CN114134125A

CN114134125A - Preparation method and application of novel halophilic archaea nitrite reductase

Info

Publication number: CN114134125A
Application number: CN202110593384.2A
Authority: CN
Inventors: 崔恒林; 殷雪矇; 侯靖
Original assignee: Jiangsu University
Current assignee: Jiangsu University
Priority date: 2021-05-28
Filing date: 2021-05-28
Publication date: 2022-03-04
Anticipated expiration: 2041-05-28
Also published as: CN114134125B

Abstract

The invention belongs to the field of genetic engineering, and relates to a preparation method and application of a novel halophilic archaea nitrite reductase; the method comprises the following steps: firstly, obtaining a coding gene nirK based on the genome of halophilic archaea (Haloterrigeno sp.) KZCA68-1_Htg(ii) a nirK was generated by molecular cloning techniques_HtgConnecting to a vector to construct a recombinant plasmid; will be provided withTransforming the recombinant plasmid into an archaeohalophilic host, culturing the transformed recombinant host cell in an Hv-YPC liquid culture medium to a stable stage, centrifugally collecting the thallus at a low temperature, carrying out heavy suspension in a cell lysate, and collecting a supernatant through ultrasonic crushing and centrifugation for recombinant protein purification; purifying by nickel affinity chromatography and gel filtration chromatography to obtain high-purity reductase, which is recorded as NirK_Htg. NirK obtained by the invention_HtgHas good enzymological characteristics, and can degrade nitrite in the processes of high-salt pickling of food, waste water treatment and the like.

Description

Preparation method and application of novel halophilic archaea nitrite reductase

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to a preparation method and application of novel halophilic archaea nitrite reductase.

Background

Nitrite is widely used as a food additive in food, especially various high-salt foods. Excessive intake of nitrite can cause chronic carcinogenesis and acute poisoning, and controlling nitrite within safety limits is a research hotspot at home and abroad at present. The method for degrading nitrite by using nitrite reductase has the characteristics of high efficiency, health and the like, and is the most common method at present. At present, nitrite reductase is mostly derived from lactic acid bacteria, has low tolerance to salt and limits the application in the high-salt food industry.

Halophilic archaea is an extreme microorganism depending on a high-salt environment, and is a good microbial source of salt-tolerant nitrite reductase. The research on halophilic archaea nitrite reductase is limited at present, and is mainly limited by complicated preparation steps and low yield of pure enzyme.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provides a novel gene of halophilic archaea nitrite reductase and a preparation method of the halophilic archaea nitrite reductase.

The invention obtains a novel gene of halophilic archaea nitrite reductase based on the genome of a halophilic archaea Haloterrigena sp.KZCASC 68-1, and the gene is named nirK_HtgThe nucleotide sequence is shown as SEQ ID NO.1, and the amino acid sequence is shown as SEQ ID NO. 2; based on nirK_HtgThe coded novel halophilic archaea nitrite reductase is named as NirK_Htg。

In order to achieve the above object, the present invention comprises the steps of:

(1) construction of pTA04-nirk_HtgRecombinant expression plasmid:

firstly, a novel nitroso of halophilic archaea is obtained based on the genome of halophilic archaea Haloterrigea sp.KZCAC 68-1Gene nirK of acid salt reductase_HtgFurther designing target fragment primers containing restriction enzyme sites EcoRI and BamHI, and amplifying target fragment nirK by using conventional PCR technology_Htg(ii) a nirK was generated by molecular cloning techniques_HtgConnecting to pTA04 vector to construct recombinant plasmid;

(2) transformation of halophilic archaea haloferrocyni volcanii:

transforming the recombinant plasmid successfully constructed in the step (1) into a halophilic archaea host to obtain a transformed recombinant host cell; the host is a strain Halofarax volcanii;

inoculating the transformed recombinant host cell into an Hv-YPC liquid culture medium for activation culture to obtain a culture solution after culture; inoculating the culture solution into an Hv-YPC liquid culture medium, performing shake-flask culture to a stationary phase, further centrifuging, collecting thalli, and storing at low temperature for later use;

(3) purification of recombinant nitrite reductase:

collecting the thalli stored in the step (2) in cell lysis solution for resuspension, ultrasonically breaking cells after resuspension, collecting supernatant fluid after centrifugation, namely crude enzyme solution, and using the crude enzyme solution for recombinant protein purification; firstly, obtaining target protein containing imidazole by adopting nickel column affinity chromatography purification; finally, the imidazole is removed by gel filtration chromatography to obtain the halophilic archaea nitrite reductase with high purity, which is recorded as NirK_Htg。

Preferably, the halophilic archaea (Haloterrigeno sp.) KZCA68-1 in the step (1) is preserved in China general microbiological culture Collection center with the strain preservation number of CGMCC 22195 and the preservation date: 2021, 4 and 16 months.

Preferably, the Halofax volcanii in step (2) is purchased from the Japanese Collection of Microorganisms (JCM) under the accession number: JCM 8879.

Preferably, the composition of the Hv-YPC medium in step (2) is (per liter): 5.0g yeast extract, 1.0g soybean peptone, 1.0g acid hydrolyzed casein, 4.2g KCl, MgSO₄·7H₂O 33.0g，MgCl₂·6H₂O 30.0g，NaCl 144.0g，1M Tris-HCl(pH 8.0)12.0mL，CaCl₂0.33g (predissolved in water, added after dissolution) of the aboveThe above components are dissolved in 1L distilled water, pH is adjusted to 7.5, and sterilization is carried out for 30min at 115 ℃.

Preferably, the conditions of the activation culture in the step (2) are as follows: culturing at 37 ℃ and 180rpm for 3-4 days.

Preferably, the temperature for cryopreservation in step (2) is-20 ℃.

Preferably, the specific operation of the nickel column affinity chromatography purification in the step (3) is as follows: firstly, 20 times of bed volume of lysine buffer is used for balancing the nickel column; loading the centrifuged supernatant; then eluting the hybrid protein by using a buffer solution I; eluting the target protein by using the buffer solution II to obtain the target protein containing imidazole.

Preferably, the lysine buffer component is 2M NaCl, 20mM Tris-HCl, pH 8.0.

Preferably, the buffer I component is 2M NaCl, 20mM Tris-HCl, 40mM imidazole, pH 8.0.

Preferably, the buffer II component is 2M NaCl, 20mM Tris-HCl, 250mM imidazole, pH 8.0.

Preferably, the gel filtration chromatography in the step (3) is performed by using

pure protein isolation and purification System, HiTrap^TMRemoving imidazole with Desaling (5mL) chromatographic column, and performing gel filtration chromatography with lysine buffer as mobile phase to obtain high-purity halophilic archaea nitrite reductase, i.e. NirK_Htg。

The novel halophilic archaea nitrite reductase NirK prepared by the invention_HtgCan be used for degrading nitrite in the processes of high-salt pickled food, wastewater treatment and the like.

The invention also provides the NirK_HtgThe characterization of the enzymology properties of (1) specifically comprises the optimum temperature and the temperature stability; the optimum NaCl concentration and the stability of the NaCl concentration; optimal pH and pH stability; scanning at full wavelength; organic solvent resistance; determination of metal ion tolerance and enzyme kinetic parameters.

With NaNO₂As substrate, NirK_HtgThe optimum reaction conditions of (A) are 35 ℃, 1.5M NaCl andpH 6.0; the high-salt-content sodium alginate has good thermal stability at 30 ℃ and 60 ℃, better tolerance to low-salt environment and high-salt environment, and better pH stability at pH 6.0 and pH 7.5; the methanol, the ethanol, the Tween 80, the Tween 20, the glycerol and the DMF (dimethylformamide) can promote the NirK to different degrees_HtgThe enzyme activity of (a); for Mg²⁺、Ca²⁺、Sr²⁺、Mn²⁺And Cu²⁺Has good tolerance. The full-wavelength scanning result shows that the absorption peaks at 460 nm, 586nm and 952nm, wherein the absorption value at 586nm is the maximum, so the NirK_HtgIs a blue copper-type nitrite reductase. With NaNO₂As substrate NirK_HtgMaximum reaction rate V_max74970 μ g/min/mg with a kinetic constant K_mIt was 1.285 mM.

The invention has the advantages and technical effects that:

(1) the invention discloses a novel halophilic archaea nitrite reductase gene, expresses a novel halophilic archaea nitrite reductase and provides a preparation method of the halophilic archaea nitrite reductase. Compared with the traditional halophilic archaea nitrite reductase purification method, the method has simpler purification steps, and the obtained nitrite reductase has high purity.

(2)NirK_HtgHas good enzymology characteristics, has better universality to temperature, pH and salinity, can resist various metal ions and organic solvents, and has excellent properties of novel halophilic archaea nitrite reductase NirK_HtgCan be applied to degrading nitrite in the processes of high-salt pickled food, wastewater treatment and the like.

Drawings

FIG. 1 shows the restriction enzyme digestion verification of the successfully constructed plasmid.

FIG. 2 shows NirK after nickel column purification_HtgSDS-PAGE patterns of (5).

FIG. 3 shows NirK_HtgGel filtration chromatography.

FIG. 4 is a graph of reaction temperature versus NirK_HtgThe effect of activity.

