CN113881675B - paracoccus denitrificans ammonium salt inducible promoter - Google Patents

paracoccus denitrificans ammonium salt inducible promoter Download PDF

Info

Publication number
CN113881675B
CN113881675B CN202111255374.4A CN202111255374A CN113881675B CN 113881675 B CN113881675 B CN 113881675B CN 202111255374 A CN202111255374 A CN 202111255374A CN 113881675 B CN113881675 B CN 113881675B
Authority
CN
China
Prior art keywords
ammonium salt
paracoccus denitrificans
inducible promoter
promoter
recombinant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111255374.4A
Other languages
Chinese (zh)
Other versions
CN113881675A (en
Inventor
周胜虎
邓禹
牛晓倩
赵运英
毛银
李国辉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangnan University
Original Assignee
Jiangnan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangnan University filed Critical Jiangnan University
Priority to CN202310956583.4A priority Critical patent/CN116751783A/en
Priority to CN202310944518.XA priority patent/CN117025601A/en
Priority to CN202310922440.1A priority patent/CN116732037A/en
Priority to CN202310933004.4A priority patent/CN116732038A/en
Priority to CN202310924867.5A priority patent/CN116836985A/en
Priority to CN202111255374.4A priority patent/CN113881675B/en
Publication of CN113881675A publication Critical patent/CN113881675A/en
Application granted granted Critical
Publication of CN113881675B publication Critical patent/CN113881675B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/101—Plasmid DNA for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
    • C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses an induced promoter of paracoccus denitrificans ammonium salt, and belongs to the field of synthetic biology. The invention screens out 15 promoters P which are induced by ammonium salt and can regulate and control different expression intensities from the paracoccus denitrificans genome 1849 、P rpsu 、P 2495 、P mdh 、P 1851 、P 2068 、P 4130 、P 2486 、P 2480 、P 1869 、P cs 、P rpst 、P 4462 、P nir And P 1690 The promoter is used for regulating and controlling the expression of fluorescent protein in paracoccus denitrificans, the fluorescent response value of unit OD is 9-32 times of that of the fluorescent protein in the absence of ammonium salt, and the promoter can be used as a gene expression regulating element for finely regulating and controlling gene expression and metabolic pathways, and has wide application prospect.

