CN100436579C - Vitreoscilla hemoglobin gene and its uses - Google Patents

Abstract

The present invention discloses a Vitreoscilla hemoglobin gene and application thereof. The gene has one of the following nucleotide sequence: 1) DNA sequence of sequence 1 in a sequence list; 2) DNA sequence of function protein which has more than 90% of homology with the DNA sequence of the sequence 1 in the sequence list and has the same encoding; 3) nucleotide sequence which can be hybridized with the DNA sequence limited by the sequence 1 in the sequence list under the very precise condition. The Hansenula polymorpha Morais et Maia engineering bacteria with the Vitreoscilla hemoglobin gene of the present invention can normally grow and express target genes under the oxygen-poor condition; the present invention can improve the use factor of oxygen, can avoid supplying pure oxygen for keeping the requirements of Hansenula polymorpha Morais et Maia for the oxygen in the process of ferment, can eventually improve expression quantity, and can solve the safety problem of simultaneously using inflammable methanol and pure oxygen during the process of the production.

Description

A kind of Vitreoscilla hemoglobin gene and application thereof

Technical field

The present invention relates to a kind of Vitreoscilla hemoglobin gene and application thereof.

Background technology

Exist a kind of O in the organism ₂Conjugated protein is oxyphorase.Oxyphorase has all had discovery now in bacterium, yeast, plant and animal.Many oxyphorases all have its common characteristic: oxyphorase is a kind of conjugated protein, is made of globin and protoheme.Protoheme is made up of protoporphyrin and ferrous atom, and each globin molecule has 4 peptide chains, and each is a protoheme in conjunction with a prothetic group for each peptide chain, O ₂Promptly be incorporated into Fe ²⁺On, oxyphorase forms Oxyhemoglobins (HbO with loose combination of oxygen ₂), this oxygenation is carried out when oxygen partial pressure is high easily, is easy to dissociate when oxygen partial pressure is low.Red corpuscle combination and carry O ₂Process do not influence ferrous ion, can not make it be oxidized to ferric ion; Fe ³⁺There is not band O ₂Ability only sees unusual methemoglobin.People such as Magnolo have expressed Vitreoscilla hemoglobin (VHb) in sky blue streptomycete, the result shows VHb introduced can make its more efficient use oxygen in the aerobic industrial microorganism, cut down the consumption of energy, and promotes growth, increases product production.People such as Wang Qinglu study VHb and nitrilase gene in pichia spp, it is discovered, the VHb gene can efficiently express in yeast, and shake flask fermentation experiment showed, that oxyphorase can obviously promote yeast bulk-growth and nitrilase gene to express under the oxygen deprivation condition.

Methanol yeast is that the class that grew up gradually in recent years is as the cell factory expression alien gene, the desirable host of eukaryotic gene particularly, wherein multiple-shaped nuohan inferior yeast (Hansenula polymorpha) is current ideal heterologous gene expression system of generally acknowledging in the world.The optimum growth temperature height of multiple-shaped nuohan inferior yeast, growth velocity is fast, is beneficial to large scale fermentation production, can efficiently express many genes of efficiently expressing of being difficult in other systems.Because multiple-shaped nuohan inferior yeast can be integrated a plurality of genes than substep by certain gene dosage, the reorganization bacterium can be by the required gene of the ratio expression of the best, and this does not appear in the newspapers in other methanol yeast.Multiple-shaped nuohan inferior yeast has that genetic manipulation is simple, copy number of foreign gene is high, foreign protein output height, be easy to advantage such as suitability for industrialized production, is one and is better than intestinal bacteria and other zymic heterologous gene expression system, has obtained extensive concern.Especially in secretion type expression, foreign protein can be finished translation post-treatment processes such as proteolysis maturation, glycosylation modified and disulfide linkage formation by Secretory Pathway, makes the more approaching native protein form with biologic activity of expressed albumen.

Multiple-shaped nuohan inferior yeast is high aerobic microbiological, usually can occur during the fermentation because of situations such as growth of oxygen supply deficiency restrictive cell and expression of exogenous gene.Vitreoscilla hemoglobin is a kind of interior soluble material of born of the same parents that is similar to human hemoglobin, and it can improve the utilize ability of engineering bacteria to oxygen from molecular level.Based on this characteristic, up to the present, Vitreoscilla hemoglobin is successful Application in the fermenting process of multiple biochemical products such as penicillin acylase and PHB.

Summary of the invention

The purpose of this invention is to provide a kind of Vitreoscilla hemoglobin gene and application thereof.

Vitreoscilla hemoglobin gene provided by the present invention, name is called Hb, can have one of following nucleotide sequence:

1) dna sequence dna of sequence 1 in the sequence table;

2) with sequence table in the dna sequence dna of sequence 1 have 90% above homology, and the identical function protein DNA sequence of encoding;

3) nucleotide sequence of the dna sequence dna hybridization that under the rigorous condition of height, can limit with sequence in the sequence table 1.

The rigorous condition of above-mentioned height can be 0.1 * SSPE (or 0.1 * SSC), in the solution of 0.1%SDS, under 65 ℃, hybridize and wash film.

Wherein, the sequence 1 in the sequence table is made up of 466 deoxynucleotides, and deoxynucleotide is an encoding sequence from 5 ' end 3-458 position.

Contain expression carrier of the present invention, clone and host bacterium and all belong to protection scope of the present invention.

Contain expression carrier of the present invention and specifically can be pHMOXZR25S-Hb or pHFMDZR25S-Hb; Described pHMOXZR25S-Hb is that the multiple clone site that the dna sequence dna with sequence in the sequence table 1 is inserted into pHMOXZR25SA-M as shown in Figure 5 obtains.Described pHFMDZR25S-Hb is that the multiple clone site that the dna sequence dna with sequence in the sequence table 1 is inserted into pHFMDZR25SA-M expression vector as shown in Figure 4 obtains.

Vitreoscilla hemoglobin gene of the present invention is to design artificial synthetic gene according to the debaryomyces hansenii codon-bias.In actual applications, can pass through multiple-shaped nuohan inferior yeast expression vector pHFMDZR25S-Hb or pHMOXZR25S-Hb with reorganization Vitreoscilla hemoglobin gene of the present invention, method importing by electroporation contains in the multiple-shaped nuohan inferior yeast engineering bacteria of external source goal gene, makes multiple-shaped nuohan inferior yeast engineering bacteria efficiently expressing exogenous gene under the oxygen deprivation situation.

Experiment shows, the multiple-shaped nuohan inferior yeast engineering bacteria that contains Vitreoscilla hemoglobin gene of the present invention, can normal growth under the oxygen deprivation situation and express goal gene, improved the utilization ratio of oxygen, avoid during the fermentation with keeping the demand of multiple-shaped nuohan inferior yeast oxygen for pure oxygen, finally improve expression amount, and solved the safety issue that inflammable substance methyl alcohol and pure oxygen in process of production use simultaneously.

Description of drawings

Fig. 1 is the synthetic schemes synoptic diagram of Vitreoscilla hemoglobin gene Hb

Fig. 2 is a multiple-shaped nuohan inferior yeast expression vector pHFMDZRA-M structure iron

Fig. 3 is a multiple-shaped nuohan inferior yeast expression vector pHMOXZRA-M structure iron

Fig. 4 is a multiple-shaped nuohan inferior yeast expression vector pHFMDZR25SA-M structure iron

Fig. 5 is a multiple-shaped nuohan inferior yeast expression vector pHMOXZR25SA-M structure iron

Embodiment

Experimental technique among the following embodiment if no special instructions, is ordinary method.

Percentage composition described in the following embodiment if no special instructions, is the quality percentage composition.

The acquisition of embodiment 1, multiple-shaped nuohan inferior yeast preference Vitreoscilla hemoglobin gene Hb:

According to GenBank number be: the Vitreoscilla hemoglobin gene sequence of AY278200 and debaryomyces hansenii codon-bias, Vitreoscilla hemoglobin gene is optimized, design has the reorganization Vitreoscilla hemoglobin gene of multiple-shaped nuohan inferior yeast preference codon, utilizes the method for PCR to carry out synthetic multiple-shaped nuohan inferior yeast preference Vitreoscilla hemoglobin gene then.Primer sequence is as shown in table 1.

The primer sequence of the synthetic multiple-shaped nuohan inferior yeast preference of table 1. PCR Vitreoscilla hemoglobin gene

Title	Sequence (5 '-3 ')
		HF1	5′gaattcatggaccaacaaactattaacattattaaggctactgttccagttttgaaggagc 3′
HF2	5′ctattactactactttctacaagaacttgttcgctaagcacccagaggttagaccattg 3′
		HF3	5′gggtagacaagagtctttggagcaaccaaaggctttggctatgactgttttggctgctg 3′
HF4	5′ttgagaacttgccagctattttgccagctgttaagaagattgctgttaagcactgtcaa 3′
		HF5	5′gtgttgctgctgctcactacccaattgttggtcaagagttgttgggtgctattaaggag 3′
HF6	5′gacgctgctactgacgacattttggacgcttggggtaaggcttacggtgttattgctga 3′
		HF7	5′tcaagttgaggctgacttgtacgctcaagctgttgagcaccaccaccaccaccactg 3′
HR1	5′ttcttgtagaaagtagtagtaatagtaacaccgtgctccttcaaaactggaacagtagc 3′
		HR2	5′ttgctccaaagactcttgtctacccatgtcgaacaatggtctaacctctgggtgctta 3′
HR3	5′ggcaaaatagctggcaagttctcaatgttttgagcagcagccaaaacagtcatagccaa 3′
		HR4	5′attgggtagtgagcagcagcaacaccagcttgacagtgcttaacagcaatcttc 3′
HR5	5′ccaaaatgtcgtcagtagcagcgtcacccaaaacctccttaatagcacccaacaactct 3′
		HR6	5′agcgtacaagtcagcctcaacttgaatgaaaacgtcagcaataacaccgtaagccttac 3′
HR7	5′gcggccgctcagtggtggtggtggtggtgctcaacagcttg 3′

The synthetic schemes of multiple-shaped nuohan inferior yeast preference Vitreoscilla hemoglobin gene Hb as shown in Figure 1.At first this sequence is divided into two parts.All primers are made the solution of 50pmol/L.Get HF2, HF3, HF4 and HR1, HR2, each 2 μ l of HR3 are behind the mixing, add 198 μ l sterilization distilled water and be diluted to 100 times, get 1 μ l HF1 and HR4 upstream and downstream primer, get the HF2 of 100 times of dilutions as the PCR reaction, HF3, HF4 and HR1, HR2, each 1 μ l of HR3 adds (50 μ l in the following PCR reaction system as the template of reaction, operation on ice): HF1 (50pmol/L) 1 μ l, HR4 (50pmol/L) 1 μ l, the primer (HF2 of 100 * dilution, HF3, HF4 and HR1, HR2, HR3) each 1 μ l, 10mmol/L dNTP 1 μ l, 10 * PCR reaction buffer, 5 μ l, Pfu DNA PCRsystem polysaccharase: 2U adds sterilization dd H ₂O to 50 μ l.

The PCR response procedures is: 94 ℃ of pre-sex change 3min of elder generation; 94 ℃ of sex change 30S then, 55 ℃ of annealing 45sec, 72 ℃ are extended 30S, 30 circulations; Last 72 ℃ are extended 10min.Product behind the pcr amplification carries out 1% agarose gel electrophoresis, and the purpose fragment is reclaimed in rubber tapping, obtains the F1 fragment (Hb-fragment1) of purifying, reclaims good fragment and is dissolved among the 30 μ l elution baffer.

Get HF6, HF7 and HR5, each 2 μ l of HR6, behind the mixing, add 198 μ l sterilization distilled water and be diluted to 100 times, get 1 μ l HF5 and HR7 as PCR react the upstream and downstream primer, get the HF6 of 100 times of dilutions, HF7 and HR5, each 1 μ l of HR6 adds (50 μ l, operation on ice) in the following PCR reaction system as the template of reaction: HF5 (50pmol/L) 1 μ l, HR7 (50pmol/L) 1 μ l, the primer of 100 times of dilutions (HF6, HF7 and HR5, HR6) each 1 μ l, dNTP (10mmol/L) 1 μ l, 10 * PCR reaction buffer, 5 μ l, Pfu DNAPCR system polysaccharase 2U adds sterilization dd H ₂O to 50 μ l.

The PCR response procedures is: 94 ℃ of pre-sex change 3min of elder generation; 94 ℃ of sex change 30S then, 55 ℃ of annealing 45sec, 72 ℃ are extended 30S, 30 circulations; Last 72 ℃ are extended 10min.1% agarose gel electrophoresis, the purpose fragment is reclaimed in rubber tapping, obtains the F2 fragment (Hb-fragment2) of purifying, reclaims good fragment and is dissolved among the 30 μ l elutionbaffer.

Design following reaction amplification F1+F2 fragment again:

Fetch F1 and each 1 μ l of F2 of receipts, behind the mixing, redilution 10 *, from 10 * dilution, get 1 μ l then and add (50 μ l in the following PCR reaction system as template, operation on ice): HF1 (50pmol/L) 1 μ l, HR7 (50pmol/L) 1 μ l, each 1 μ l of the F1 of 10 times of dilutions and F2, dNTP (10mmlo/L) 1 μ l, ExTaqDNA PCR system polysaccharase, 2 μ l, 10 * PCR buffer, 5 μ l are settled to 50 μ l.Behind the mixing, carry out PCR reaction (94 ℃ of pre-sex change 3min of elder generation; 94 ℃ of sex change 30s again, 55 ℃ of annealing, 72 ℃ are extended 60s, 30cycles; Last 72 ℃ are extended 10min), product 1% agarose gel electrophoresis that amplification obtains, the purpose fragment is reclaimed in rubber tapping, and it is dissolved in 50 μ l sterilization dd H ₂Among the O.The product that obtains is multiple-shaped nuohan inferior yeast preference Vitreoscilla hemoglobin gene, with its called after Hb, reclaiming the back is connected with the pMD18-T carrier, order-checking, show the nucleotide sequence that multiple-shaped nuohan inferior yeast preference Vitreoscilla hemoglobin gene Hb has sequence 1 in the sequence table, from 5 of sequence 1 ' end 3-458 is that Nucleotide is encoding sequence, will contain the pMD18-T carrier called after pMD18T-Hb of Hb, this Hb genes encoding Vitreoscilla hemoglobin (GenBank number: AY278200).

Embodiment 2, the structure that contains reorganization expression of vitreoscilla haemoglobin gene carrier and the acquisition of engineering bacteria

1, the structure of FMD promoter vector and MOX promoter vector

(the building process spare of pHFMDZA and pHMOXZA is seen document Houhui Song to pHFMDZA and pHMOXZA, Yong Li, Weihuan Fang, Yunfeng Geng, Xu Wang, Min Wang, BingshengQiu, Development of a set of expression vectors in Hansenula polymorpha, Biotechnology Letters, Volume 25, and Issue 23, and Dec 2003, Pages 1999-2006) transforms and obtain new FMD promoter vector pHFMDZR25SA-M and MOX promoter vector pHMOXZR25SA-M, these two carriers contain autonomously replicating sequence, HARS (sequence 2) 25SrDNA (sequence 3), and these two original papers can improve the copy number of goal gene.The terminator sequence AOX-TT of pHFMDZA and pHMOXZA replaced respectively becomes FMD-TT sequence (sequence 4) and MOX-TT sequence (sequence 5).

PHFMDZR25SA-M and pHMOXZR25SA-M without linearizing, can directly carry out electroporation with plasmid and transform in the process of electroporation transformed yeast.The method that makes up is as follows:

1) design primer (table 2) is from debaryomyces hansenii genome amplification HARS, 25SrDNA, FMD-TT and MOX-TT sequence

The primer sequence of table 2. amplification HARS, 25SrDNA, FMD-TT and MOX-TT sequence

With HARS upstream and downstream primer (HARS-up and HARS-down), 25S upstream and downstream primer (25S-up and 25S-down), FMD-TT upstream and downstream primer (FMD-TT-up and FMD-TT-down) and MOX-TT upstream and downstream primer (MOX-TT-up and MOX-TT-down) in the table 1, with the debaryomyces hansenii genome as template, increase respectively HARS, 25SrDNA, FMD-TT and MOX-TT sequence.The program of amplification is: earlier after 94 ℃ of 5min heat denatured, 94 ℃ of 1min then, 56 ℃ of 45sec, 72 ℃, 1min, after 30 circulations again 72 ℃ extend 10min.Reaction system is 50ul.The purpose fragment that obtains of amplification is carried out after rubber tapping is reclaimed behind the electrophoresis again, and the double enzyme site (shown in the table 2) according to design carries out double digestion, after enzyme is cut again rubber tapping reclaim standbyly, obtained the purpose fragment and be respectively the FMD-TT of 25SrDNA, 556bp of HARS, 2807bp of 512bp and the MOX-TT of 382bp.With pHFMDZA (HouhuiSong, Yong Li, Weihuan Fang, Yunfeng Geng, Xu Wang, Min Wang, Bingsheng Qiu, Development of a set of expression vectors in Hansenulapolymorpha, Biotechnology Letters, Volume 25, Issue 23, Dec 2003, Pages 1999-2006) reclaims the big fragment of 3035bp with tapping rubber behind XbalI and the BamHI double digestion rear electrophoresis, the product that reclaims be connected with FMD-TT PCR product behind the BamHI double digestion with XbalI, to connect the product transformed into escherichia coli again, utilize resistance (zeocin) substratum to screen, carry out PCR with FMD-TT upstream and downstream primer and identify positive colony, show the pHFMDZA carrier called after pHFMDZA-M that contains FMD-TT identifying through PCR, with pHFMDZA-M BglII single endonuclease digestion, reclaim linearizing enzyme behind the electrophoresis and cut product, it is carried out isocaudarner with HARS PCR product with the product behind BglII and the BamHI double digestion is connected, connect like this that BamHI site on the original HARS primer in back is destroyed to be fallen, only remaining BglII site, to connect the product transformed into escherichia coli again, on the resistance substratum, cultivate, utilize the HARS primer to identify positive colony, evaluation is shown the pHFMDZA-M carrier called after pHFMDZRA-M (Fig. 2) that contains HARS, the positive colony that obtains carries out the BglII single endonuclease digestion again, the enzyme that reclaims linearize behind the electrophoresis is cut product, with its be connected with the PCR product of BamHI double digestion 25SrDNA with BglII, with the same transformed into escherichia coli of product after connecting, on the resistance substratum, cultivate, utilize 25SrDNA upstream and downstream primer to identify positive colony, evaluation is shown the pHFMDZRA-M carrier called after pHFMDZR25SA-M (Fig. 4) that contains 25SrDNA.The building process of MOX promoter vector is with the building process of above-mentioned carrier, PCR product with XbalI and BamHI double digestion MOX-TT terminator, be connected to XbalI and BamHI double digestion pHMOXZA (the Houhui Song under excessively, Yong Li, Weihuan Fang, Yunfeng Geng, Xu Wang, MinWang, Bingsheng Qiu, Development of a set of expression vectors in Hansenulapolymorpha, Biotechnology Letters, Volume 25, Issue 23, Dec 2003, Pages 1999-2006) on, the carrier called after pHMOXZA-M that contains MOX-TT, with pHMOXZA-M BglII single endonuclease digestion, reclaim linearizing enzyme behind the electrophoresis and cut product, it is carried out isocaudarner with HARS PCR product with the product behind BglII and the BamHI double digestion is connected, connect like this that BamHI site on the original HARS primer in back is destroyed to be fallen, only remaining BglII site, to connect the product transformed into escherichia coli again, on the resistance substratum, cultivate, utilize the HARS primer to identify positive colony, evaluation is shown the pHMOXZA-M carrier called after pHMOXZRA-M (Fig. 3) that contains HARS, the positive colony that obtains carries out the Bg/II single endonuclease digestion again, the enzyme that reclaims linearize behind the electrophoresis is cut product, with its be connected with the PCR product of BamHI double digestion 25SrDNA with BglII, with the same transformed into escherichia coli of product after connecting, on the resistance substratum, cultivate, utilize 25SrDNA upstream and downstream primer to identify positive colony, evaluation is shown the pHMOXZRA-M carrier called after pHMOXZR25SA-M (Fig. 5) that contains 25SrDNA.

For easy to connect, pass through pcr amplification again, 5 ' end at the reorganization Vitreoscilla hemoglobin gene has added the EcoRI restriction enzyme site, 3 ' end has added the Not[restriction enzyme site, used synthetic gene primer sequence sees Table 1, because the primer sequence of synthetic gene originally is long especially, be inconvenient to identify recon like this, so designed its sequence of primers designed be: Hb-EcoRI: GaattcAtggaccaacaaactattaacattatt ( EcoRI), Hb-NotI: GcggccgcTcagtggtggtggtggtggtgctca ( AotI) be template with pMD18T-Hb, carry out pcr amplification.Its pcr amplification system is 50 μ l, and amplification program is 94 ℃ of 5min of elder generation; 94 ℃ of 1min then, 56 ℃ of 45sec, 72 ℃, 1min, after 30 circulations again 72 ℃ extend 10min.Pcr amplification obtains 5, and ' end has added the EcoRI restriction enzyme site, and 3 ' end has added the Hb of NotI restriction enzyme site.After this fragment cut with EcoRI and NotI enzyme, be inserted into respectively between the EcoRI and NotI enzyme recognition site of pHMOXZR25SA-M (Fig. 5) and pHFMDZR25SA-M expression vector (Fig. 4).Showing the pHMOXZR25SA-M called after pHMOXZR25S-Hb that contains Hb through order-checking; Showing the pHFMDZR25SA-M called after pHFMDZR25S-Hb that contains Hb through order-checking.

2.pHFMDZR25S-Hb expression at multiple-shaped nuohan inferior yeast

PHFMDZR25S-Hb is transformed multiple-shaped nuohan inferior yeast (Hansenula polymorpha) AS2.2412 (available from Microbe Inst., Chinese Academy of Sciences culture presevation chamber) with the electroporation conversion method, this electroporation conversion method is that the contriver is to (Faber, Haima et al., 1994) improvement, (transformation efficiency is up to 10 promptly to have avoided short circuit phenomenon in the electric shock process to improve transformation efficiency again ⁶).Concrete steps are as follows:

Choose multiple-shaped nuohan inferior yeast (Hansenula polymorpha) AS2.2412 (available from DSMZ of Microbe Inst., Chinese Academy of Sciences) mono-clonal in 5ml YPD liquid nutrient medium, 37 ℃ of overnight incubation, get 2ml bacterium liquid and add the pre-temperature of 200ml to 37 ℃ YPD, 37 ℃ are cultured to OD ₆₀₀Between=the 1.2-1.5 (about 6h).The centrifugal 5min of room temperature 6000rpm abandons supernatant, with 500mlTED (100mmol/L Tris-HCl; 50mM EDTA; 25mmol/L DTT, pH=8.0) suspension cell.At 37 ℃ of shaking tables, 200rpm shakes 15min, 4 ℃ of 6000rpm, centrifugal, 5min abandons supernatant, and the sucrose of the 270mmol/L of usefulness 200ml precooling is suspension cell gently, 4 ℃ of 6000rpm, centrifugal, 5min abandons supernatant, with the sucrose of the 270mmol/L of 100ml precooling suspension cell gently, 4 ℃ of 6000rpm, centrifugal, 5min, abandon supernatant, with the sucrose of the 270mmol/L of 1ml precooling suspension cell gently, be distributed into 100 μ l/ pipe ,-80 ℃ of preservations, in the competent cell of 100 μ l, add 10 μ l plasmid DNA (pHFMDZR25S-Hb or pHMOXZR25S-Hb), add in the electric shock cup in 2mm aperture shock parameters: 50uF, 100 Ω gently behind the mixing, 1.5KV, add YPDTM (1% yeast extract of 940 μ l after the electric shock immediately; 1% peptone; 2% glucose; 1mmol/L MgCL ₂), draw to the tubule of 2-5ml, 37 ℃ of shaking tables, 200rpm cultivates 1h.Get 100 μ l and be applied to the YPD flat board that contains Zeocin microbiotic (final concentration 100ug/ml), cultivated 2-3 days for 37 ℃, clone not of uniform size appears on the flat board, the picking mono-clonal utilizes primer Hb-EcoRI and Hb-NotI to carry out PCR and identifies recon, to show the transformant called after ASpHFMDZR25S-Hb that contains pHFMDZR25S-Hb through evaluation, contain the transformant called after ASpHMOXZR25S-Hb of pHMOXZR25S-Hb.

3, change active detection of the anti-oxygen deprivation of multiple-shaped nuohan inferior yeast preference Vitreoscilla hemoglobin gene engineering bacteria

1) multiple-shaped nuohan inferior yeast preference Vitreoscilla hemoglobin gene is to the influence of the biomass of its engineering bacteria

ASpHFMDZR25S-Hb, ASpHMOXZR25S-Hb and multiple-shaped nuohan inferior yeast (Hansenulapolymorpha) AS2.2412 (contrast) are fermented with three 250ml triangular flasks that 25ml, 50ml, 100ml YPD substratum are housed respectively respectively, inoculum size is 5% (volume ratio), add the methanol induction of 0.5% (volume ratio) every day at twice, coinduction four days promptly 96 hours.After getting 100 times of fermented liquid 10ul dilutions, with the YPD substratum in contrast, measure the OD of control group, ASpHMOXZR25S-Hb group and ASpHFMDZR25S-Hb group ₆₀₀Absorption value.The result is as follows:

Table 3. control group, ASpHMOXZR25S Hb group and ASpHFMDZR25S-Hb group culture biomass detect

Detect as can be seen from biomass parameters, at 25ml and 50ml, the biomass fundamental interval of control group, ASpHMOXZR25S-Hb group and ASpHFMDZR25S-Hb group is little in the triangular flask of 100ml, only need see that the difference of three's expression amount gets final product so whether play effect at the Vitreoscilla hemoglobin of relatively recombinating.Here the Vitreoscilla hemoglobin of recombinating as can be seen is little to the biomass influence.

2) multiple-shaped nuohan inferior yeast is had a preference for the influence of Vitreoscilla hemoglobin gene Hb to exogenous gene expression:

The engineering bacteria (being the multiple-shaped nuohan inferior yeast AS2.2497 transformant that changes hepatitis B surface antigen secretion expression carrier pHFMDHZ-R-HBsAgHan (200410047904.6) over to that the method for embodiment 2 obtains in 200410047904.6 the specification sheets according to number of patent application) that will contain hbsag gene is as recipient bacterium, change pHFMDZR25S-Hb or pHMOXZR25S-Hb over to recipient bacterium, make reorganization Vitreoscilla hemoglobin and hepatitis B surface antigen coexpression in multiple-shaped nuohan inferior yeast AS2.2497, in contrast with the multiple-shaped nuohan inferior yeast AS2.2497 transformant that changes hepatitis B surface antigen secretion expression carrier pHFMDHZ-R-HBsAgHan (200410047904.6) over to.Detect the influence of multiple-shaped nuohan inferior yeast preference Vitreoscilla hemoglobin gene Hb as follows to exogenous gene expression:

(contain 1.5% (volume ratio) glycerine, triangular flask pH5.0) ferments, and the liquid amount of triangular flask is respectively 25ml with 250ml the YPD nutrient solution to be housed, 50ml, 100ml, inoculum size is 5%, add the methanol induction of 0.5% (volume ratio) every day at twice, coinduction four days promptly 96 hours.Control group is also used identical treatment process.Because used foreign gene engineering bacteria is a secretor type hepatitis B surface antigen engineering bacteria, expression product is in nutrient solution, directly detect with 20 μ l supernatant liquors, the expression amount that detects hbsag gene by ELSA embodies the reorganization Vitreoscilla hemoglobin to yeast-leavened influence.During ELISA detected, the expression (the hepatitis B surface antigen test kit is bought in Huamei Bio-Engrg Co.) that detects hepatitis B surface antigen with the hepatitis B surface antigen detection kit was measured the light absorption value (OD at 450nm place with microplate reader ₁₅₀).The result is as shown in table 4, show the recipient bacterium of triangular flask transfer pHFMDZR25S-Hb that 25ml and 50ml substratum are housed or pHMOXZR25S-Hb and the hepatitis B surface antigen expression amount of contrast and do not have very big difference, this result be since the sample-loading amount of 25ml and 50ml for the triangular flask of 250ml, the enough multiple-shaped nuohan inferior yeast growths of the content of its oxygen are used, so do not have influence on the expression amount of hepatitis B surface antigen.And 100ml sample-loading amount air flow for the triangular flask of 250ml is not enough, can not satisfy the requirement of multiple-shaped nuohan inferior yeast oxygen in process of growth, has influenced the expression of hepatitis B surface antigen; In the 250ml triangular flask of dress 100ml substratum, the recipient bacterium hepatitis B surface antigen EL[SA detected result of changeing pHFMDZR25S-Hb is OD ₄₅₀=1.592, the recipient bacterium hepatitis B surface antigen ELISA detected result of changeing pHMOXZR25S-Hb is OD ₄₅₀=1.621, control group is OD ₄₅₀=0.164, absorb 10 times of value differences.Illustrate that Hb gene of the present invention can improve the utilization ratio of multiple-shaped nuohan inferior yeast engineering bacteria to oxygen under the oxygen deprivation situation.

Table 4.Hb is to the detected result that influences of exogenous gene expression

Sequence table

<160>5

<210>1

<211>466

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>1

ccatggacca acaaactatt aacattatta aggctactgt tccagttttg aaggagcacg 60

gtgttactat tactactact ttctacaaga acttgttcgc taagcaccca gaggttagac 120

cattgttcga catgggtaga caagagtctt tggagcaacc aaaggctttg gctatgactg 180

ttttggctgc tgctcaaaac attgagaact tgccagctat tttgccagct gttaagaaga 240

ttgctgttaa gcactgtcaa gctggtgttg ctgctgctca ctacccaatt gttggtcaag 300

agttgttggg tgctattaag gaggttttgg gtgacgctgc tactgacgac attttggacg 360

cttggggtaa ggcttacggt gttattgctg acgttttcat tcaagttgag gctgacttgt 420

acgctcaagc tgttgagcac caccaccacc accactgagc ggccgc 466

<210>2

<211>512

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>2

gtcgacgaac ccgcgtttga gtacttgctc aagctttctg gtagacgttg tagtactcat 60

gaaacaagcc ttagcactct gatctgtttc tcttgggtag cggtgagtgg tttattggag 120

ttcactggtt tcagcaaatc tgtcatctag acaatattgt tactaaattt ttttgaacat 180

acaattgttc gtaattcatc tattattata catcctcgtc agcaatttct ggcagacgga 240

gtttactaca acgtctttga gtatgaggcc gagaaatcca gctctgtggc catactcagt 300

cttgacagcc tgctgatgtt ggctgcgttc aacgcaataa gcgtgtcctc cgactccgag 360

ttgtgctcgt tatcgtcgtt ctcatcctcg gaaaaatcac acgaaagaac atactcacca 420

gtaggctttc tggtccctgg ggcacggctg tttctgacgt attccggcgt tgataatagc 480

tcgaaagtga acgccgagtc gcgggagtcg ac 512

<210>3

<211>2807

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>3

agactactgg caggatcaac cagataacta tctgatgtta ggccggaacc taacaagcgc 60

ttcccgctaa acagcccgag agctgtccag cagacaaagc agcagatatt attatcagtt 120

cgcaatcaag attccaagag aaatctcaat cggcagaagc ccaccgcgcc ggccgcttta 180

ctggccctcg cagagactaa ctgcatccat atagccctct ttgagttctc ccgaataatt 240

tccgcaaaat cattttggca gctgataacg ctaccaaaag tttttacatc attatcctgg 300

aaggaagtta caagcagaaa catcacgtag taaaaaaaaa ctacggctat gcttcgctgc 360

agactcccaa attcgtcttt agtagagttc ttgccatagg ctagtaatcc actaaatcca 420

tcagtgctca cacacaaaaa taattagaaa tttggtatga gactgttcag gctactcagg 480

ccatcaaaaa ttattttttt gtgaccgccc aagatcaccc atgttgaatt agccttgaga 540

gaaagtgtat ctgacgataa caactttact ctctccacta atcaacgagg ccttgaagag 600

ttcttttcag aactcccttt cgaagatcga accccaaacg cgcagaagct ttcgcttctt 660

cacattcagt tttcaaatct tcttttatgc tttcgcatga aagtccatcc gcatctctca 720

cgtataattt cctctccaat ataatttatt ccaaaatttc catagttatg catttacttt 780

tttttcgcaa ctctctccag ctttttatat ttttcatttc gattctaatt ctataccatc 840

tccaaatatt attcccccga cgtatttctt tgtaccacga aatttttact tcgtgccacc 900

ccctactacg cgacaaccaa aaaattaaag atactcaaaa aaccacaatc tcgtcactgg 960

aatatggagt ttctacgctt tgcagtcaat tccctttaac attgacattg tgcaggtctc 1020

caaattgaca ttcatacaat ccatgccggt tcttcatttt tcaacaggag atcctcttct 1080

aatttccaat ttctccatct ttttaattct cctacgtaga atcgtcaaac cactcataca 1140

atatcacttc agtacatcct tcatctacgg ttacagtggt cttctctatc atccatcata 1200

ctatctcacc taccaagaaa aaaaaaaaat attatggtta cgcatttcgt tctacaacag 1260

ctgccaccac cagccaacag ttagttgaaa agtacttctc ccttgctaaa tccatatccc 1320

ccactcgttt ccatactctt tcggttgcgg ccatatctag cagaaagcac cgtttcccgt 1380

ccgatcaact gtagttaagc tgctaagagc ctgaccgagt agtgtagtgg gagaccatac 1440

gcgaaactca ggtgctgcaa tctttttttt ttttattatt tttttttccc ttccctccag 1500

tccaacgcgg tctcgaggtc gcgttctgca tcaatccatt gtctatccaa acgtctatat 1560

atatatgccc acctcttcca cacctatctt ttttttcctc ccagcacgta gagaagagtg 1620

gtcgccaatc ctaatccctc cgacttcttc ttgtaatcct gcctttagga agagcagcaa 1680

cagtggtatg gtgcaaaaag tcttcattca tcctttacca ctaccacttt ttttgccggc 1740

tcttccaggc accttgtagc acctctttca actctgccac catctctata cttaaatttt 1800

cctttccagc gccagataac aaacaggacg tgtgccacac actttgcatc acagaatatc 1860

tgtcgattct gcctactttt gttagcttag ttgcccgtat cgtactcact tttcatacga 1920

caaccatcaa ttaccataca ttttttttca tttaccttct attttactat ggtacagaat 1980

atctgtcatt tgtcagagct caggacactt ctattggcca atatcacccg aaatgtttga 2040

gctagatatc cttacaccac ttcactactc acatcgaaaa ttcaatctaa attattgaag 2100

gcttgctacc aaaaaaaaat aaagaaaaat aaaaaaaaaa aatcatatcc ctgaaaaata 2160

catgataata ataataagta ggaaaaaaaa aaaaattaga aaaataatgc tggttcctct 2220

cctcgactca aatgtttttt ttatacacca tccagaattg ttccacgcac gacctctgct 2280

tcaaaaaaat taaaaatctc ctctaaaaga cacccggcta ccaccaagta atatctctta 2340

ggggagattg tgttgtgtaa acacaaacaa atcggacaac tgaggcttaa tctcagcaga 2400

tcgtaacaac aaggctactc tactgcttac aataccccgt tgtacattta agtcgtatgc 2460

aaaggattta tcctcgcgca taatgacatt gctatccacc ggcaagcact taaaaccttt 2520

ccgttaaaag caccattgcc agcctgctat ggttcagcga cacagagtgc cttattcgta 2580

tccaactaaa atgtgcgagg gcaagaaatc atcgctttct agcatggatt ctgacttaga 2640

ggcgttcagc cattatccag cagatggtag cttcgcggca atgcctgatc agacagccgc 2700

aaaaaccaat tatctgaatg aacggttcct ctcgtactaa gttcaattac tattgcgata 2760

acattcatca gtagggtaaa actaacctgt ctcacgacgg tctaaac 2807

<210>4

<211>556

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>4

agcggtcttg gaggagctga ttggatctag atgaaatagg aaatataatt atggctctac 60

tgcgctgcgt aaacgtcact gtaggcgatt tcgcttagcc caagtccgcg atgcggtccg 120

acgacaccag agcgcgtcca cctcctgtgc gccgcaccgc ccccaaagga ggttgcggct 180

gtgcggctcg acgcgaccaa aaaaataagc gtcaaaagga ggtgtcaggg aagcacgccg 240

tggggctcga gatatataaa gcgcagcgta gctttgtctg tcttgctaat gagcgacgac 300

caagccttgg aaattttcct gaaatccccc gtcacccagg acatgatcca ccacttggtg 360

acggtcacct tacaggttct gccttgcgag tcctccaaga ccatcaccca gaaagtcaag 420

tcttcagccg acacagagcc cgtgctcaag accaagccgc tgccctcgct gcatgacttt 480

caccaagctc gtccgctata ccaacgtcta cacgggaacg ttgatgtcga ccatcgtgtt 540

cctcaacaga ctacaa 556

<210>5

<211>382

＜213〉artificial sequence

<220>

<223>

<400>5

tctagacgtg gaaggacata ccgcttttga gaagcgtgtt tgaaaatagt tctttttctg 60

gtttatatcg tttatgaagt gatgagatga aaagctgaaa tagcgagtat aggaaaattt 120

aatgaaaatt aaattaaata ttttcttagg ctattagtca ccttcaaaat gccggccgct 180

tctaagaacg ttgtcatgat cgacaactac gactcgttta cctggaacct gtacgagtac 240

ctgtgtcagg agggagccaa tgtcgaggtt ttcaggaacg atcagatcac cattccggag 300

attgagcagc tcaagccgga cgttgtggtg atatcccctg gtcctggcca tccaagaaca 360

gactcgggaa tatctcggat cc 382

Claims (10)

1, a kind of Vitreoscilla hemoglobin gene, its nucleotide sequence is shown in SEQ ID NO:1.

2, contain the described expression carrier of claim 1.

3, expression vector according to claim 2 is characterized in that: described expression vector is pHMOXZR25S-Hb; Described pHMOXZR25S-Hb is that the multiple clone site that the dna sequence dna with SEQ ID NO:1 is inserted into pHMOXZR25SA-M as shown in Figure 5 obtains.

4, expression vector according to claim 2 is characterized in that: described expression vector is pHFMDZR25S-Hb; Described pHFMDZR25S-Hb is that the multiple clone site that the dna sequence dna with SEQ ID NO:1 is inserted into pHFMDZR25SA-M expression vector as shown in Figure 4 obtains.

5, the transgenic cell line that contains the described gene of claim 1.

6, the host bacterium that contains the described gene of claim 1.

7, host bacterium according to claim 6 is characterized in that: described host bacterium is a multiple-shaped nuohan inferior yeast.

8, host bacterium according to claim 7 is characterized in that: described multiple-shaped nuohan inferior yeast is multiple-shaped nuohan inferior yeast AS 2.2412 or AS2.2497.

9, the described gene of claim 1 is expressed application in the efficient of goal gene improving the multiple-shaped nuohan inferior yeast engineering bacteria under the oxygen deprivation situation.

10, application according to claim 9 is characterized in that: described goal gene is a hbsag gene.

Images