CN113249350B

CN113249350B - Copper-containing amine oxidase capable of degrading biogenic amine and derived from saccharopolyspora holtziae and application of copper-containing amine oxidase

Info

Publication number: CN113249350B
Application number: CN202110710160.5A
Authority: CN
Inventors: 毛健; 刘双平; 孙梦菲; 徐岳正; 周建弟
Original assignee: Industrial Technology Research Institute Of Jiangnan University Shaoxing; Zhejiang Guyue Longshan Shaoxing Wine Co ltd; Jiangnan University
Current assignee: Industrial Technology Research Institute Of Jiangnan University Shaoxing; Zhejiang Guyue Longshan Shaoxing Wine Co ltd; Jiangnan University
Priority date: 2021-06-25
Filing date: 2021-06-25
Publication date: 2022-08-26
Anticipated expiration: 2041-06-25
Also published as: CN113249350A

Abstract

The invention discloses a copper-containing amine oxidase capable of degrading biogenic amine and derived from saccharopolyspora hopogonii and application thereof, belonging to the technical field of molecular biology. The invention screens and obtains 1 copper-containing amine oxidase with biogenic amine degradation capability from saccharopolyspora holtziae, the copper-containing amine oxidase can degrade phenethylamine, histamine and tyramine within 24h, the degradation rates are respectively up to 54.27%, 57.15% and 51.58%, the copper-containing amine oxidase is suitable for degradation of biogenic amine in yellow wine and soy sauce, and the safety of fermented food is further improved.

Description

Copper-containing amine oxidase capable of degrading biogenic amine and derived from saccharopolyspora holtziae and application of copper-containing amine oxidase

Technical Field

The invention relates to a copper-containing amine oxidase capable of degrading biogenic amine from saccharopolyspora hopogonii and application thereof, belonging to the technical field of molecular biology.

Background

Biogenic amines are low molecular weight nitrogen-containing organic bases formed primarily by decarboxylation of amino acids. Biogenic amines are widely distributed in nature, can be produced by metabolism of microorganisms, plants and animals, and can be taken into the human body through food. A proper amount of biogenic amine has positive effects on human bodies, such as improving the immunity of the human bodies, enhancing the activity of blood vessels, regulating mental activities and the like. However, biogenic amines, when accumulated in large amounts in humans, cause various toxic effects such as headache, hypotension, palpitation, and vomiting, and in severe cases, are life threatening. The biogenic amine in the food is mainly derived from two parts of food raw materials and a food processing and storing process, wherein the food raw materials such as fruits, vegetables, grains and the like contain a small amount of biogenic amine, and more biogenic amine is generated by the growth and metabolism of microorganisms in the food processing and storing process, so that the biogenic amine content in the fermented food is generally higher, and the reasonable control of the biogenic amine content in the fermented food has important significance.

When biogenic amine exists in fermented food, the inoculation of biogenic amine degrading strains or the application of biogenic amine degrading enzymes is the most effective method, and the two methods have the advantages of high efficiency and safety and have great potential in the aspect of controlling the biogenic amine content in the food. The method for degrading the biogenic amine in the fermented food by utilizing biogenic amine degrading enzyme has little influence on the production process and the flavor of the food. The present studies indicate that amine oxidase is the main biogenic amine-degrading enzyme, and it has been found that amine oxidase derived from microorganisms is mainly flavin-containing amine oxidase and copper-containing amine oxidase. Copper-containing amine oxidase is a copper-containing reductase, and the copper-containing amine oxidase capable of degrading biogenic amine is separated from various microorganisms by scholars, and has certain degradation capability on various biogenic amines such as histamine, phenethylamine, tyramine and the like.

The amine oxidase with the effect of degrading biogenic amine obtained by separation at present is few in types and poor in effect, so that the screening of the amine oxidase with the effect of efficiently degrading biogenic amine has important significance for degrading biogenic amine in fermented foods such as aged yellow rice wine and the like and improving the quality of the fermented foods.

Disclosure of Invention

The invention aims to solve the problem of high biogenic amine content in the traditional fermented food, provides the copper-containing amine oxidase capable of degrading biogenic amine from saccharopolyspora holtziae, and reduces biogenic amine in fermented food such as yellow wine, soy sauce and the like by using a method for degrading biogenic amine by using the copper-containing amine oxidase, thereby improving the quality of the traditional fermented food.