Description

Paracoccus denitrificans ammonium salt inducible promoter
Technical Field
The invention relates to an induced promoter of paracoccus denitrificans ammonium salt, belonging to the field of synthetic biology.
Background
Environmental protection has been paid more attention to in recent decades, and the pollution of rivers, lakes and the like cannot be effectively restrained due to the increasing force of the country, so that the pollution load of the water is continuously increased, the eutrophication problem is still serious, and the safety of drinking water is still threatened. The nitrogen pollution is difficult to control and the solution of the nitrogen pollution is quite difficult due to the reasons of wide sources of the nitrogen pollutants, complex pollution paths and processes, low treatment effect of the traditional denitrification technology, difficulty in realizing large-scale application of the new denitrification technology and the like. Biological denitrification is the most commonly used and effective method in the sewage denitrification treatment at present, and the selection of the strain with the denitrification function is the basis of biological denitrification.
In order to degrade nitrogen in complex sewage environments, it is also important to obtain efficient nitrogen degrading microorganisms, which will probably fundamentally solve the difficulties faced in the current denitrification engineering. With a thorough understanding of denitrifying microorganisms, researchers have found that there is a coupling process of heterotrophic nitrification and aerobic denitrification in some denitrifying bacteria, which are called heterotrophic nitrification-aerobic denitrification bacteria (heterotrophic nitrifying and aerobic denitrifying bacteria, HN-AD). The discovery of HN-AD bacteria provides a foundation for a single-stage denitrification process, and breaks through the traditional denitrification process of co-culturing nitrifying bacteria and denitrifying bacteria for denitrification. The paracoccus denitrificans (Paracoccus denitrificans) has the functions of nitrifying and aerobic denitrifying, and thus becomes a denitrification mode strain. The p.denstification bacteria are gram-negative bacteria, are spherical, can live under aerobic conditions and also can live in anaerobic environments, and have strong adaptability. At present, the paracoccus denitrificans not only can perform aerobic denitrification, but also can convert ammonia nitrogen into nitrite nitrogen, and has heterotrophic nitrification function. Besides the denitrification function, the P.densificans also have high degradation capability on organic pollutants, and can be applied to the biological treatment of sewage containing cyanide, pyridine, benzene and other organic pollutants and the biological restoration of polluted soil. Therefore, the P.Denitrificans has certain research value and application potential in novel biological denitrification of wastewater.
The paracoccus denitrificans genetic engineering is a means for improving the degradation of ammonia nitrogen by P.Denitrificans. However, the lack of an efficient genetic transformation system in p.dentrifics greatly limits the use of genetic engineering to degrade ammonia nitrogen in p.dentrifics. Therefore, it is necessary to establish a highly efficient genetic transformation system. Wherein the vector is the core part of the genetic transformation system, and the promoter is the key element for the efficient expression of the vector. Therefore, aiming at the important role of P.Denitrifics in biological nitrogen circulation, the excavation and functional research of the promoter of the ammonium salt induction type gene element of P.Denitrifics are carried out, which is helpful for establishing a genetic transformation system suitable for high efficiency of P.Denitrifics and improving the ammonia nitrogen degradation efficiency of P.Denitrifics.
Disclosure of Invention
The invention provides an ammonium salt inducible promoter, which has a nucleotide sequence shown in any one of SEQ ID NO.1-SEQ ID NO.15 and can start gene transcription in paracoccus denitrificans.
The invention also provides recombinant expression vectors containing ammonium salt inducible promoters that allow insertion of the gene of interest and expression of the protein from the gene of interest in bacteria.
In one embodiment, the carrier includes, but is not limited to PIND 4 。
In one embodiment, the bacteria include, but are not limited to: rhodobacter sphaeroides (Rhodobacter sphaeroides), paracoccus denitrificans (Paracoccus denitrificans) PD1222; the Paracoccus denitrificans PD1222 is disclosed in paper (purification of acid urease and identification and analysis of producing bacteria).
The invention also provides a recombinant microbial cell containing the recombinant expression vector.
In one embodiment, the host of the recombinant microbial cell is an aerobic denitrifying paracoccus DYTN-1, and the strain is disclosed in paper "efficient removal of total nitrogen in sewage by paracoccus DYTN-1" published in 2019.
The invention also provides a method for expressing the exogenous protein, which is to place the ammonium salt inducible promoter at the upstream of a target gene and culture microbial cells carrying the target gene in an environment containing ammonium salt.
In one embodiment, the method comprises: transferring a recombinant expression vector carrying an ammonium salt inducible promoter and a target gene into a microbial cell, and culturing the microbial cell in an environment containing ammonium salt.
In one embodiment, the method is to add ammonium salt to induce expression of genes after culturing the microbial cells in a medium for a period of time.
In one embodiment, the method of preparing a microbial cell comprises: transferring the recombinant expression vector into a donor strain, uniformly mixing the donor strain and an acceptor strain according to a certain proportion, enabling the donor strain and the acceptor strain to be in direct contact, and driving the recombinant vector to migrate into the acceptor to finish joint transfer in the process by the auxiliary strain.
In one embodiment, the culturing cultures the microbial cells in an ammonium salt-containing M9 medium at 30-37℃for at least 48 hours.
In one embodiment, the concentration of the ammonium salt is 1mg/L to 2g/L.
In one embodiment, the microbial cells are host with Paracoccus denitrificans DYTN-1, and are host with PIND 4 Is a carrier.
The invention also provides application of the ammonium salt inducible promoter, the recombinant expression vector, the recombinant microorganism cell or the method in regulating and controlling target protein expression.
The beneficial effects are that: the invention successfully screens 15 promoters with different expression intensities induced by ammonium salt in paracoccus denitrificans in a joint mode, which are respectively P 1849 、P rpsu 、P 2495 、P mdh 、P 1851 、P 2068 、P 4130 、P 2486 、P 2480 、P 1869 、P cs 、P rpst 、P 4462 、P nir And P 1690 The fluorescence response value of the promoter in the unit OD is 9-32 times of that of the promoter in the absence of ammonium salt, can be used as a gene expression regulating element, is used for finely regulating gene expression and a finely regulating metabolic pathway, and has wide application prospect.
Drawings
Fig. 1: recombinant expression vector PIND 4 -Pp.den-sfGFP schematic structure
Fig. 2: and comparing response intensity performances of different ammonium salt inducible promoters.
Fig. 3: p (P) 4130 And P rpsu Fluorescence response at different concentrations of ammonium salt.
Detailed Description
Restriction enzymes and DNA polymerases were purchased from the company Simerfei and Takara, respectively. Multifunctional microplate reader BioTek HT plate reader (Winooski, VT, USA) is used to detect the fluorescence intensity of the sample. Coli JM109 was used for molecular cloning, E.coli S17-1. Lambda. Pir as an auxiliary strain for the conjugation transfer of Paracoccus denitrificans DYTN-1, and Paracoccus denitrificans DYTN-1 for protein expression.
EXAMPLE 1 construction of Gene recombination vector
1. Cloning of the sfGFP Gene containing NcoI and HindIII cleavage sites from the sfGFP-containing vector pJKR-H-cdaR (from adedge) using primers F: ccatggtgcgtataggtgaagaactg and R: aagcttagaactggcatgcatctttg, the desired gene sfGFP and plasmid PIND were digested with the restriction enzymes NcoI and HindIII 4 (obtained from the national academy of sciences of military medicine, disclosed in the paper "expression of sorbose dehydrogenase in Paracoccus denitrificans") were digested separately to construct PIND 4 -sfGFP recombinant expression vector. sfGFP gene fragment and PIND 4 Enzyme digestion reaction system: 10 XQuickcut Buffer 5. Mu.L, restriction enzymes NcoI and HindIII 1. Mu.L each, sfGFP or PIND 4 The total amount was 1. Mu.g, with dd H 2 O is added to the total volume of 50 mu L, the mixture is put into a metal bath at 37 ℃ for enzyme digestion for 1h, inactivated at 80 ℃ for 15min, and the enzyme digestion result is detected by 1% agarose gel electrophoresis.
2. Purifying and recovering the gene fragment: experimental procedures refer to the instructions for use of the purification recovery kit by the manufacturer Sangon Biotech DNA.
DNA ligation: determination of the target Gene sfGFP and plasmid PIND after cleavage purification recovery 4 Is mixed at a molar ratio of 4:1, 1. Mu.LT 4 ligase, 2.5. Mu.L 10×T DNA Ligase Buffer, and dd H is added 2 O was made up to 25. Mu.L in total and was connected at 16℃for 20h.
4. Conversion: thawing competent cells E.collJM 109 taken out of a refrigerator at-80 ℃ for 10min on ice, adding 25 mu L of a connection product into the mixture, uniformly mixing the mixture, carrying out ice bath for 15min, putting the mixture into a constant-temperature water bath kettle at 42 ℃ for hot shock for 90s, quickly putting the mixture back into the ice water bath for 2min, adding 1000 mu L of LB culture medium (without antibody) into the mixture, fully mixing the mixture, resuscitating the mixture for 1h at 37 ℃ and 220r/min, finally, taking 100 mu L of resuscitated bacterial liquid, coating the resuscitated bacterial liquid on LB solid culture medium containing 50 mu g/mL of kanamycin antibiotic, culturing the mixture for 12h at 37 ℃, taking single bacterial colony out on a flat plate, picking the single bacterial colony, carrying out bacterial colony PCR (polymerase chain reaction) verification, and screening positive transformants to obtain a carrier PIND 4 -sfGFP。
5. Data by kegg (https:// www.kegg.jp /)The library was searched for the complete genomic sequence of Paracoccus denitrificans PD1222, and the p.den-1869, p.den-2486, p.den-2480, p.den-rpst, p.den-1690, p.den-nir, p.den-4462, p.den-cs, p.den-1849, p.den-2495, p.den-1851, p.den-mdh, p.den-2068, p.den-rpsu and p.den-4130 genes were searched for and analyzed to determine P 1869 、P 2486 、P 2480 、P rpst 、P 1690 、P nir 、P 4462 、P cs 、P 1849 、P 2495 、P 1851 、P mdh 、P 2068 、P rpsu And P 4130 The promoter sequence, which comprises a core region, a 5' -non-coding region (UTR) and an RBS region, can be directly connected to the upstream of the CDS region of a target gene for gene expression, and the nucleotide sequences are respectively shown as SEQ ID NO.1-SEQ ID NO. 15. Extracting genome DNA of the paracoccus denitrificans by using a genome kit of the Shanghai worker bacteria. Primers were synthesized by Jin Weizhi Biotechnology Inc., and information on the design of the primers is shown in Table 1.
Table 1 Paracoccus denitrifican promoter primer sequence information
6. Preparation of linearized vector PIND with primers F atggtgcgtataggtgaagaactg and R gcgcaacgcaattaatgtaagttag Using plasmid PIND4-sfGFP as template 4 50. Mu.L of the system for PCR amplification of sfGFP, 25. Mu.L of 2X PrimeSTAR Max DNA polymerase, 1. Mu.L of each primer F/R (10. Mu. Mol/L), 1. Mu.L of DNA template, 22. Mu.Ldd H 2 O. The amplification procedure is shown in Table 2. The PCR product is detected by 1% agarose gel electrophoresis, and the target fragment is recovered by cutting gel according to the specification of the DNA purification recovery kit.
TABLE 2 PCR amplification procedure
DNA ligation: determining the concentration of the purified and recovered promoter fragment and the linear vector, and feeding the concentration into the reactor according to a molar ratio of 3:1Mix rows, add 5. Mu.L ABclonal ligase, use dd H 2 O was made up to a total volume of 10. Mu.L and was connected at 50℃for 15 mm.
8. Conversion: thawing competent cells E.coli JM109 taken out of a refrigerator at-80 ℃ for 10min on ice, adding 15 mu L of a connection product into the mixture, uniformly mixing the mixture, carrying out ice bath for 15min, putting the mixture into a constant temperature water bath kettle at 42 ℃ for hot shock for 90s, quickly putting the mixture back into the ice water bath for 2min, adding 1000 mu L of LB culture medium (without antibody) into the mixture, fully mixing the mixture, resuscitating the mixture for 1h at 37 ℃ and 220r/min, finally, taking 100 mu L of resuscitated bacterial liquid, coating the resuscitated bacterial liquid on LB solid culture medium containing 50 mu g/mL of kanamycin antibiotic, culturing the mixture for 12h at 37 ℃, taking single bacterial colony out on a flat plate, picking the single bacterial colony, carrying out bacterial colony PCR (polymerase chain reaction) verification, and screening positive transformants to obtain a carrier PIND 4 -Pp.den-sfGFP。
EXAMPLE 2 Paracoccus denitrificans conjugation transformation
(1) The recombinant plasmid constructed in example 1 was transformed into E.coli S17-1 lambda pir competent cells by heat shock method, cultured on 50. Mu.g/mL kanamycin-resistant LB medium for 24 hours, single colony was picked up for colony verification, positive clones were transferred to LB medium and cultured at 200rpm,37℃for 12 hours to extract plasmid for sequencing verification.
(2) E.coli S17-1 lambda pir containing recombinant plasmid constructed in the step (1) is used as a donor strain, paracoccus denitrificans DYTN-1 is used as an acceptor strain, and is respectively inoculated into 2 test tubes containing 5mL of LB culture medium, and is cultured overnight at 37 ℃ to respectively obtain the bacterial body with the quantity of 10 8 cfu/mL of bacterial liquid. Both were then combined according to 3:10 are transferred into the same test tube to mix the donor and acceptor bacteria in the test tube uniformly, and the mixed culture of the donor and acceptor bacteria is placed at 37 ℃ for 30min. After the mixed culture of donor and recipient bacteria is incubated for 30min, the test tube is vigorously shaken to allow sexual bacteria Mao Duankai between the donor bacteria and recipient bacteria, thereby stopping the dispatch transfer of genes. And (3) sucking 0.1mL of bacterial liquid, coating the bacterial liquid on a corresponding resistance flat plate for two days, culturing, picking single bacterial colonies, and shaking bacteria to identify positive clones.
EXAMPLE 3 Paracoccus denitrificans ammonium salt inducible promoter to regulate GFP expression
M9 Medium, glycerol 4g/L, naCl 0.5g/L, KH 2 PO 4 3.0g/L，Na 2 HPO 4 6.78g/L，CaCl 2 0.115g/L，MgSO 4 0.24g/L, 1g/L of ammonium chloride or 1g/L of peptone; wherein glycerol is used as a carbon source, and peptone or ammonium chloride is used as a nitrogen source. When ammonium chloride is used as a nitrogen source, the ammonium chloride is used as an inducer; when peptone was used as a nitrogen source, a control was used.
The recombinant vector-containing Paracoccus denitrificans positive colonies constructed in example 2 were activated overnight, inoculated into a submerged well plate containing 2mLM medium at an inoculum size of 2%, cultured at 30℃and 200rpm for 48 hours, and then sampled and collected to obtain supernatants, which were appropriately diluted with PBS buffer to ensure OD 600 Fluorescence was measured at 37℃at room temperature using a BioTek HT plate reader (VT, winioski, USA) in the range of 0.2-0.8 at excitation wavelength of 485.+ -. 20nm and emission wavelength of 528/20 nm. Finally, by putting OD 600 And the fluorescence divided to normalize the fluorescence. As shown in FIG. 2, the 15 promoters with different expression intensities induced by ammonium salt obtained by screening in examples 1-2 can make the fluorescence response value of the unit OD of paracoccus denitrificans 9-32 times under the condition of ammonium salt induction than that under the condition of no ammonium salt, and the results show that the promoters screened by the invention are greatly influenced by ammonium salt and have excellent expression efficiency under the condition of ammonium salt induction.
EXAMPLE 4 expression of Paracoccus ammonium salt inducible promoters at different ammonium salt concentrations
The specific embodiment is the same as in example 3, except that the ammonium chloride concentration in the medium was adjusted to 1, 5, 10, 25, 50, 75, 100, 250, 500, 750, 1000, 2000mg/L, respectively, and the results showed that promoter P per unit OD 4130 The fluorescence response value can reach 283 when the concentration of ammonium chloride is 500mg/L, and the promoter P of unit OD rpsu The fluorescence response value can reach 1176 at the concentration of 100mg/L of ammonium chloride.
While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> university of Jiangnan
<120> Paracoccus denitrificans ammonium salt inducible promoter
<130> BAA211168A
<160> 15
<170> PatentIn version 3.3
<210> 1
<211> 220
<212> DNA
<213> artificial sequence
<400> 1
accgcggcaa tgacgaaccc gccctgcgct tcctgcaaga gggcgatcct gcggccatgg 60
cggcgaaaat cgccctcgca cggtccgtcg gcgttgtcat ttcggccggt cttggtatct 120
tgggggtgac tccggccaaa gaaatgcgct gaagaacggc gccttgccgg ggacgagcag 180
ataaacgagc agcgtcggga caaccggcag gcaggcagga 220
<210> 2
<211> 230
<212> DNA
<213> artificial sequence
<400> 2
gggcggcctg ttcctgtgcg gcgaccgcaa gcggcccaag gacaagggcc agggctgccg 60
aggccagtag gccgggtctg gcgaatgggg tcctttgtct catctggctt tcctatttgc 120
tggcgcgcgt tcacgccgtt cctgggcgca atccgcgcgc ggggctttga cctttgttaa 180
ggccgaggtg cggcatttgc gcgatcagcg ggacgaaccc tgggacgcgg 230
<210> 3
<211> 400
<212> DNA
<213> artificial sequence
<400> 3
tcctcagcgc ctgcaaggat ttcgacgagc cgatgggcgc cgcgatcgaa cggcgcatcg 60
ccgggctgag gccgcgcttc tatacccggc ttggcgcggg tatccgccat gcctcggccg 120
ggctttcggc gcaggccagc agccggcggc tgcttctggt catcaccgac ggcaagccca 180
acgacctgga ccattacgag ggccgccacg gcatcgagga cagcgccatg gcggtgcgcg 240
aggcgcgacg ggccggccat gccgtgcatg gcatcaccgt ggatcgcgac gcgaaaagct 300
ggtttccccg catctttggc cagggcggct tttcgctgat cccgcatccc gaccggctgc 360
tggcggcgct gccggtgatc tatcggcaac tggtggcgtg 400
<210> 4
<211> 220
<212> DNA
<213> artificial sequence
<400> 4
cgaggaccag aaagagggca tggccgcctt tctggaaaag cgcgagccgc aattccgcga 60
ccgctgattt cgcgcttggc atccggcccg gatcgctgta taggcccggg cttacatgcg 120
tgtgggcccg cttaaaggca agaatcatga ccgtccgttc ccggacggcg ccatgggctt 180
ttgcgcaacc gagatatgaa gaacagatag gaccgcaccc 220
<210> 5
<211> 280
<212> DNA
<213> artificial sequence
<400> 5
ccgtcctgat gcgactggtt gaacaggtcg cggatttccg ggttctggaa catgcgcgca 60
tacatttcac gcacgatatc aagaccatga gcctcgatcg cggggacggt ggctttgacc 120
agcgcaatgg tctgcgcgct caagggctgc ggcattcggc ttctcctgca aggttgcgcg 180
gcagggttcc cggccgcgac tcaaaaacat gtattctgga tacatctatc cttgccgcca 240
gaaacatgca atcaggatgc atgttttatc ggagaccgcg 280
<210> 6
<211> 92
<212> DNA
<213> artificial sequence
<400> 6
aagaattgac tcgcgcccgg attctgccta tgtgacccgc aaccgccgtc cggtggggtt 60
tttcctgaca cagttttctg cgcggaccga tc 92
<210> 7
<211> 160
<212> DNA
<213> artificial sequence
<400> 7
tcggcgacgg caagatcttc atcctgccgg tcgaacaggc catccgcatc cgcaccggcg 60
agaccggcga cgacgcggtc tgatcccgcc cacccgcacc atgaaccaat gacccatgcc 120
cggcggcggc gccgggcaga ctgatggagg aaggatccca 160
<210> 8
<211> 220
<212> DNA
<213> artificial sequence
<400> 8
ggccgccaag cagataggcg agtcgcacgg tctggggctg ggcaaggtgg cggcgccgct 60
tcgtgcggcc ctcgcggggc gcagttcgac ccctagcgtg ttcgatatga tgttggcgct 120
tggccgcgac gaaacgctgg cccggatgca ggatcaagcg ggctgagacc cgcgcccatc 180
acccggcccg cgggccggag acaggtgaaa ggaactggga 220
<210> 9
<211> 400
<212> DNA
<213> artificial sequence
<400> 9
cagcacgcgc aggaacatga tccccgccgc cagcatgatg atcagggcgt tgaccagata 60
cgcgagatca tcgggtcgcg cataattggc cgcgatcgcg gccaggaccg cgatcgtgcc 120
cagcgcgatc agcttgatgg tgtccaacat gaattcgtgt ccttaaatcc tgcgccgaag 180
gcggccgatt cgcacgaaat gcgacgggaa cgcggctccg acagctaact tctaacgtca 240
cacggtttcg tgagactttg atctgcgtca atctgtcatt gctggatagg tgtaaaatcc 300
cggaatatct ggacaggatg tcgcagccgc cccccggcaa cgattgcgat cctgccggat 360
gcaggtgaaa cttgcgccga accccgaaag gagagggccc 400
<210> 10
<211> 280
<212> DNA
<213> artificial sequence
<400> 10
catcctcgag ctgctgggtc agcccggcca tgccggcgac caccgaggcc acgaaatcca 60
tccggtcgcc ggcccagacc acgacctgtc ccgcctcgta gcggcgatag aatttcatct 120
cctccagttc ggtcagctca tcgccttcgc aatgtgcgca aacggcccga taccgtatcg 180
gacaaatctc gcagggctgc tgcgtcgcgc agagggcggc gtcatgtggc atttgatttg 240
ggtcaaggtt ccagcgcgtg ttccgcggca ggatagcagt 280
<210> 11
<211> 396
<212> DNA
<213> artificial sequence
<400> 11
cagccgtcgc ccatctgcgc gcgcatctgg aggcgtgggg cggcaactcc tcgggcctgg 60
gcgtcggcaa tatcgacccg cagggcaagg tccatcccga cacctactgg tcggactaca 120
cgctgggctc ggtcaaggag cggccgttct cggcgatctg gaccggggac gacccgatcc 180
tggccacgct gcgcacccgg ccgcggccgc tgaaggggcg ctgcggcgcc tgcgcctatc 240
aggcggtctg cggcggcaat acccgcatcc gggcgctgca actgaccggc gatccatggg 300
ccgaggatcc ggcctgctat ctctcgggct ccgagatcgg cgcagaaggt gctgacctgg 360
accgccttgc cgtcacgcct ttccggggaa aaagcc 396
<210> 12
<211> 220
<212> DNA
<213> artificial sequence
<400> 12
gcgatcaccg ccagcaccca gcccagcatc tccatcggtg cgctccttcg tccctgaccc 60
cggactaatc cagcgccggg ccggcggcaa tgcgggacgg gtttgccctg ttagcggttg 120
acaacggccg attttgcgcc cggcacgcag ccaaggcttg cgattctcat cccgagggac 180
tacgccaccg cgcgaaccat catggaaatc ggaggttaac 220
<210> 13
<211> 214
<212> DNA
<213> artificial sequence
<400> 13
gcgacacgga gcggttctgg gacccggacg gttggcagcc gctctgtgcc agctgtcaca 60
gtcgcaagac cgcgagcgag gatggcggct tcggcaacgc ccgccgccaa ccataaacca 120
ccgccccccg gggggagggt aaatctctgg ggccttccag ccccggaccg ggcgccaagc 180
tttctgcatc cgcggccaaa atggcgaggg gggg 214
<210> 14
<211> 220
<212> DNA
<213> artificial sequence
<400> 14
gagcttcatt tcacggaaca ccccctcgcg ctgaagtttt ttcttcagag cacgaagcgc 60
ctgttcgacg ttgttgtcgc gaacacttac ctgcatgtgg ttgtcaccac cttcctaggt 120
taaagttgag cagatttgca ggacgcggcc ttctagcaag gcgaatcggc tttgtccaga 180
ttttccgggc ccgcgcggca tgaagaatga ggagagtgcc 220
<210> 15
<211> 310
<212> DNA
<213> artificial sequence
<400> 15
tggcgcagat cgcgcatgag ctttggggca cgcccgcgcc ggatgtgccg cagggcgcgc 60
ggctggccga ggcagtggcc gagcattacg acgacatcct gtcgctttac gggcgcgaac 120
tggggctgcg cgtcgcccgc aagcacctgg gctggtatgc cgaggcgaac ggcgccccga 180
accgcgccga gcttctgcgc gcgcccacgc ccgaggccgc gctggccgcg atccgggccg 240
gcttcggcga tgccgatgcc gcgccgggcg atgcggtcca tgccaacgca caggcgaccg 300
aggtgccttc 310

Claims (10)

1. The ammonium salt inducible promoter is characterized in that the nucleotide sequence is shown as SEQ ID NO. 1.
2. A recombinant expression vector comprising the ammonium salt inducible promoter of claim 1.
3. A recombinant microbial cell comprising the recombinant expression vector of claim 2.
4. The recombinant microorganism according to claim 3, wherein the host comprises Paracoccus denitrificansParacoccus denitrificans）。
5. The recombinant microorganism according to claim 3, wherein Paracoccus denitrificans DYTN-1 is used as host and PIND is used as host 4 Is a carrier.
6. A method for increasing the expression level of a protein, comprising placing the ammonium salt-inducible promoter of claim 1 upstream of a target gene, and culturing microbial cells carrying the target gene in an environment containing ammonium salt.
7. The method of claim 6, wherein the microbial cells are host Paracoccus denitrificans DYTN-1 in PIND 4 Is a carrier.
8. The method according to claim 6, wherein the culturing is performed by culturing the microbial cells in an M9 medium containing ammonium salt at 30-37℃for at least 48h.
9. The method according to any one of claims 6 to 8, wherein the concentration of the ammonium salt is 1mg/L to 2g/L.
10. Use of the ammonium salt inducible promoter of claim 1, the recombinant expression vector of claim 2, the recombinant microbial cell of any one of claims 3 to 5 or the method of any one of claims 6 to 9 for increasing expression of a protein of interest.
CN202111255374.4A 2021-10-27 2021-10-27 paracoccus denitrificans ammonium salt inducible promoter Active CN113881675B (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
CN202310956583.4A CN116751783A (en) 2021-10-27 2021-10-27 Ammonium salt-induced Paracoccus denitrificans promoter P1690
CN202310944518.XA CN117025601A (en) 2021-10-27 2021-10-27 Paracoccus denitrificans endogenous ammonium salt inducible promoter
CN202310922440.1A CN116732037A (en) 2021-10-27 2021-10-27 Paracoccus denitrificans-derived promoter Pcs
CN202310933004.4A CN116732038A (en) 2021-10-27 2021-10-27 Paracoccus denitrificans ammonium salt inducible promoter Pnir
CN202310924867.5A CN116836985A (en) 2021-10-27 2021-10-27 Paracoccus denitrificans ammonium salt inducible promoter Prpst
CN202111255374.4A CN113881675B (en) 2021-10-27 2021-10-27 paracoccus denitrificans ammonium salt inducible promoter

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111255374.4A CN113881675B (en) 2021-10-27 2021-10-27 paracoccus denitrificans ammonium salt inducible promoter

Related Child Applications (5)

Application Number Title Priority Date Filing Date
CN202310924867.5A Division CN116836985A (en) 2021-10-27 2021-10-27 Paracoccus denitrificans ammonium salt inducible promoter Prpst
CN202310956583.4A Division CN116751783A (en) 2021-10-27 2021-10-27 Ammonium salt-induced Paracoccus denitrificans promoter P1690
CN202310944518.XA Division CN117025601A (en) 2021-10-27 2021-10-27 Paracoccus denitrificans endogenous ammonium salt inducible promoter
CN202310922440.1A Division CN116732037A (en) 2021-10-27 2021-10-27 Paracoccus denitrificans-derived promoter Pcs
CN202310933004.4A Division CN116732038A (en) 2021-10-27 2021-10-27 Paracoccus denitrificans ammonium salt inducible promoter Pnir

Publications (2)

Publication Number Publication Date
CN113881675A CN113881675A (en) 2022-01-04
CN113881675B true CN113881675B (en) 2023-08-22

Family

ID=79013776

Family Applications (6)

Application Number Title Priority Date Filing Date
CN202111255374.4A Active CN113881675B (en) 2021-10-27 2021-10-27 paracoccus denitrificans ammonium salt inducible promoter
CN202310956583.4A Pending CN116751783A (en) 2021-10-27 2021-10-27 Ammonium salt-induced Paracoccus denitrificans promoter P1690
CN202310933004.4A Pending CN116732038A (en) 2021-10-27 2021-10-27 Paracoccus denitrificans ammonium salt inducible promoter Pnir
CN202310922440.1A Pending CN116732037A (en) 2021-10-27 2021-10-27 Paracoccus denitrificans-derived promoter Pcs
CN202310924867.5A Pending CN116836985A (en) 2021-10-27 2021-10-27 Paracoccus denitrificans ammonium salt inducible promoter Prpst
CN202310944518.XA Pending CN117025601A (en) 2021-10-27 2021-10-27 Paracoccus denitrificans endogenous ammonium salt inducible promoter

Family Applications After (5)

Application Number Title Priority Date Filing Date
CN202310956583.4A Pending CN116751783A (en) 2021-10-27 2021-10-27 Ammonium salt-induced Paracoccus denitrificans promoter P1690
CN202310933004.4A Pending CN116732038A (en) 2021-10-27 2021-10-27 Paracoccus denitrificans ammonium salt inducible promoter Pnir
CN202310922440.1A Pending CN116732037A (en) 2021-10-27 2021-10-27 Paracoccus denitrificans-derived promoter Pcs
CN202310924867.5A Pending CN116836985A (en) 2021-10-27 2021-10-27 Paracoccus denitrificans ammonium salt inducible promoter Prpst
CN202310944518.XA Pending CN117025601A (en) 2021-10-27 2021-10-27 Paracoccus denitrificans endogenous ammonium salt inducible promoter

Country Status (1)

Country Link
CN (6) CN113881675B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111718936A (en) * 2020-06-30 2020-09-29 江南大学 Ammonium salt inducible promoter and application thereof in regulating and controlling expression of target gene

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111718936A (en) * 2020-06-30 2020-09-29 江南大学 Ammonium salt inducible promoter and application thereof in regulating and controlling expression of target gene

Also Published As

Publication number Publication date
CN117025601A (en) 2023-11-10
CN116732037A (en) 2023-09-12
CN116836985A (en) 2023-10-03
CN113881675A (en) 2022-01-04
CN116732038A (en) 2023-09-12
CN116751783A (en) 2023-09-15

Similar Documents

Publication Publication Date Title
WO2021042460A1 (en) Application of transport carrier gene which improves l-tryptophan production efficiency in escherichia coli
WO2013132518A1 (en) Recombinant nitrogen fixing microorganism and uses thereof
CN113528476B (en) Glucose oxidase mutant and coding gene and efficient recombinant expression thereof
CN113881675B (en) paracoccus denitrificans ammonium salt inducible promoter
US20220411837A1 (en) Recombinant methanotrophic bacteria for indigo biosynthesis and methods thereof
WO2013191349A1 (en) Thermococcus onnurineus na1 mutant strain with increased hydrogen productivity, and method for producing hydrogen using same
CN113881676B (en) Paracoccus denitrificans nitrate inducible promoter
CN113817739B (en) Paracoccus denitrificans oxygen inducible promoter
CN112877304B (en) Construction and application of bacterial laccase mutant LacAT and expression strain thereof
CN114941005B (en) Recombinant expression vector, genetically engineered bacterium for degrading phenol and application of genetically engineered bacterium
CN101892228B (en) Engineering bacteria with high tolerance to acrylamide and acrylonitrile for producing nitrile hydratase and application thereof
Gou et al. Desulfurization metabolite of Rhodococcus erythropolis LSSE8-1 and its related desulfurizational gene fragments
CN112680464B (en) Monomethylarsenic and trivalent antimony oxidase gene arsV, and protein coded by same and application thereof
JP3169928B2 (en) Isolation of a Rhodobacter sphaeroides RV uptake hydrogenase (Hup) deficient strain with improved hydrogen light production efficiency
EP1016725B1 (en) Plasmids originating in ammonia oxidizing bacteria and use of the same
CN116333959A (en) Paracoccus denitrificans for degrading sulfamethoxazole and application thereof
JP4131028B2 (en) Plasmid derived from ammonia oxidizing bacteria and use thereof
JP3169927B2 (en) Isolation of polyhydroxyalkanoic acids (PHAs) -deficient strains of Rhodobacter sphaeroides RV with improved hydrogen photoproduction yield
CN117448351A (en) SufB gene with saline-alkali tolerance capability, expression vector and application thereof
CN118421669A (en) Strain for producing indigo, construction method and application thereof
Xing et al. Continuous hydrogen production of auto-aggregative Ethanoligenens harbinense YUAN-3 in a continuous stirred-tank reactor
GB2591209A (en) High-Throughput screening method of lysine decarboxylase
CN114134125A (en) Preparation method and application of novel halophilic archaea nitrite reductase
CN118126919A (en) Engineering bacterium for synthesizing ceruloplasmic reticulum and construction method and application thereof
CN116064521A (en) PH-induced promoter derived from bacillus amyloliquefaciens and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant