 2 were activated overnight, they were inoculated into an orifice plate containing 2mL of M9 medium at an inoculum size of 2% for cultivation. In addition, the strains were cultured with and without nitrate induction, respectively, and after 48 hours of culture, the supernatants were sampled and collected, and diluted appropriately with PBS buffer to ensure OD 600 Fluorescence was measured at 37℃at room temperature using a BioTek HT plate reader (VT, winioski, USA) in the range of 0.2-0.8 at excitation wavelength of 485.+ -. 20nm and emission wavelength of 528/20 nm. Finally, by putting OD 600 And the fluorescence divided to normalize the fluorescence.
The results show that 7 promoters with different expression intensities induced by nitrate are successfully screened in paracoccus denitrificans by a conjugation mode, and the promoter P 0893 、P 4237 、P nir 、P 1845 、P 3636 、P 2411 And P 1746 The fluorescence response values per OD in the presence of nitrate were 6, 6.5, 10.2, 12.6, 23.4 and 27-fold, respectively, in the absence of nitrate, indicating that the promoter was greatly affected by nitrate and had excellent expression efficiency in the presence of nitrate (fig. 2).
EXAMPLE 4 expression of Paracoccus denitrificans nitrate inducible promoters at different nitrate concentrations
The specific embodiment is the same as in example 3, except that the nitrate concentration in the M9 medium was adjusted to 1, 5, 10, 25, 50, 75, 100, 250, 500, 750, 1000, 2000mg/L, respectively, and the results showed that promoter P per unit OD 1845 The fluorescence intensity at 100mg/L can reach 610, P 0893 The fluorescence intensity at 100mg/L is over 200, and the nitrate concentration range from 250mg/L to 2000mg/L has good linear relation, which is beneficial to realizing the accurate regulation of the protein expression.
While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> university of Jiangnan
<120> Paracoccus denitrificans nitrate inducible promoter
<130> BAA211167A
<160> 7
<170> PatentIn version 3.3
<210> 1
<211> 282
<212> DNA
<213> artificial sequence
<400> 1
gatttcctcg gccgcaggcc cggcattcag ccgcgcctcg agatattcga agcgctcgac 60
gatctggata aggcggtctt ccggcagcat tcgttgcaat tagccgctgc ttcaacggcc 120
ggcaaggcag aacctcgaaa acatctgacc cagatcaaag cgcgacggac cgtcatggtg 180
caggtttccg cgagacgcgc ccaccaagcc aaaggaggca cccaagtgaa actcgtcccc 240
tttctgacag cgacgagtct tgccctgtcc gctctgccgg tc 282
<210> 2
<211> 400
<212> DNA
<213> artificial sequence
<400> 2
ggatcagttc cagttgcgcg ggaaagacct ggtcataggc cgcatgcatc agcgcgtcga 60
aggccgggct ggtcatgttg cgaaacagcg gcaggttgcg gatgtcgttg cggtcctctt 120
cgcgcatatg ggtcgtcctg cgtggtgttt gtggaatcgg cgtcacgctt gcaaaaatct 180
tgatttaagt caatcatcaa atcaatattt gtcacgaaca gtggcggcat atgcaggctg 240
acgatttgag aagtcaccag atcggacagt gcagaatcca aatccggtcg gttttcccgg 300
gccggccgga caaagttgat ccagatcaaa cctcgcgaaa ggggcccgtg ctgggtgagc 360
gtcgaaacag cgcgcgaaag tcccaatcgg agcatccgcc 400
<210> 3
<211> 92
<212> DNA
<213> artificial sequence
<400> 3