The invention provides a copper-containing amine oxidase which is (a) or (b):

(a) a protein consisting of an amino acid sequence shown in SEQ ID No. 2;

(b) and (b) a protein derived from (a) having a copper-containing amine oxidase activity, wherein the amino acid sequence in (a) is substituted, deleted or added with one or more amino acids.

The invention also provides a gene encoding the copper-containing amine oxidase.

In one embodiment, the gene comprises the nucleotide sequence set forth in SEQ ID NO. 1.

The invention also provides a recombinant expression plasmid carrying the gene.

In one embodiment, the recombinant expression plasmid is a pET series plasmid.

The invention also provides recombinant microbial cells expressing the copper-containing amine oxidase.

In one embodiment, the recombinant microbial cell includes, but is not limited to, escherichia coli, bacillus, or yeast.

The invention also provides a genetic engineering bacterium which takes escherichia coli BL21 as a host and expresses the copper-containing amine oxidase shown in SEQ ID No. 2.

In one embodiment, the genetically engineered bacterium uses a pET series plasmid as an expression vector.

In one embodiment, the genetically engineered bacterium uses pET28a (+) as an expression vector to express the copper-containing amine oxidase shown in SEQ ID NO. 2.

The invention also provides a construction method of the genetic engineering bacteria, which is to connect the gene sequence shown in SEQ ID NO.1 with a vector and transform the gene sequence into an escherichia coli cell.

In one embodiment, the vector is pET28a (+).

The invention also provides a production method of the copper-containing amine oxidase. The method comprises the steps of inoculating the genetic engineering bacteria into a culture medium for culture, collecting somatic cells, crushing the cells to obtain a crude enzyme solution, and purifying.

In one embodiment, the strain culture method is to inoculate the genetically engineered bacterium into LB culture medium and culture to 0D ₆₀₀ When the induction time is 0.6-0.8, IPTG is added for induction for 14-20 h.

In one embodiment, the purification method is nickel column affinity chromatography.

The invention also provides application of the copper-containing amine oxidase in reducing biogenic amine in the field of food.

In one embodiment, the use comprises reducing the biogenic amine content in a fermented food product.

In one embodiment, the application is that the recombinant copper-rich oxidase is added into yellow wine and soy sauce to degrade biogenic amine in the yellow wine and soy sauce.

In one embodiment, the recombinant copper-rich oxidase is added into yellow wine or soy sauce in an amount of 0.5-2 g protein/L, and reacted at 20-45 ℃ for at least 20 h.

In one embodiment, the application is that the recombinant copper-rich oxidase is added into yellow wine or soy sauce in an amount of 1g/L and reacts for at least 24 hours at 20-25 ℃.

In one embodiment, the biogenic amines include, but are not limited to, tryptamine, phenethylamine, cadaverine, putrescine, histamine, tyramine, spermidine, spermine.

The invention has the beneficial effects that:

(1) the copper-containing amine oxide recombinase provided by the invention has stronger performance of degrading biogenic amine, can degrade phenylethylamine, histamine and tyramine within 24h, and has the degradation rates respectively reaching 54.27%, 57.15% and 51.58%.

(2) The recombinase has certain tolerance capacity to ethanol, and CuAO ^Shod The residual enzyme activity is more than 40% in the environment of 18% vol ethanol, and the method has a certain application value in fermented wine such as yellow wine, grape wine and the like.

(3) The recombinase has obvious degradation effect on common biogenic amine in the food such as phenylethylamine, histamine and tyramine, the total biogenic amine degradation rate of the commercially available yellow wine and the commercially available soy sauce is respectively 25.86% and 14.90%, and the safety of fermented food is further improved.

Drawings

Fig. 1 is a gel electrophoresis validation of s. hordei F2002 copper-containing amine oxidase gene: m: DNA marker; k: negative control; 1: and (5) PCR amplification products.

FIG. 2 shows the results of enzyme digestion; m: DNA marker; 1: the empty plasmid pET-28a (+) is subjected to single enzyme digestion; 2: pET-28a (+) -CuAO ^Shir Single enzyme digestion fragment; 3: pET-28a (+) -CuAO ^Shir Nde I and EcoR I.