FIG. 5 is NaCl concentration vs. NirK_HtgThe effect of activity.

FIG. 6 is pH vs. NirK_HtgThe effect of activity.

FIG. 7 shows NirK_HtgStability at different temperatures.

FIG. 8 shows NirK_HtgStability under different pH conditions.

FIG. 9 shows NirK_HtgStability at different NaCl concentrations.

FIG. 10 shows metal ion pairs NirK_HtgThe effect of activity.

FIG. 11 is the organic solvent couple NirK_HtgThe effect of activity.

FIG. 12 is NirK_HtgFull wavelength scan of (a).

Detailed Description

The invention is further described with reference to the drawings and the detailed description.

KZCASI 68-1 is screened by the inventor and is separated from the salt lake of Kunzcheng mistaka in the autonomous region of Xizang in 2018, 9 months and 9 days; the Queen-Sec salt lake is located in the autonomous region of Tibet, the elevation of the lake surface is 4347 meters, the longitude and latitude are 33 degrees 08'N, and the longitude and latitude are 80 degrees 39' 1E.

Example 1:

halophilic archaea nitrite reductase NirK_Htg(ii) heterologous expression of (a);

(1) amplification of target genes by PCR

A small amount of Haloterrigena sp.KZCAS68-1 thallus is taken to be put into 30 mu L of sterile double distilled water and boiled for 10min, and the obtained product is used as a DNA amplification template. The sequence of a forward primer F of the specific primer is (5'-ATAGAATTCACCCTAACTACAGCCAAC-3'), the sequence of a reverse primer R of the specific primer is (5 'ATAGGATCCCGCGTCCTCGTCGTAGAG-3'), and the restriction sites are EcoRI and BamHI.

PCR amplification System (25. mu.L):

PCR amplification procedure:

and (3) detecting the PCR product under an ultraviolet lamp after electrophoresis of 1% agarose gel, cutting off a target fragment, and recovering DNA by using a DNA gel recovery kit.

(2) Double enzyme digestion and purification of target gene and vector

The recovered target gene and pTA04 vector were digested simultaneously with EcoRI and BamHI restriction enzymes (purchased from TaKaRa) in a water bath at 37 ℃ for 30 min. And purifying the enzyme digestion product by using a DNA gel recovery kit to obtain the purified target gene.

(3) Ligation and transformation of E.coli DH5 alpha

The purified target gene and pTA04 vector were ligated by using T4 DNA ligase (available from Takara Co.) at 16 ℃ for 1 hour.

Ligation system (10 μ L):

add 10. mu.L of the ligation into 100. mu.L of E.coli DH 5. alpha. competence; ice-bath for 30min, heat shock for 90s at 42 ℃ and ice-bath for 2min, adding 500 microliter LB liquid culture medium, resuscitating at 37 ℃ for 45 min-1 h at 180rpm, centrifuging at 6000rpm for 3min, discarding 500 microliter of supernatant, blowing off the residual bacterial liquid, coating on LB plate containing ampicillin, and culturing overnight at 37 ℃.

(4) Plasmid extraction

Transformants were picked and grown on LB plates containing ampicillin and verified by PCR. And (3) carrying out amplification culture on the positive transformant which is verified to be correct in an LB liquid culture medium containing ampicillin, and extracting plasmid enzyme digestion verification by using a plasmid DNA miniprep kit. The reaction conditions are as follows: the plasmid was digested simultaneously for 30min in a water bath at 37 ℃ with EcoRI and BamHI restriction enzymes (from TaKaRa) as follows:

enzyme digestion system (10 μ L):

the agarose gel electrophoresis was performed for verification, as shown in FIG. 1, wherein lanes 1-2 represent the extracted plasmids, and lane M represents the DNA marker; lanes 3-4 show the plasmid double digestion results. Successfully constructed plasmids were stored at-20 ℃ for subsequent transformation.

Example 2:

transforming halophilic archaea Halofarax volcanii;

inoculating the strain Halofax volcanii into an Hv-YPC liquid culture medium (thymine is added into the culture medium to enable the final concentration to be 40 mu g/mL), preparing a protoplast by using thalli growing to the middle logarithmic phase, then converting the recombinant plasmid into Halofax volcanii by using a PEG mediated conversion method, selecting a red transformant, and carrying out PCR verification; after PCR verification, the obtained positive transformant is the transformed recombinant host cell;

the obtained positive transformant was inoculated into an Hv-YPC liquid medium (inoculum size 1%, m/v), cultured at 37 ℃ and 180rpm for 3 days to obtain a culture solution, inoculated into 200mL of the Hv-YPC liquid medium at an inoculum size of 1% (v/v), shake-cultured to a stationary phase, and then centrifuged to collect the cells, which were stored at-20 ℃.