aagaattgac tcgcgcccgg attctgccta tgtgacccgc aaccgccgtc cggtggggtt 60
tttcctgaca cagttttctg cgcggaccga tc 92
<210> 4
<211> 390
<212> DNA
<213> artificial sequence
<400> 4
cggtcgagga tttccgtgcc caggccgacc cggatgcgga tgcctcgggg ctggaggaac 60
gctatccggg tgcgcagcag cgcaatttcg accgccgccc cggcgtgtcc gagatggatg 120
ccctgatcgc ctatctccag gtcctgggca cgatggtcga tttctcgacc ttcgaacccg 180
atccgaaccg ctgaggcccg ccatggacag gtattccttc ctgcgcgaac tggccgacag 240
ctgggtgctt ctgctgctgg tggtcttttt cctggggacg attgtcttcg ccttcaggcc 300
gggctcgcgg ccgctgcatc gcgacgcggc cgaaagcatc ttccgtaacg agacgaaacc 360
cgcatccgcg ggcgagaagg aggtcgagtg 390
<210> 5
<211> 268
<212> DNA
<213> artificial sequence
<400> 5
gcgacatggc gctcgacagc cttggggccg ccgcccgacg ccgcggccag cgccgcctcg 60
cgcaccgtct ccagcatggc gagatgcgcc gtgcggttgg cgcggaacgc ctccgaggac 120
ggcagggccg aggtgccaag cttcatcgca tcatcctttc ggtcgaagtg ccggcgctgc 180
tgcgccagtt tgtcgcatcc ctgccaaagg cgggaaaatc ttgatccaga tcaacgtcga 240
agcccgggac aaggagccat gagcgggc 268
<210> 6
<211> 338
<212> DNA
<213> artificial sequence
<400> 6
gatcacgccg cgcgacatcg ccttcatccg tcccggtctg tcggccacgg taaaggtcag 60
tgcctatgac tatgccgtct atggggggct gaagggcgag gtggtgacga tctcgcccga 120
caccatccag gacgagatca accgggacca gttctattac cgcgtgctga tccgggccga 180
aagcgacgcg ctggtcaacg acgcggggca gcgttttccc atcgtgcccg gcatgatggc 240
gaccgtggac atccatacgg ggcaaaagac agtgctggaa tacctgatcc agccgttcaa 300
tcgcgccggc gaggccatga gggaaaggtg atccacaa 338
<210> 7
<211> 291
<212> DNA
<213> artificial sequence
<400> 7
gtccagcgac agctcgcccc ggatcagccg gaacagcgtg gtcttgccgg cgccgttcgg 60
gccgaccagg ccgaccttgt ggccgtcggg gatggtggcc gaggcgtgct cgaacagcgg 120
tcgtccggcg atggaatagg atatgtcgtc gatgcgcagc atgcgccccc gcatggcgca 180
agccgcggcg ggcgtcaatg ccgcgccggc ttttcaagcg tcgcggcgca tgttaacggg 240
gcgcggattt ccgggccacc tgcggccgga acaaggaaaa ggacgaccga c 291
Claims (9)
1. The nitrate inducible promoter is characterized in that the nucleotide sequence is shown as SEQ ID NO. 1.
2. A recombinant expression vector comprising the nitrate inducible promoter of claim 1.
3. The recombinant expression vector of claim 2, wherein the recombinant expression vector is PIND 4 。
4. A recombinant microbial cell comprising the recombinant expression vector of claim 2 or 3.
5. The recombinant microbial cell of claim 4, wherein the recombinant microbial cell is rhodobacter sphaeroides @Rhodobacter sphaeroides) Or denitrifying ParacoccusParacoccus denitrificans）。
6. Use of the nitrate-inducible promoter of claim 1 for regulating protein expression, wherein the nitrate-inducible promoter is placed upstream of a gene of interest, and microbial cells carrying the gene of interest are cultured in an environment containing nitrate; the target gene is induced to express by the nitrate-inducible promoter; the concentration of the nitrate is 250 mg/L-2 g/L.
7. The use according to claim 6, wherein the nitrate is added to the culture medium to induce the expression of genes after culturing the microbial cells in the culture medium for a period of time.