FIG. 3 is a recombinant cuprammonium oxidase CuAO ^Shod The result of purification (2). (a) A process diagram for purifying the recombinant protein by using the nickel column HP; (b) is CuAO ^Shir Electrophoresis chart of protein separation and purification process; m: an Unstained Protein Ladder; 1: CuAO ^Shir Purifying the pre-protein; 2: CuAO ^Shir And (5) purifying the protein.

FIG. 4 is CuAO ^Shod Ability to degrade a single biogenic amine.

FIG. 5 is a graph of CuAO at various pH ^Shod The enzyme activity is high; (a) the substrate is phenethylamine; (b) the substrate is histamine; (c) the substrate is tyramine.

FIG. 6 temperature vs. CuAO ^Shod Influence of enzyme activity; (a) the substrate is phenethylamine; (b) is histamine as a substrate; (c) the substrate is tyramine.

FIG. 7 ethanol vs CuAO ^Shod Influence of enzyme activity; (a) the substrate is phenethylamine; (b) is histamine as a substrate; (c) as substrate tyramine。

FIG. 8CuAO ^Shod Capability of degrading biogenic amine in the commercial yellow wine.

FIG. 9CuAO ^Shod Ability to degrade biogenic amines in commercially available soy sauce.

Detailed Description

The biogenic amine content was determined by High Performance Liquid Chromatography (HPLC).

The enzyme activity determination method comprises the following steps: the activity of the biological amine oxidase is determined by using an indirect determination method, the amine oxidase acts on the biological amine to degrade the biological amine into corresponding aldehydes and hydrogen peroxide, under the condition that peroxidase exists, the hydrogen peroxide, 4-aminoantipyrine and 2,4, 6-tribromo-3-hydroxybenzoic acid generate a hydroquinone dye, the product has a maximum absorption value at 510nm, the activity of the amine oxidase is in a linear relation with the color depth of the product within a certain range, and the activity of the amine oxidase can be determined by determining the change of A510. The reaction was carried out in a 96-well plate, and the reaction system included 10. mu.L of enzyme solution (150 mg. multidot.L) ^-1 ) 100 μ L of the prepared solution (including 200 mmol. L) ^-1 Potassium phosphate buffer solution (pH 7.6), 1.5 mmol. multidot.L ^-1 4-Aminoantipyrine, 1 mmol.

L

^-1 2,4, 6-tribromo-3-hydroxybenzoic acid), to start the reaction, 20 μ L of biogenic amine solution (10 mmol. multidot.l) was added ^-1 ) And 70. mu.L peroxidase (1.4 mg. multidot.mL) ^-1 ) The absorbance was measured at 510nm, the reaction temperature at 37 ℃ and the reaction time at 10 min.

Definition of enzyme activity: will generate 1. mu. moL of H per minute ₂ O ₂ The amount of enzyme required is defined as one unit of enzyme activity (U).

Example 1: PCR amplification of copper-containing amine oxidase Gene in Hordei F2002

Primers were designed based on the amine oxidase gene (Protein ID WP _179723446.1) in Saccharopolyspora holdii (saccharomyces hoddei) in NCBI database, and the multicopper oxidase gene was amplified using s.hordei F2002 genome deposited in the present research laboratory as a template. The primers required for amplification were as follows: the upper primer sequence (5'→ 3') is ATGGCGATGCACCCGCTGGAT; the lower primer sequence (5'→ 3') was TCAGGACTCGCAGCAGTGGG. According to

Preparing PCR reaction liquid according to the requirements of a reaction system of HS DNA Polymerase with GC Buffer, wherein the PCR amplification system comprises the following steps: pre-denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 30s, extension at 72 ℃ (1 min. kb) ^-1 ) The cycle was 30 times.

Carrying out PCR amplification by taking the genome of S.hordei F2002 as a template, verifying the amplification result by 1% agarose gel electrophoresis of a PCR product, wherein the amplified sequence size is the same as the target gene sequence size and is about 1900bp as shown in FIG. 1, which indicates that the S.S.hordei F2002 contains a copper-containing amine oxidase gene, purifying the PCR product and then sending the purified PCR product to a company for sequencing, and the sequencing result is shown as SEQ ID NO. 1.

Example 2: genetically engineered bacterium E.coli BL21-pET28a-CuAO ^Shod Construction of

(1) Obtaining the target fragment.

Using s.hordei F2002 whole genome sequence as template, PCR amplification was performed with primers and whole genome DNA together, the PCR reaction system and amplification procedure were the same as described in example 1, and the PCR product gel with the correct band verification was carefully cut off, recovered and purified.

(2) And (4) enzyme digestion and connection.

The plasmid pET-28a (+) and the target fragment were subjected to double digestion with restriction enzymes Nde I and EcoR I, respectively, as shown below: the target gene fragment was 40. mu.L, the plasmid was 40. mu.L, each of the restriction enzymes Nde I and EcoR I was 2.5. mu.L, and the Green Buffer was 5. mu.L. And (3) fully and uniformly mixing the components in the enzyme digestion system, and then placing the mixture in a metal bath at 37 ℃ for reacting for 45 min. And (3) recovering and purifying the gene fragment and the plasmid subjected to double enzyme digestion, and performing the following steps according to a molar ratio of 4-10: 1, adding Solution I ligase in the same volume, fully and uniformly mixing, and then placing in a metal bath at 16 ℃ for heat preservation overnight.

(3) And (4) transformation.

Placing E.coli BL21(DE3) competent cells preserved at-80 ℃ on ice for 5-10 min, sucking 5-10 mu L of a ligation product to be transformed by using a pipette, adding the ligation product into the competent cells, gently blowing and sucking the ligation product uniformly, uniformly mixing the mixture, and performing ice bath for 30 min. After the ice bath is finished, the ice is thermally shocked for 90s at 42 ℃, and then immediately taken out and placed in ice until reaching 2 to up to sixAnd 5 min. Then 700. mu.L of LB liquid medium, 37 ℃ at 200 r.min was added ^-1 And carrying out shake culture for 45-60 min. 8000r min ^-1 Centrifuging for 2min, discarding most of supernatant, and keeping about 100 μ L of supernatant to resuspend the thallus. The bacterial liquid is uniformly coated on the surface of the substrate containing 30 mg.L ^-1 And (3) inversely placing the kanamycin on an LB solid medium flat plate in an incubator at 37 ℃ for overnight culture, and after single bacteria grow out, carrying out PCR verification and screening positive transformants.

(4) And (5) enzyme digestion verification.

Extracting plasmid of recombinant bacteria, carrying out Nde I and EcoR I double enzyme digestion, respectively obtaining 5369bp pET-28a (+) fragment and 1917bp target fragment as shown in figure 2, sending the target fragments to a company for sequencing, and verifying that the sequencing result is consistent with the target gene sequence, thereby verifying the recombinant bacteria E ^Shod Successfully constructed, and the recombinase expressed by the strain is named as CuAO ^Shod 。

Example 3: recombinase CuAO ^Shod Induced expression and purification of

(1) Recombinase CuAO ^Shod Induced expression of

Inoculating the recombinant strain liquid to the culture medium containing 50 mg.L at the inoculation amount of 1 percent ^-1 Ampicillin in LB medium at 37 ℃ at 150 r.min ^-1 Culturing under the condition for 12 h. The seed solution was transferred to a medium containing 50 mg.L at an inoculum size of 2% (v/v) ^-1 Kanamycin in TB fermentation medium at 37 ℃ and 160 r.min ^-1 Culturing under the condition until OD600 is 0.6, adding final concentration of 0.25 mmol.L ^-1 IPTG (isopropyl-beta-D-thiogalactoside) at 25 ℃ and 160 r.min ^-1 Culturing for 12h under the condition of OD ₆₀₀ Is 1.5. The bacterial liquid is heated to 12000 r.min at 4 deg.C ^-1 Centrifuging for 10min under the condition, collecting lower layer thallus, adding 0.2 mol. L ^-1 After resuspending the cells in sodium phosphate buffer (pH 7.4), the cells were collected by centrifugation and the above procedure was repeated twice. And (3) crushing the thallus by using an ultrasonic cell crusher under the ultrasonic conditions that: 400W, 1s of work, 1s of interval and 5-15 min of crushing time. After the completion of the crushing, the temperature is 12000 r.min at 4 DEG C ^-1 Centrifuging to collect supernatant, filtering with 0.45 μ M filter membrane, and storing at low temperature with enzyme activity of 30U/L.

(2) Recombinase CuAO ^Shod Purification of (2)

Affinity chromatography column HisTrap ^TM HP (GE healthcare) purified protein, and AKTA avant 25 instrument is adopted to separate and purify the target protein, and the operation steps are as follows:

1. machine self-checking, software opening, program setting, pump washing and post connection.

2. 15 column volumes were equilibrated with phosphate buffer containing 20mM imidazole, pH 7.4, at a flow rate of 1mL min ^-1 。

3. Suspending the recombinant engineering bacteria in a buffer (50 mmol. multidot.L) ^-1 PBS, pH 7.40, 0.50M NaCl), obtaining a crude enzyme solution by ultrasonication, filtering the crude enzyme solution with a 0.45 μ M filter membrane, loading the filtered crude enzyme solution on the column after the above equilibration, and controlling the flow rate to be 1 mL/min ^-1 。

4. Washing 5-10 bed volumes with 20mM imidazole, pH 7.4 phosphate buffer at a flow rate of 1 mL/min ^-1 。

5. The elution was performed in a linear fashion with phosphate buffer containing 500mM imidazole at pH 7.4 (

slope

5, 20 column volumes washed, buffer 2 concentration from 0 to 100%, then 100% buffer 2 wash 8-10 column volumes) at a flow rate of 1mL min ^-1 The molecular weight and purity of the eluted protein at each stage were determined by SDS-PAGE, and the protein purification process and SDS-PAGE results are shown in FIG. 3, in which the amount of protein was 150 mg/L.

6. Washing 5-10 column volumes with pure water, then washing 3-5 volumes with 20% alcohol at a flow rate of 1 mL/min ^-1 。

Example 4: recombinase CuAO ^Shod Degradation of biogenic amines

To recombinant enzyme CuAO ^Shod The enzyme activity was measured, and the oxidative deamination of 8 biogenic amines was studied, as shown in Table 1, which have different degrees of oxidation ability to tryptamine, phenethylamine, histamine and tyramine, wherein the oxidation ability to phenethylamine, histamine and tyramine is stronger, and when phenethylamine is used as a substrate, the specific activity is 0.23 U.mg ^-1 When histamine was used as a substrate, the specific activity was 0.22 U.mg ^-1 When tyramine is used as a substrate, the specific activity is 0.22 U.mg ^-1 . Bioamine content in 8 monoamine solutions before and after enzyme addition using HPLCAs can be seen from FIG. 4, the recombinant enzyme CuAO was detected ^Shod The degradation capacities of phenylethylamine, histamine and tyramine are the most obvious, and the degradation rates are 54.27%, 57.15% and 51.58% respectively; the degradation capability of the compound on cadaverine, putrescine, spermidine and spermine is very weak, and the degradation rate is not less than 10%.

TABLE 1CuAO ^Shod Oxidation activity on various biogenic amines

Example 5: recombinase CuAO ^Shod Study of the enzymatic Properties

(1) Recombinase CuAO ^Shod Optimum reaction pH of

Changing the pH value of a reaction system to 4-9, and measuring the recombination enzyme CuAO under different pH reaction conditions ^Shod The enzyme activity of (A) is calculated by taking the highest enzyme activity as 100%, and the relative enzyme activity of each pH point is calculated, and the result is shown in figure 5, CuAO ^Shod Has high activity in neutral environment, and CuAO when the substrates are phenylethylamine, histamine and tyramine respectively ^Shod The optimum pH value of the enzyme is 6.5, and the relative enzyme activity can be maintained to be more than 80% between the pH values of 6-7.

(2) Recombinase CuAO ^Shod Optimum reaction temperature of

Changing the reaction temperature to 20-70 ℃, and measuring the recombination enzyme CuAO under different temperature reaction conditions ^Shod The enzyme activity of (A) is calculated by taking the highest enzyme activity as 100%, and the relative enzyme activity of each temperature point is calculated, the result is shown in figure 6, the enzyme activity is higher when the reaction temperature is 35-60 ℃, and when the substrates are respectively phenethylamine, histamine and tyramine, CuAO ^Shod The optimal reaction temperature is 45 ℃, and the relative enzyme activity can be maintained to be more than 80% between 40 ℃ and 50 ℃.

(3) Ethanol on recombinase CuAO ^Shod Influence of enzyme Activity

Under the conditions of the optimal reaction pH and temperature of the recombinase, enzyme solution is placed in a buffer solution containing 0, 3, 7, 10, 15, 18 and 20 percent (v/v) ethanol for 1h, and then the enzyme activity is measured. Calculating the phase of each ethanol concentration environment by taking the highest enzyme activity as 100 percentThe results of the enzyme activity are shown in FIG. 7, and the low concentration ethanol is applied to CuAO ^Shod The enzyme activity is not greatly influenced, and when the ethanol concentration is 3 percent, the recombinase CuAO ^Shod Relative enzyme activity of greater than 80%, thus, CuAO ^Shod The method has good application potential in food containing low-concentration ethanol; and CuAO ^Shod The residual enzyme activity is more than 40% under the environment with higher ethanol content (15-18% vol), and simultaneously, compared with phenylethylamine, CuAO ^Shod The residual enzyme activity to histamine and tyramine is higher in the environment with higher ethanol concentration, so that CuAO ^Shod Has certain ethanol tolerance and certain application value in yellow wine, grape wine and other fermented wine.

Example 6: recombinase CuAO ^Shod Application in yellow wine

The recombinant amine oxidase is respectively added into the commercial yellow wine (the content is 1g protein/L yellow wine), the content of the biogenic amine is measured after the mixture is kept stand for 24 hours at room temperature, and the contrast group is the commercial yellow wine without the enzyme. As shown in FIG. 8, the commercial yellow wine contains 6 kinds of biogenic amines except tryptamine and spermine, and the total biogenic amine content is 59.58 mg.L ^-1 Tyramine and cadaverine are main biogenic amines, and recombinase CuAO ^Shod The total biogenic amine degradation rate of the commercial yellow wine is 21.18 percent, and the highest degradation rate of tyramine is 25.86 percent.

Example 7: recombinase CuAO ^Shod Application in soy sauce

Adding the recombinant amine oxidase into commercial yellow wine (the content is 1 g.L) ^-1 ) And standing at room temperature for 24h, and determining the content of biogenic amine, wherein the control group is commercial yellow wine without enzyme. As shown in FIG. 9, the total degradation rate of biogenic amine was 14.90% for commercial soy sauce, and the degradation rates of histamine and tyramine, which are main biogenic amines, were 20.44% and 16.37%, respectively.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by one skilled in the art without departing from the spirit and scope of the invention as defined by the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

South of the Yangtze university (Shaoxing) industry and technology research institute

Zhejiang Guyue Longshan Shaoxing Wine Co.,Ltd.

<120> saccharopolyspora hophatheri-derived copper-containing amine oxidase capable of degrading biogenic amine and application thereof

<130> BAA210774A

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 1902

<212> DNA

<213> Saccharopolyspora hordei

<400> 1

atggcgatgc acccgctgga tccgctgagc gcggaggagg tcctgcgcaa ccgcgacgtc 60

ctgcagcagg ccggcctgct gcgcgcgtcg acccggttcc ccctggtgca gctggcggaa 120

ccggacaagg ccgcggtgct cgcgcaccgc gacggcgatc cggtggagcg gcgggcgcgc 180

tcggtgctgc tggacgtcga gaccggtgag gtgatgacca ccgtggtctc gctgaccagc 240

ggcgaactgg tggacaaggc cgtggtcaac ccggtcgacg agggtcagcc gccggtcatg 300

ctcgacgagt acgagctggt cgagcgcatc gtgcgtgccg acgagacctg gctgcgggcg 360

atccgcgacc gcggcatcga ggacgtgtcc acggtgcggg tgtgcccgct gtcggcgggg 420

tggttcggcg acccggcgga gcgcggtcgg cggatgctgc gcgccctggc gttcctgcag 480

gacagcccgg acgaactgcc gtgggcgcac ccgatcgacg ggctggtggc ctacgtcgac 540

gtgatcgagc agcgggtgct ggaggtcgtc gacgaccgca cgctcccagt gccggccgag 600

agcggcgact acaccgacga agcggtgcgc ggcccgcacc gcgagtcgct gcgaccgatc 660

gagatcaccc agcccgaggg gccgagcttc cacgtcgacg gccacgaggt gcggtgggag 720

gactggcggt tccgcatcgg gttcgacccg cgcgaaggcc tggtgctgca ccagctgtcc 780

ttccacgagc ggccggtggt gcaccgggcg tcgatcagcg agatggtggt caactacggc 840

gacccgtccc cggcccggtt ctggcagaac tacttcgacg ccggcgagta ctcgctgggc 900

aagctcgcca acgaactggt gctcggctgc gactgcctcg gcgagatccg gtacttcgac 960

gccgtggtgg cgcaggagga cggcacgccc cgcacgctgc gcaacgcggt gtgcctgcac 1020

gaagaggacg tcggggtgct gtggaagcac accgacgtgt tcaccggctc ggccgagacc 1080

cgccggcagc ggcggctggt ggtgtcgttc ttcgtctcgg tcggcaacta cgactacggc 1140

ttctactggt acctctacct ggacggcacc atccagctgg agaccaaggc gacggggatc 1200

gtgttcacct ccgcctaccc ggaggagggg tcgcgctggg ccaccgagct cgctcccggg 1260

ctcggcggcc cgtaccacca gcacctgttc agcgcgcggc tggacatgac ggtggacggc 1320

acccgcaacg cggtggacga ggtcgaggtg cagcgggtgc cgatcggcgc ggacaacccg 1380

cacggcaacg ccttcacccg gcgcgtcacc aggctggcgc gggagagcga ggcggcgcgc 1440

gaagcggacc cggcgtcggg ccgggtctgg cacgtggtca acaccgagcg caccaaccgc 1500

ctcggtcaac cggtcggcta cgcgctgcac ccgcagggcg gcccgctgct gctggccgac 1560

ccggagtcct cgatcgcccg gcgcgcggcg ttcgcgacca agcacctgtg ggtcacccag 1620

tgctcgccgg acgagcggta cccggcgggc gagtgggtga accagcacca cggcggggcg 1680

gggctcccgg cctacgcggc gcaggaccgc agcgtcgacg gcgaggacat cgtcctgtgg 1740

cacaccttcg gcctcacgca cttcccgcgg accgaggact ggccggtcat gccggtggac 1800

acgtgcggct tcaccctcaa gccggtcggc ttcctcgacc gcaaccccac cctcgacgtc 1860

ccacccacca cgagcaccca ctcccactgc tgcgagtcct ga 1902

<210> 2

<211> 633

<212> PRT

<213> Saccharopolyspora hordei

<400> 2

Met Ala Met His Pro Leu Asp Pro Leu Ser Ala Glu Glu Val Leu Arg

1 5 10 15

Asn Arg Asp Val Leu Gln Gln Ala Gly Leu Leu Arg Ala Ser Thr Arg

20 25 30

Phe Pro Leu Val Gln Leu Ala Glu Pro Asp Lys Ala Ala Val Leu Ala

35 40 45

His Arg Asp Gly Asp Pro Val Glu Arg Arg Ala Arg Ser Val Leu Leu

50 55 60

Asp Val Glu Thr Gly Glu Val Met Thr Thr Val Val Ser Leu Thr Ser

65 70 75 80

Gly Glu Leu Val Asp Lys Ala Val Val Asn Pro Val Asp Glu Gly Gln

85 90 95

Pro Pro Val Met Leu Asp Glu Tyr Glu Leu Val Glu Arg Ile Val Arg

100 105 110

Ala Asp Glu Thr Trp Leu Arg Ala Ile Arg Asp Arg Gly Ile Glu Asp

115 120 125

Val Ser Thr Val Arg Val Cys Pro Leu Ser Ala Gly Trp Phe Gly Asp

130 135 140

Pro Ala Glu Arg Gly Arg Arg Met Leu Arg Ala Leu Ala Phe Leu Gln

145 150 155 160

Asp Ser Pro Asp Glu Leu Pro Trp Ala His Pro Ile Asp Gly Leu Val

165 170 175

Ala Tyr Val Asp Val Ile Glu Gln Arg Val Leu Glu Val Val Asp Asp

180 185 190

Arg Thr Leu Pro Val Pro Ala Glu Ser Gly Asp Tyr Thr Asp Glu Ala

195 200 205

Val Arg Gly Pro His Arg Glu Ser Leu Arg Pro Ile Glu Ile Thr Gln

210 215 220

Pro Glu Gly Pro Ser Phe His Val Asp Gly His Glu Val Arg Trp Glu

225 230 235 240

Asp Trp Arg Phe Arg Ile Gly Phe Asp Pro Arg Glu Gly Leu Val Leu

245 250 255

His Gln Leu Ser Phe His Glu Arg Pro Val Val His Arg Ala Ser Ile

260 265 270

Ser Glu Met Val Val Asn Tyr Gly Asp Pro Ser Pro Ala Arg Phe Trp

275 280 285

Gln Asn Tyr Phe Asp Ala Gly Glu Tyr Ser Leu Gly Lys Leu Ala Asn

290 295 300

Glu Leu Val Leu Gly Cys Asp Cys Leu Gly Glu Ile Arg Tyr Phe Asp

305 310 315 320

Ala Val Val Ala Gln Glu Asp Gly Thr Pro Arg Thr Leu Arg Asn Ala

325 330 335

Val Cys Leu His Glu Glu Asp Val Gly Val Leu Trp Lys His Thr Asp

340 345 350

Val Phe Thr Gly Ser Ala Glu Thr Arg Arg Gln Arg Arg Leu Val Val

355 360 365

Ser Phe Phe Val Ser Val Gly Asn Tyr Asp Tyr Gly Phe Tyr Trp Tyr

370 375 380

Leu Tyr Leu Asp Gly Thr Ile Gln Leu Glu Thr Lys Ala Thr Gly Ile

385 390 395 400

Val Phe Thr Ser Ala Tyr Pro Glu Glu Gly Ser Arg Trp Ala Thr Glu

405 410 415

Leu Ala Pro Gly Leu Gly Gly Pro Tyr His Gln His Leu Phe Ser Ala

420 425 430

Arg Leu Asp Met Thr Val Asp Gly Thr Arg Asn Ala Val Asp Glu Val

435 440 445

Glu Val Gln Arg Val Pro Ile Gly Ala Asp Asn Pro His Gly Asn Ala

450 455 460

Phe Thr Arg Arg Val Thr Arg Leu Ala Arg Glu Ser Glu Ala Ala Arg

465 470 475 480

Glu Ala Asp Pro Ala Ser Gly Arg Val Trp His Val Val Asn Thr Glu

485 490 495

Arg Thr Asn Arg Leu Gly Gln Pro Val Gly Tyr Ala Leu His Pro Gln

500 505 510

Gly Gly Pro Leu Leu Leu Ala Asp Pro Glu Ser Ser Ile Ala Arg Arg

515 520 525

Ala Ala Phe Ala Thr Lys His Leu Trp Val Thr Gln Cys Ser Pro Asp

530 535 540

Glu Arg Tyr Pro Ala Gly Glu Trp Val Asn Gln His His Gly Gly Ala

545 550 555 560

Gly Leu Pro Ala Tyr Ala Ala Gln Asp Arg Ser Val Asp Gly Glu Asp

565 570 575

Ile Val Leu Trp His Thr Phe Gly Leu Thr His Phe Pro Arg Thr Glu

580 585 590

Asp Trp Pro Val Met Pro Val Asp Thr Cys Gly Phe Thr Leu Lys Pro

595 600 605

Val Gly Phe Leu Asp Arg Asn Pro Thr Leu Asp Val Pro Pro Thr Thr

610 615 620

Ser Thr His Ser His Cys Cys Glu Ser

625 630

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence

<400> 3

atggcgatgc acccgctgga t 21

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence

<400> 4

tcaggactcg cagcagtggg 20

Claims

1. Application of the copper-containing amine oxidase with the amino acid sequence shown as SEQ ID NO.2 in reducing biogenic amine in the field of food.

2. The use according to claim 1, wherein the biogenic amines include, but are not limited to, one or more of tryptamine, phenethylamine, cadaverine, putrescine, histamine, tyramine, spermidine, spermine.