Example 3:

NirK purified by nickel column affinity chromatography_Htg；

(1) Resuspending the thallus collected in example 2 in 30mL lysine buffer, carrying out ultrasonic cell disruption treatment, centrifuging and collecting supernatant, namely crude enzyme solution;

(2) run off the column stock solution (20% ethanol) using 10 bed volumes of ddH₂Washing the column with O, and balancing the column with lysine buffer with 10 times of the volume of the column bed;

(3) passing the crude enzyme solution sample through a chromatographic column for three times;

(4) the column was then washed with 25mL of buffer I to remove non-specifically bound contaminating proteins.

(5) Then 10mL of buffer II is used for eluting the column, and the eluent (1mL per tube), namely the target protein containing imidazole, is collected in tubes and stored at 4 ℃, and the SDS-PAGE analysis and the enzyme activity determination are carried out on the eluent.

As shown in FIG. 2, the lanes are indicated as lane M: pre-staining a Marker with protein; lane 1: intracellular supernatant before passing through a nickel column; lane 2: discharging liquid after passing through a nickel column; lane 3: 40mM imidazole-eluting heteroprotein; lane 4: tube 2 eluted with 100mM imidazole; lane 5: sample solution in tube 2 eluted with 250mM imidazole; lane 6: sample solution of tube 9 eluted by 250mM imidazole; lane 7: sample solution in tube 2 eluted by 500mM imidazole; lane 8: sample solution in tube 9 eluted by 500mM imidazole; lane 9: 1M imidazole elute.

Example 4:

removing imidazole by gel filtration chromatography;

(1) sample pretreatment

The imidazole-containing target protein of example 3 was concentrated to 600. mu.L using a Millipore ultrafiltration tube having a molecular weight cut-off of 10kDa, and after the concentration, the sample was filtered through a 0.22 μm filter, centrifuged at 10000rpm for 5min, and the supernatant was collected for use.

(2) Gel filtration chromatography

The above supernatant was subjected to gel filtration chromatography to remove imidazole. Gel filtration chromatography Using AKTA pure protein isolation and purification System, HiTrap^TMDesaling (5mL) column, collecting the eluate (1 mL/tube) at a fixed volume, i.e., NirK_HtgFor subsequent characterization of the enzymatic properties (FIG. 3).

Example 5: (Performance test):

NirK_Htgmeasuring enzyme activity;

(1) measurement method

Reaction system (250 μ L):

the experimental group and the control group are respectively provided with three groups in parallel; the control group had no enzyme added.

After reaction in a water bath at 40 ℃ for 10min, the reaction was terminated by vigorously shaking with a shaker until the dark blue color faded. The reaction was diluted 200-fold to 10 mL. Adding 200 μ L reagent 1, mixing, reacting for 4 min; then 200. mu.L of reagent 2 is added, mixed evenly and reacted for 30min in dark. The absorbance was measured at 540 nm.

(2) Definition of enzyme activity unit:

the amount of enzyme required to reduce nitrite at 1. mu.g per minute was one unit of enzyme activity (U).

(3) The enzyme activity calculation formula is as follows:

y: enzyme activity (U)

X1: nitrite content (mM) before enzyme reaction

X2: nitrite content (mM) after enzyme reaction

Specific enzyme activity (U/mg) is defined as the number of units of enzyme activity per weight (mg) of protein.

The results showed that the specific enzyme activity was 1012.79U/mg when measured at 2M NaCl, 40 ℃ and pH 8.0.

Example 6:

NirK_Htgdetermining the optimal reaction condition;

the reaction system was the same as in example 5; the optimum reaction temperature is specifically: the reaction temperature is 30-85 ℃, and the enzyme activity of the nitrite reductase at different temperatures is measured in a buffer solution with the final NaCl concentration of 2M and the pH value of 7.5. The results show that NirK_HtgThe optimum reaction temperature of (2) was 35 ℃ (FIG. 4).

The optimum NaCl concentration is specifically: the final NaCl concentrations in the reaction system were 0M, 0.5M, 1.0M, 1.5M, 2.0M, 2.5M, 3.0M, 3.5M, and 4.0M, respectively, and the reaction was carried out at the optimum temperature and pH 7.5. The enzyme activity of nitrite reductase in systems with different NaCl concentrations was determined. The results show that NirK_HtgThe optimum NaCl concentration of (2) was 1.5M (FIG. 5).

The optimum pH is specifically as follows: the buffer solution of the reaction system is high-salt buffer solution with different pH values, and 0.1M citric acid-trisodium citrate high-salt buffer solution (pH 3.0, pH 4.0, pH 5.0, pH 6.0) and 0 are respectively prepared according to the optimal NaCl concentration1M dipotassium hydrogenphosphate-monopotassium phosphate trihydrate buffer (pH 6.0, pH 6.5, pH 7.0, pH 7.5), 0.1M Tris-HCl buffer (pH 7.5, pH 8.0, pH 8.5, pH 9.0), and 50mM CHES-NaOH buffer (pH 9.0, pH 9.5, pH 10.0, pH 10.5). And measuring the enzyme activity under the conditions of the optimal temperature and the optimal NaCl concentration. The results show that NirK_HtgThe optimum pH was 6.0 (FIG. 6, in which A and B coincide at pH 6.0 and C and D coincide at pH 9.0).

NirK_HtgThe optimum reaction conditions of (A) were 35 ℃, 1.5M NaCl and pH 6.0.

Example 7:

NirK_Htganalyzing the stability;

the thermal stability is specifically operated as: respectively incubating the enzyme solution at 30 ℃, 60 ℃ and 80 ℃ for 0min, 30min, 60min and 90min, then adding the enzyme solution into a reaction system, reacting in a phosphate buffer solution with the optimal temperature, the optimal NaCl concentration and the pH of 7.5, and determining the enzyme activity of the nitrite reductase. The results show that NirK_HtgThe enzyme activity is not obviously reduced when the enzyme is placed at 30 ℃ and 60 ℃ for less than 90 min. After standing at 80 ℃ for 30min and 60min, the enzyme activity slightly decreases, but when the time is prolonged to 90min, the enzyme activity decreases to about 50% (fig. 7).

The pH stability is specifically operated as follows: respectively adding the enzyme solution into buffer solutions with pH 6.0(0.1M dipotassium hydrogen phosphate trihydrate-potassium dihydrogen phosphate), pH7.5 (0.1M dipotassium hydrogen phosphate trihydrate-potassium dihydrogen phosphate) and pH 9.5(50mM CHES-NaOH) under the optimum NaCl concentration for incubation for 0min, 30min, 60min and 90min, reacting at the optimum temperature, and determining the activity of the nitrite reductase. The results show that NirK_HtgThe enzyme activity has better stability when the enzyme is placed for 0-90 min at the pH value of 6.0 and the pH value of 7.5. After standing at pH 9.5 for 30min and 60min, the enzyme activity is still 80%, and when the time is prolonged to 90min, the enzyme activity is reduced to about 60% (figure 8).

The NaCl stability was specifically performed as follows: adding the enzyme solution into phosphate buffer solution with pH7.5 and containing 0M NaCl, 2M NaCl and 3.5M NaCl, incubating for 0min, 30min, 60min and 90min, reacting at the optimum temperature, and determining the activity of nitrite reductase. NirK_HtgAfter being placed for 0-90 min under the NaCl concentration of 0M, 2M and 3.5M, the sodium chloride solution has the advantages ofHigh stability, substantially maintained above 80% (fig. 9).

Example 8:

NirK_Htgresistance to metal ions and organic solvents;

the reaction system was the same as in example 5; the metal ion resistance is specifically operated as follows: fe was added to the reaction system to a final concentration of 5mM³⁺、K⁺、Ca²⁺、Cu²⁺、Mg²⁺、Mn²⁺、Zn²⁺、Sr²⁺、Ni²⁺、Co²⁺Measuring the enzyme activity of nitrite reductase in a phosphate buffer solution with the optimal temperature, the optimal NaCl concentration and the pH value of 7.5; wherein, con, refers to control group (no enzyme added). The results show Mg²⁺、Ca²⁺、Sr²⁺For NirK_HtgEnzyme activity had little effect, Mn²⁺、Cu²⁺Can promote enzyme activity, Fe³⁺、K⁺、Zn²⁺、Ni²⁺、Co²⁺Has inhibitory effect on enzyme activity, wherein Fe³⁺The inhibition effect on enzyme activity is strongest (figure 10).

The organic solvent resistance is specifically operated as follows: adding 15% (v/v) of methanol, ethanol, glycerol, acetone, acetonitrile, DMSO, DMF, isopropanol, Tween 20, Tween 80 and Triton X-100 into the reaction system, and determining the activity of nitrite reductase in phosphate buffer solution with optimal temperature, optimal NaCl concentration and pH of 7.5, wherein con. The results show that: NirK with DMSO, TritonX-100 and acetone_HtgThe enzyme activity has obvious inhibition effect; the methanol, the ethanol, the Tween 80, the Tween 20, the glycerol and the DMF (dimethylformamide) can promote the NirK to different degrees_HtgThe enzyme activity is high, wherein the promotion effect of the glycerol is the most obvious (figure 11).

Example 9:

measuring enzyme kinetic parameters;

the reaction system was the same as in example 5; the specific operation is as follows: setting a substrate NaNO in a 250 mu L reaction system₂Is 0mM, 0.5mM, 1mM, 1.5mM, 2mM, 2.5mM, 3mM, 4mM, 5 mM; performing the reaction in a buffer solution with optimal temperature, optimal NaCl concentration and pH of 7.5The enzyme activity was determined at different substrate concentrations. Construction of an enzyme kinetics Curve Using GraphPad Prism7, K was calculated_mAnd V_maxThe value is obtained. The results show that NirK_HtgMaximum reaction rate V_max74970 μ g/min/mg with a kinetic constant K_mIt was 1.285 mM.

Example 10:

NirK_Htgscanning at full wavelength;

DU800 for specific operation^TMThe nucleic acid protein analyzer performs a full wavelength scan. The results show that NirK_HtgHas absorption peaks at 460, 586nm and 952nm, wherein the absorption value at 586nm is maximum, so NirK_HtgIs a blue copper-type nitrite reductase (FIG. 12).

Description of the drawings: the above embodiments are only used to illustrate the present invention and do not limit the technical solutions described in the present invention; thus, while the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted; all such modifications and variations are intended to be included herein within the scope of this disclosure and the present invention and protected by the following claims.

The nucleotide sequence is as follows: SEQ ID NO.1

ATGACCCTAACTACAGCCAACCGACGGCGGTTCATGCAGACGATCGGTGCGGCCGGCGCCGTTGCGGTCGCCGGCTGTCTCGGCGGCGACGCGCCCCAGGCGGACAGTGCGGCGAACGAAACGGACGCCGCCGAGCAGGGACTGCCGGCGGCGAAGGCTGTCGACGTCGACCGGATCGCCCGCGATCCGACCGACATCCCCGCGCCGGTCGACTGGACCGAGCCCCGCGAACACGATATCACGATCCGGGCCCAGGACGTGACCGCCGAGATCGAACCCGGCGTCACGTTCACCTACATGACCTTCGAGGGGCAGGTTCCCGGTCCGATGGTCCGCGTGCGCCGCGGCGACCGCGTCAACCTCACCTTCGAGGTCCCCGAAGCGGAGAACTTCGCGAGCCACAACATGGACTTCCACGCGGTCTACGGCCCCGGCGGCGGCGCCGAAGCGACGACGATCGGGCCCGGCGACGACGCCGCCCGAATCAGCTTCACCGCCGACTACGCCGGCGCGTTCGTCTACCACTGCGCGATCCCGGACATGGACTACCACATCAGCGCCGGCATGTTCGGCACGATCCTCGTCGAACCCGAAGAGGGCCTCCCCGAGGTCGACAACGAGTACTACCTCGGCCAACACGAGATCTACACCGACGGCCAAGTCGGCGCGGAAGGCCACCACACCTTCGACTTCGACGCGATGCTGGCCGAACGGCCCACCTACGTCGTCTTCAACGGCCAGGCCTACGGCTTCACCGAAGACGGCGCCATGCAGGCCAAAACCGGCGAGACCGCCCGCGTGTACTTCGCCAACGGCGGCCCCAACCTGCTGAGCTCGCTCCACCCCATCGGTAACGTCTTCAGCCGCTACTACCGCGACGGCGACCTCGTCAGCGACCCCGATCGCAACGTCGAGACCGCCCCCGTCGCCCCCGGGACGACGACCGTCGGCGAGATGGAGTTCCCCGTCCCCGGCCCCGTCAAAATCGTCGACCACGCGCTCACCCGCGCCGCGCGACGCGGCGCCCTCGCCGTGATCGACGTCCAGGGCGAACCCACCCGCGACCTCTACGACGAGGACGCGTGA

Amino acid sequence: SEQ ID NO.2

MTLTTANRRRFMQTIGAAGAVAVAGCLGGDAPQADSAANETDAAEQGLPAAKAVDVDRIARDPTDIPAPVDWTEPREHDITIRAQDVTAEIEPGVTFTYMTFEGQVPGPMVRVRRGDRVNLTFEVPEAENFASHNMDFHAVYGPGGGAEATTIGPGDDAARISFTADYAGAFVYHCAIPDMDYHISAGMFGTILVEPEEGLPEVDNEYYLGQHEIYTDGQVGAEGHHTFDFDAMLAERPTYVVFNGQAYGFTEDGAMQAKTGETARVYFANGGPNLLSSLHPIGNVFSRYYRDGDLVSDPDRNVETAPVAPGTTTVGEMEFPVPGPVKIVDHALTRAARRGALAVIDVQGEPTRDLYDEDA*。

Sequence listing

<110> university of Jiangsu

<120> preparation method and application of novel halophilic archaea nitrite reductase

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1086

<212> DNA

<213> halophilic archaea KZCA68-1 (Haloterrigeno sp)

<400> 1

atgaccctaa ctacagccaa ccgacggcgg ttcatgcaga cgatcggtgc ggccggcgcc 60

gttgcggtcg ccggctgtct cggcggcgac gcgccccagg cggacagtgc ggcgaacgaa 120

acggacgccg ccgagcaggg actgccggcg gcgaaggctg tcgacgtcga ccggatcgcc 180

cgcgatccga ccgacatccc cgcgccggtc gactggaccg agccccgcga acacgatatc 240

acgatccggg cccaggacgt gaccgccgag atcgaacccg gcgtcacgtt cacctacatg 300

accttcgagg ggcaggttcc cggtccgatg gtccgcgtgc gccgcggcga ccgcgtcaac 360

ctcaccttcg aggtccccga agcggagaac ttcgcgagcc acaacatgga cttccacgcg 420

gtctacggcc ccggcggcgg cgccgaagcg acgacgatcg ggcccggcga cgacgccgcc 480

cgaatcagct tcaccgccga ctacgccggc gcgttcgtct accactgcgc gatcccggac 540

atggactacc acatcagcgc cggcatgttc ggcacgatcc tcgtcgaacc cgaagagggc 600

ctccccgagg tcgacaacga gtactacctc ggccaacacg agatctacac cgacggccaa 660

gtcggcgcgg aaggccacca caccttcgac ttcgacgcga tgctggccga acggcccacc 720

tacgtcgtct tcaacggcca ggcctacggc ttcaccgaag acggcgccat gcaggccaaa 780

accggcgaga ccgcccgcgt gtacttcgcc aacggcggcc ccaacctgct gagctcgctc 840

caccccatcg gtaacgtctt cagccgctac taccgcgacg gcgacctcgt cagcgacccc 900

gatcgcaacg tcgagaccgc ccccgtcgcc cccgggacga cgaccgtcgg cgagatggag 960

ttccccgtcc ccggccccgt caaaatcgtc gaccacgcgc tcacccgcgc cgcgcgacgc 1020

ggcgccctcg ccgtgatcga cgtccagggc gaacccaccc gcgacctcta cgacgaggac 1080

gcgtga 1086

<210> 2

<211> 361

<212> PRT

<213> halophilic archaea KZCA68-1 (Haloterrigeno sp)

<400> 2

Met Thr Leu Thr Thr Ala Asn Arg Arg Arg Phe Met Gln Thr Ile Gly

1 5 10 15

Ala Ala Gly Ala Val Ala Val Ala Gly Cys Leu Gly Gly Asp Ala Pro

20 25 30

Gln Ala Asp Ser Ala Ala Asn Glu Thr Asp Ala Ala Glu Gln Gly Leu

35 40 45

Pro Ala Ala Lys Ala Val Asp Val Asp Arg Ile Ala Arg Asp Pro Thr

50 55 60

Asp Ile Pro Ala Pro Val Asp Trp Thr Glu Pro Arg Glu His Asp Ile

65 70 75 80

Thr Ile Arg Ala Gln Asp Val Thr Ala Glu Ile Glu Pro Gly Val Thr

85 90 95

Phe Thr Tyr Met Thr Phe Glu Gly Gln Val Pro Gly Pro Met Val Arg

100 105 110

Val Arg Arg Gly Asp Arg Val Asn Leu Thr Phe Glu Val Pro Glu Ala

115 120 125

Glu Asn Phe Ala Ser His Asn Met Asp Phe His Ala Val Tyr Gly Pro

130 135 140

Gly Gly Gly Ala Glu Ala Thr Thr Ile Gly Pro Gly Asp Asp Ala Ala

145 150 155 160

Arg Ile Ser Phe Thr Ala Asp Tyr Ala Gly Ala Phe Val Tyr His Cys

165 170 175

Ala Ile Pro Asp Met Asp Tyr His Ile Ser Ala Gly Met Phe Gly Thr

180 185 190

Ile Leu Val Glu Pro Glu Glu Gly Leu Pro Glu Val Asp Asn Glu Tyr

195 200 205

Tyr Leu Gly Gln His Glu Ile Tyr Thr Asp Gly Gln Val Gly Ala Glu

210 215 220

Gly His His Thr Phe Asp Phe Asp Ala Met Leu Ala Glu Arg Pro Thr

225 230 235 240

Tyr Val Val Phe Asn Gly Gln Ala Tyr Gly Phe Thr Glu Asp Gly Ala

245 250 255

Met Gln Ala Lys Thr Gly Glu Thr Ala Arg Val Tyr Phe Ala Asn Gly

260 265 270

Gly Pro Asn Leu Leu Ser Ser Leu His Pro Ile Gly Asn Val Phe Ser

275 280 285

Arg Tyr Tyr Arg Asp Gly Asp Leu Val Ser Asp Pro Asp Arg Asn Val

290 295 300

Glu Thr Ala Pro Val Ala Pro Gly Thr Thr Thr Val Gly Glu Met Glu

305 310 315 320

Phe Pro Val Pro Gly Pro Val Lys Ile Val Asp His Ala Leu Thr Arg

325 330 335

Ala Ala Arg Arg Gly Ala Leu Ala Val Ile Asp Val Gln Gly Glu Pro

340 345 350

Thr Arg Asp Leu Tyr Asp Glu Asp Ala

355 360

Claims

1. A preparation method of novel halophilic archaea nitrite reductase is characterized by comprising the following specific steps:

(1) construction of pTA04-nirk_HtgRecombinant expression plasmid:

firstly, a novel halophilic archaea is obtained based on the genome of KZCA68-1 (Haloterrigeno sp.)Gene nirK of nitrite reductase_HtgFurther designing target fragment primers containing restriction enzyme sites EcoRI and BamHI, and amplifying target fragment nirK by using conventional PCR technology_Htg(ii) a nirK was generated by molecular cloning techniques_HtgConnecting to pTA04 vector to construct recombinant plasmid;

(2) transformed halophilic archaea (haloferrox volcanii):

(3) purification of recombinant nitrite reductase

2. The method for preparing the novel halophilic archaea nitrite reductase according to claim 1, wherein the halophilic archaea (Haloterrigea sp.) KZCA68-1 in the step (1) is preserved in CGMCC 22195 with the preservation date of 2021, 4 months and 16 days.

3. The method for preparing a novel halophilic archaea nitrite reductase according to claim 1, wherein said halophilic archaea (haloferron) in step (2) is purchased from the japanese culture collection with the strain accession number: JCM 8879.

4. The method for preparing a novel halophilic archaea nitrite reductase according to claim 1, wherein the Hv-YPC medium in the step (2) comprises the following components: 5.0g of yeast extract, 1.0g of soytone, 1.0g of acid hydrolyzed casein, 4.2g of KCl, MgSO4 & 7H2O 33.0.0 g, MgCl2 & 6H2O 30.0.0 g, NaCl 144.0g, 1M Tris-HCl (pH 8.0)12.0mL, and CaCl 20.33g, wherein the above components are dissolved in 1L of distilled water, the pH is adjusted to 7.5, and the sterilization is carried out at 115 ℃ for 30 min.

5. The method for preparing a novel halophilic archaea nitrite reductase according to claim 1, wherein the conditions of the activation culture in the step (2) are as follows: culturing at 37 ℃ and 180rpm for 3-4 days; the low-temperature preservation temperature is-20 ℃.

6. The method for preparing the novel halophilic archaea nitrite reductase according to claim 1, wherein the specific operation of the nickel column affinity chromatography purification in the step (3) is as follows: firstly, 20 times of bed volume of lysine buffer is used for balancing the nickel column; loading the centrifuged supernatant; then eluting the hybrid protein by using a buffer solution I; and eluting the target protein by using the buffer solution II to finally obtain the target protein containing imidazole.

7. The method of claim 6, wherein the buffer I comprises 2M NaCl, 20mM Tris-HCl, 40mM imidazole, pH 8.0; the buffer solution II comprises 2M NaCl, 20mM Tris-HCl and 250mM imidazole, and has the pH value of 8.0; the lysine buffer component was 2M NaCl, 20mM Tris-HCl, pH 8.0.

8. The method for preparing a novel halophilic archaea nitrite reductase according to claim 1, wherein said gel filtration chromatography in step (3) is performed by using

pure protein isolation and purification System, HiTrap^TMRemoving imidazole by a desaling chromatographic column, taking lysine buffer as a mobile phase, and obtaining high-purity halophilic archaea nitrite reductase, namely NirK by gel filtration chromatography_Htg。

9. The method of claim 8, wherein said lysine buffer component is 2M NaCl, 20mM Tris-HCl, pH 8.0.

10. Use of the halophilic archaea nitrite reductase prepared by the method according to any one of claims 1 to 9 for degrading nitrite in the process of curing food and wastewater.