8. The use according to claim 6, wherein the microbial cells are cultured in a nitrate-containing medium.
9. The use according to claim 8, wherein the medium is a nitrate-containing M9 medium; the culture is carried out at 30-37 ℃ for at least 48h.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111257340.9A CN113881676B (en) | 2021-10-27 | 2021-10-27 | Paracoccus denitrificans nitrate inducible promoter |
| CN202310928164.XA CN117210458A (en) | 2021-10-27 | 2021-10-27 | Paracoccus denitrificans nitrate inducible promoter |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111257340.9A CN113881676B (en) | 2021-10-27 | 2021-10-27 | Paracoccus denitrificans nitrate inducible promoter |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310928164.XA Division CN117210458A (en) | 2021-10-27 | 2021-10-27 | Paracoccus denitrificans nitrate inducible promoter |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113881676A CN113881676A (en) | 2022-01-04 |
| CN113881676B true CN113881676B (en) | 2023-08-29 |
Family
ID=79014669
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310928164.XA Pending CN117210458A (en) | 2021-10-27 | 2021-10-27 | Paracoccus denitrificans nitrate inducible promoter |
| CN202111257340.9A Active CN113881676B (en) | 2021-10-27 | 2021-10-27 | Paracoccus denitrificans nitrate inducible promoter |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310928164.XA Pending CN117210458A (en) | 2021-10-27 | 2021-10-27 | Paracoccus denitrificans nitrate inducible promoter |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN117210458A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111718936A (en) * | 2020-06-30 | 2020-09-29 | 江南大学 | Ammonium salt inducible promoter and application thereof in regulating and controlling expression of target gene |
-
2021
- 2021-10-27 CN CN202310928164.XA patent/CN117210458A/en active Pending
- 2021-10-27 CN CN202111257340.9A patent/CN113881676B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111718936A (en) * | 2020-06-30 | 2020-09-29 | 江南大学 | Ammonium salt inducible promoter and application thereof in regulating and controlling expression of target gene |
Also Published As
| Publication number | Publication date |
|---|---|
| CN117210458A (en) | 2023-12-12 |
| CN113881676A (en) | 2022-01-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9321697B2 (en) | Recombinant nitrogen fixing microorganism and uses thereof | |
| CN113528476B (en) | Glucose oxidase mutant and coding gene and efficient recombinant expression thereof | |
| CN113881676B (en) | Paracoccus denitrificans nitrate inducible promoter | |
| US20220411837A1 (en) | Recombinant methanotrophic bacteria for indigo biosynthesis and methods thereof | |
| WO2013191349A1 (en) | Thermococcus onnurineus na1 mutant strain with increased hydrogen productivity, and method for producing hydrogen using same | |
| CN113881675B (en) | paracoccus denitrificans ammonium salt inducible promoter | |
| CN111607608A (en) | Gene engineering high-yield strain streptomyces diastatochromogenes, method for improving yield of polylysine and application | |
| CN113817739B (en) | Paracoccus denitrificans oxygen inducible promoter | |
| CN114990043A (en) | Engineering bacterium for metabolizing lysine and construction method and application thereof | |
| CN114480388A (en) | Screening and application of novel promoter element responding to explosive molecules | |
| CN101892228B (en) | Engineering bacteria with high tolerance to acrylamide and acrylonitrile for producing nitrile hydratase and application thereof | |
| CN114941005B (en) | Recombinant expression vector, genetically engineered bacterium for degrading phenol and application of genetically engineered bacterium | |
| CN110591997A (en) | Genetic engineering bacterium for improving activity of xylonic acid dehydratase and construction method and application thereof | |
| CN115011537B (en) | Engineering bacterium for producing high optical purity L-lactic acid by double anaerobic promoters and preparation method and application thereof | |
| CN114058554B (en) | Composting pseudomonas strain and application thereof | |
| CN115851563B (en) | Engineering bacterium for electrosynthesis of 3-hydroxybutyric acid by fixing carbon dioxide and construction method | |
| CN114410556B (en) | Biosensor for responding to explosive molecules by using transcription regulatory protein, and preparation method and application thereof | |
| CN112941093B (en) | Preparation of heterotetrameric alpha 2 β 2 Blue algae PDHc E1 method | |
| CN100436579C (en) | Vitreoscilla hemoglobin gene and its uses | |
| JP3169928B2 (en) | Isolation of a Rhodobacter sphaeroides RV uptake hydrogenase (Hup) deficient strain with improved hydrogen light production efficiency | |
| CN116333959A (en) | Paracoccus denitrificans for degrading sulfamethoxazole and application thereof | |
| JP3169927B2 (en) | Isolation of polyhydroxyalkanoic acids (PHAs) -deficient strains of Rhodobacter sphaeroides RV with improved hydrogen photoproduction yield | |
| CN114134125A (en) | Preparation method and application of novel halophilic archaea nitrite reductase | |
| CN114891716A (en) | Method for improving activity of recombinant escherichia coli cells | |
| CN114854700A (en) | Catechol 1, 2-dioxygenase and its coding radical, preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |