CN113832237B - SNP molecular marker related to cholesterol metabolism of meat rabbits and application thereof - Google Patents
SNP molecular marker related to cholesterol metabolism of meat rabbits and application thereof Download PDFInfo
- Publication number
- CN113832237B CN113832237B CN202111103066.XA CN202111103066A CN113832237B CN 113832237 B CN113832237 B CN 113832237B CN 202111103066 A CN202111103066 A CN 202111103066A CN 113832237 B CN113832237 B CN 113832237B
- Authority
- CN
- China
- Prior art keywords
- molecular marker
- snp molecular
- meat
- rabbits
- cholesterol
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Meat, Egg Or Seafood Products (AREA)
Abstract
The invention relates to a SNP molecular marker related to cholesterol metabolism of meat rabbits and application thereof, wherein the SNP molecular marker is positioned in a 3 rd intron region of a CAST gene of the meat rabbits, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID No.1, a G/T mutation site exists at a 190 th base of the sequence, the mutation causes the nucleotide of the sequence to generate polymorphism, and when the genotype of the site is GG, the meat rabbits to be tested belong to individuals with low content of cholesterol and low density lipoprotein in blood plasma.
Description
Technical Field
The invention belongs to the technical field of preparation of molecular markers of rabbits, and particularly relates to an SNP molecular marker related to cholesterol metabolism of meat rabbits and application thereof.
Background
The meat rabbits have good economic value and medicinal value, and the medicinal value of the rabbits is comprehensively introduced in medical treasury of plum fashion of ancient famous medical science in China, such as the meat of the rabbits is used as a medicine, so that the effects of tonifying middle-jiao and Qi, warming and wetting arthralgia, quenching thirst and strengthening spleen and suppressing the red lead toxin can be achieved; the rabbit blood can be used as a medicine, and has good effects of cooling blood, activating blood, removing heat toxin in the tyre and accelerating the production; the rabbit liver can play a good role in improving eyesight and tonifying fatigue when being used as a medicine. However, because of the strong wild nature, small size, slow growth rate, relatively high cholesterol, and limited medicinal value in meat rabbits. Therefore, the development and utilization of the novel molecular breeding markers to improve the medicinal value of the meat rabbits have important significance for the cultivation of high-quality meat rabbits.
Along with the development of molecular quantity genetics and biotechnology, the nucleic acid hybridization and high-throughput sequencing technology has been widely applied to animal breeding, and single nucleotide polymorphism (Single nucleotide polymorphism, SNP) molecular genetic markers have the advantages of wide distribution, genetic stability and suitability for high-throughput automatic analysis, so that the method becomes an important means for animal breeding improvement. Therefore, the molecular marker related to cholesterol metabolism of the meat rabbits provides a feasible way for improving the medicinal value of the meat rabbits.
Disclosure of Invention
The invention aims to provide an SNP molecular marker related to cholesterol metabolism of meat rabbits and application thereof.
In order to achieve the above purpose, the invention adopts the following technical scheme:
SNP molecular marker related to cholesterol metabolism of meat rabbits, wherein the molecular marker is derived from meat rabbitsCASTThe 3 rd intron region (NC_ 013679.1) of the gene is cloned, and the nucleotide sequence is as follows:
5’-CTTATGTTGATGTGAGCGTTTGCGCTTGGCTCTCTTGTTAAGGTGTTGTCCCTCATCGAAACCCATGTTTTCTGTTTCCAAGAAAAAGGCAGCCAGCCTCGGGAGCGGTCAGTCTTCCAGAACCAGCACTGGTGGAGCAGTCCCAGCGGCCAAGGTCAGTCACTTTCCAAGCAGGGAGAGACCCCTGCTBTTCCTCCTGGCACACAGGCCTGGGTGT-3’（SEQ ID No.1）；
b at 190bp in the above nucleotide sequence is G or T, resulting in polymorphism.
B at 190bp in the nucleotide sequence is related to the cholesterol content in plasma of the meat rabbit.
B at 190bp in the nucleotide sequence is also related to the content of low-density lipoprotein in the plasma of the meat rabbit.
A primer pair for identifying the SNP molecular marker, wherein the nucleotide sequence of the primer pair is as follows:
upstream primer (SEQ ID No. 2): 5'-CTTATGTTGATGTGAGCGTTTGC-3' the number of the individual pieces of the plastic,
downstream primer (SEQ ID No. 3): 5'-CGCAGTGACACCCAGGCC-3'.
The SNP molecular marker related to cholesterol or low density lipoprotein content in blood plasma is applied to breeding of high-quality meat rabbits.
The application of the SNP molecular marker related to the cholesterol or low-density lipoprotein content in the plasma in the detection of the cholesterol or low-density lipoprotein content in the plasma of the meat rabbits.
The primer pair is applied to breeding high-quality meat rabbits.
The primer pair is applied to the detection of the content of cholesterol or low density lipoprotein in plasma of meat rabbits.
The invention has the advantages that: the SNP marker locus provided by the invention is related to the cholesterol content in the plasma of the meat rabbits, and is also related to the low-density lipoprotein content in the plasma of the meat rabbits, and the molecular marker and the primer developed based on the SNP marker locus can be used for detecting SNP, so that the SNP marker can be identified to screen low-cholesterol meat rabbit strains, and the SNP marker has positive significance for improving the meat rabbit varieties and improving the medicines.
Drawings
FIG. 1 is a meat rabbit cloned in accordance with the present inventionCASTThe sequence fragment of the 3 rd intron region of the gene, namely the nucleotide sequence of the molecular marker screened by the invention, has the sequence length of 217bp, and the B at 190 th base of the sequence has a G/T allelic mutation, which is marked in the figure.
FIG. 2 is a distribution of different genotypes in a rabbit population.
Detailed Description
The present invention will be described in further detail with reference to examples, but embodiments of the present invention are not limited thereto.
Example 1
1. Experimental animal origin
The experimental meat rabbit breeds used in this example were as follows:
fujian yellow rabbits are provided by a natural ecological agriculture test field of Lian Jiangyu Huashan of Fujian province;
the Minsouthwest black rabbit is provided by the developing company of the Xian rabbit industry in Longyan city;
new Zealand white rabbits and Fujian white rabbits are provided by Wu Pingxian Wu Dongxiang Yuan Tiancun Fujian white rabbits seed protection fields.
2. Determination of cholesterol content and low-density lipoprotein content of meat rabbits
Collecting 1-2mL of vein blood at the ear margin of the fasted meat rabbit, and procoagulant vacuum blood collection tube (test animal fasted for 12h before blood collection, and simultaneously letting it drink water freely, and carrying out vein blood collection in awake state), flicking the tube bottom to make blood fully anticoagulated, and avoiding hemolysis.
Collecting 5mL of the empty stomach rabbit jugular vein blood in a coagulation-promoting vacuum blood collection tube, standing for 30min, centrifuging for 15min at 3000r/min, absorbing supernatant, preserving at 2-8deg.C for standby, and measuring CHOL and LDL contents by using a BECKMAN COULTER AU2700 large-scale full-automatic biochemical analyzer and Ningbo Kangmei biochemical kit (reference: chen Dongjin, chen Yanfeng, xie Xiping, etc. Fujian white rabbit blood physiological and biochemical index is measured [ J ]. University of agriculture university of Jiangxi, report 2013, 35 (4): 826-830.).
3. Meat rabbit genome DNA extraction
The whole blood genome DNA extraction kit (Beijing full gold biotechnology Co., ltd.) is used to extract the meat rabbit genome DNA, and the specific steps are as follows:
1mL of rabbit ear venous blood is collected in an anticoagulation vacuum tube of ethylene diamine tetraacetic acid (EDTA-K2), fully and uniformly mixed with an anticoagulant, then 250 mu L of anticoagulation is taken in a new 2mL eppendorf tube, 20 mu L of proteinase K and 500 mu L of BB3 lysate are added into the anticoagulation vacuum tube, fully and uniformly mixed, and then incubation is carried out for 10min at room temperature; adding the whole solution into a centrifugal column, centrifuging 12000g for 1min, and discarding effluent; adding 500 mu L of CB3 balance solution into the centrifugal column, centrifuging for 30s by 12000g, and discarding effluent; adding 500 mu L of WB3 rinsing liquid into the centrifugal column, centrifuging for 30s by 12000g, discarding effluent liquid, repeating the steps, and centrifuging for 2min by 12000g to thoroughly remove residual WB3 rinsing liquid; adding 50-200 mu L of preheated EB eluent (preheated at 60-70 ℃ before use) into the centrifugal column, standing for 1min at room temperature, centrifuging for 1min by 12000g, and eluting DNA; detecting the concentration and quality of the extracted DNA, diluting the qualified DNA sample to 100-300 ng/. Mu.L, and storing at-20deg.C for use.
The protease K, BB lysate, the CB3 balance solution, the WB3 rinse solution and the EB eluent are provided by matching a DNA extraction kit.
4. SNP locus screening and genotyping
Rabbit was prepared using Primer premier5.0 softwareCASTThe primer was designed for the gene 3 rd intron sequence (NC_ 013679.1) and was entrusted to the Saint John's lifeSynthesis by materials technologies Inc. The primer pair sequences were as follows:
upstream primer (SEQ ID No. 2): 5'-CTTATGTTGATGTGAGCGTTTGC-3';
downstream primer (SEQ ID No. 3): 5'-CGCAGTGACACCCAGGCC-3'.
PCR amplification was performed using the extracted DNA as a template according to the designed primers. PCR reaction 10. Mu.L: 5U/. Mu.L Taq enzyme 0.1. Mu.L, 1. Mu.M upstream primer 1. Mu.L, 1. Mu.M downstream primer 1. Mu.L, template DNA 2. Mu.L, 10 Xbuffer 1. Mu.L, 2.5mM dNTP 0.8. Mu.L, 100mM Mg 2+ 1 mu L, supplement ddH 2 O to a final volume of 10. Mu.L. The PCR was run as follows: 95 ℃ for 15min;94 ℃ for 30s,60 ℃ for 90s and 72 ℃ for 30s, and 35 cycles are total; and at 72℃for 10min. The PCR product is detected by 2% agarose gel electrophoresis, the amplified target fragment size is 217bp, and the electrophoresis diagram is shown in figure 1. The remaining amplified products were mixed together and sent to cloning sequencing by Shanghai, biotechnology Co., ltd, SNPs were found using chromasPro software, and G/T mutation was detected at 190bp, see FIG. 1.
The primers are used for detecting the genotype of the SNP locus by taking the DNA of 165 Fujian white rabbits, 84 Fujian southwest black rabbits, 116 New Zealand white rabbits and 80 Fujian yellow rabbits as templates.
First, the genomic DNA of the local meat rabbits of Fujian was amplified by three rounds of PCR. First round PCR reaction System 10. Mu.L: 10 Xbuffer 1. Mu.L, 50nM upstream primer 1. Mu.L, 50nM downstream primer 1. Mu.L, 2.5mM dNTP 0.8. Mu.L, hot start Taq enzyme 0.5U, template DNA 2. Mu.L, 100mM Mg 2+ 1 mu L, supplement ddH 2 O to a final volume of 10. Mu.L; the PCR was run as follows: 95 ℃ for 15min;94 ℃ for 30s,60 ℃ for 10min and 72 ℃ for 30s, and 4 cycles are total; 94℃30s,60℃1min,72℃30s, 20 cycles total. Second round PCR reaction System 10. Mu.L: the product obtained by the first round of PCR was 3. Mu.L, 10 Xbuffer 1. Mu.L, 2.5mM dNTP 0.8. Mu.L, hot start Taq enzyme 0.5U, 100mM Mg 2+ 1 mu L, supplement ddH 2 O to a final volume of 10. Mu.L; the PCR was run as follows: 95 ℃ for 15min;94 ℃ for 30s,60 ℃ for 10min and 72 ℃ for 30s, and 4 cycles are total; 94℃30s,65℃1min,72℃30s, 40 cycles total. Third round PCR reaction System 20. Mu.L: the product obtained from the second round of PCR was 10. Mu.mL, 10 Xbuffer 2. Mu.L, 2. Mu.M Barcode 3.6. Mu.L, 2.5mM dNTP 0.8. Mu.L, hot start Taq enzyme 0.5U, 100mM Mg 2+ 1 mu L, supplement ddH 2 O to a final volume of 20. Mu.L; the PCR was run as follows: 95 ℃ for 15min;94 ℃ for 30s,60 ℃ for 4min and 72 ℃ for 30s, and 4 cycles are total; 94℃30s,65℃1min,72℃30s, 40 cycles total. After the third round of amplification, the PCR product was subjected to agarose gel electrophoresis detection, and 5. Mu.L of the PCR product was loaded.
The PCR product was then recovered. Transferring 5 mu L of each qualified PCR amplification product obtained by amplifying 373 Fujian local rabbit DNA samples into the same U-shaped groove for mixing, transferring 200 mu L of the mixture into a new round bottom centrifuge tube, fixing the centrifuge tube on a shaking table after vortex shaking for 30S, and shaking at normal temperature and 250rpm overnight. And then carrying out agarose gel electrophoresis on the mixed sample library, recovering a gel block containing the target fragment after electrophoresis, and temporarily storing the recovered product at 4 ℃ for later use.
SNP typing is then performed. The above products stored at 4℃were commissioned to the Shanghai wing Synbiotics Co., ltd, and subjected to second generation sequencing typing (NGS, next-generation sequencing) by ILLumina X-10 sequencing platform, and the sequencing results were subjected to image recognition and genotyping and statistics by using Illumina RTA and Illumina bcl2fastq software. Genotyping of SNP sites related to cholesterol and low density lipoprotein levels in plasma of 373 rabbits is shown in FIG. 2. The distribution frequency of the different genotypes and alleles in 373 Fujian local rabbits is shown in Table 1, with GG genotype frequency of 0.14, TT genotype frequency of 0.40, GT genotype frequency of 0.46, G allele frequency of 0.63, T allele frequency of 0.37.
TABLE 1 genotypes and allele frequencies of different meat rabbit populations
5. Correlation analysis of SNP molecular markers and cholesterol and low density lipoprotein content in plasma of meat rabbits
And performing analysis of variance by adopting a GLM model of SAS 9.4 software, and performing correlation analysis on each genotype of the polymorphic site, the muscle fiber area of the dorsum muscle and the cholesterol and low-density lipoprotein content in blood. The analytical model is:
Y ijkl =μ+ G i +B j +P k +S l +e ijkl
wherein Y is ijkl As observed values of the characters, mu is the average value, G i For genotypic effect, B j For variety effect, P k For batch effect, si is the sex effect vector, e ijkl Is a random error. The analytical results were verified using bonferrri multiple comparisons.
As shown in Table 2, the plasma content of low density lipoprotein in GG genotype individuals was 40.32% lower than that in TT genotype individuals in the meat rabbit population, and was found to be at a very significant level [P<0.01 32.73% lower than GT genotype individuals, and shows a significant level%P<0.05 A) is provided; the cholesterol content in the plasma of GG genotype individuals is 18.40% lower than that of TT genotype individuals, and the GG genotype individuals are at a significant levelP<0.05 11.92% lower than the GT genotype individuals, but without significant differences. Therefore, in the meat rabbit population, the GG genotype individuals are bred in a secondary mode, so that the contents of the low-density lipoprotein and the cholesterol in the plasma of the meat rabbits can be gradually reduced, and the purpose of improving the medicinal value of the meat rabbits is achieved. And when the G/T mutation site at 190bp from the 5' end of the nucleotide sequence shown in SEQ ID No.1 of the individual meat rabbit is GG, the meat rabbit can be judged to belong to an individual with low cholesterol content and low density lipoprotein content in blood plasma.
TABLE 2 correlation analysis of genotype at SNP locus with cholesterol, low Density lipoprotein content in plasma of meat rabbits
Note that: the difference between the upper mark lower letter and the upper mark lower letter is obviousP<0.05 The difference between the upper-marked capital letters is very obviousP<0.01）。
SEQUENCE LISTING
<110> institute of livestock and veterinary at the national academy of agricultural sciences of Fujian province
<120> SNP molecular marker related to cholesterol metabolism of meat rabbit and application thereof
<130>
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 217
<212> DNA
<213> artificial sequence
<400> 1
cttatgttga tgtgagcgtt tgcgcttggc tctcttgtta aggtgttgtc cctcatcgaa 60
acccatgttt tctgtttcca agaaaaaggc agccagcctc gggagcggtc agtcttccag 120
aaccagcact ggtggagcag tcccagcggc caaggtcagt cactttccaa gcagggagag 180
acccctgctb ttcctcctgg cacacaggcc tgggtgt 217
<210> 2
<211> 23
<212> DNA
<213> artificial sequence
<400> 2
cttatgttga tgtgagcgtt tgc 23
<210> 3
<211> 18
<212> DNA
<213> artificial sequence
<400> 3
cgcagtgaca cccaggcc 18
Claims (4)
1. A SNP molecular marker fragment associated with cholesterol metabolism in meat rabbits, characterized in that: the nucleotide sequence of the SNP molecular marker fragment is as follows:
5’-CTTATGTTGATGTGAGCGTTTGCGCTTGGCTCTCTTGTTAAGGTGTTGTCCCTCATCGAAACCCATGTTTTCTGTTTCCAAGAAAAAGGCAGCCAGCCTCGGGAGCGGTCAGTCTTCCAGAACCAGCACTGGTGGAGCAGTCCCAGCGGCCAAGGTCAGTCACTTTCCAAGCAGGGAGAGACCCCTGCTBTTCCTCCTGGCACACAGGCCTGGGTGT-3’；
b at 190bp in the nucleotide sequence of the SNP molecular marker fragment is G or T, so that polymorphism is caused.
2. A primer pair for amplifying the SNP molecular marker fragment of claim 1, characterized in that: the nucleotide sequence of the primer pair is as follows:
an upstream primer: 5'-CTTATGTTGATGTGAGCGTTTGC-3' the number of the individual pieces of the plastic,
a downstream primer: 5'-CGCAGTGACACCCAGGCC-3'.
3. The use of the SNP molecular marker fragment according to claim 1 for breeding high-quality meat rabbits, wherein: when the G/T mutation site at 190bp from the 5' end of the SNP molecular marker fragment is GG type, the meat rabbit can be judged to belong to an individual with low cholesterol content and low density lipoprotein content in blood plasma.
4. Use of a primer pair according to claim 2 for breeding quality meat rabbits.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111103066.XA CN113832237B (en) | 2021-09-18 | 2021-09-18 | SNP molecular marker related to cholesterol metabolism of meat rabbits and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111103066.XA CN113832237B (en) | 2021-09-18 | 2021-09-18 | SNP molecular marker related to cholesterol metabolism of meat rabbits and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113832237A CN113832237A (en) | 2021-12-24 |
| CN113832237B true CN113832237B (en) | 2023-07-28 |
Family
ID=78960037
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111103066.XA Active CN113832237B (en) | 2021-09-18 | 2021-09-18 | SNP molecular marker related to cholesterol metabolism of meat rabbits and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113832237B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003060151A2 (en) * | 2002-01-09 | 2003-07-24 | Iowa State University Research Foundation, Inc. | Novel calpastatin (cast) alleles |
| WO2007012119A1 (en) * | 2005-07-26 | 2007-02-01 | Commonwealth Scientific And Industrial Research Organisation | A method for assessing traits selected from longissimus dorsi peak force, intramuscular fat, retail beef yield and net feed intake in bovine animals |
| CN101942438A (en) * | 2010-09-10 | 2011-01-12 | 中国农业科学院北京畜牧兽医研究所 | Sheep back fat trait-related SNP and application thereof |
| CN112322753A (en) * | 2020-11-27 | 2021-02-05 | 广西扬翔股份有限公司 | SNP molecular marker related to pork intramuscular fat and application thereof |
-
2021
- 2021-09-18 CN CN202111103066.XA patent/CN113832237B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003060151A2 (en) * | 2002-01-09 | 2003-07-24 | Iowa State University Research Foundation, Inc. | Novel calpastatin (cast) alleles |
| WO2007012119A1 (en) * | 2005-07-26 | 2007-02-01 | Commonwealth Scientific And Industrial Research Organisation | A method for assessing traits selected from longissimus dorsi peak force, intramuscular fat, retail beef yield and net feed intake in bovine animals |
| CN101942438A (en) * | 2010-09-10 | 2011-01-12 | 中国农业科学院北京畜牧兽医研究所 | Sheep back fat trait-related SNP and application thereof |
| CN112322753A (en) * | 2020-11-27 | 2021-02-05 | 广西扬翔股份有限公司 | SNP molecular marker related to pork intramuscular fat and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 牛肉质性状候选基因研究进展;蒋秋斐;顾亚玲;;生物技术(05);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113832237A (en) | 2021-12-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107385059B (en) | Molecular marker related to growth traits of broiler chickens and application thereof | |
| CN109468315B (en) | Rice flooding-resistant gene Sub1 codominant molecular marker and application thereof | |
| CN111286543B (en) | Haplotype marker related to egg shell quality traits in KRT14 gene and application thereof | |
| CN113502335B (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN106939342B (en) | SNP marker linked with millet beige, primer and application | |
| CN109825598B (en) | SNP (Single nucleotide polymorphism) marker remarkably related to Australian white sheep hair thickness, molecular marker and application | |
| CN111286541B (en) | Haplotype marker related to lambing number in 3' UTR of goat ZBP1 gene and application thereof | |
| CN111440878B (en) | Haplotype marker related to quality traits of egg shells in CDH17 genes and application | |
| CN107354211A (en) | The base microsatellite genetic marker site of woods musk deer four and its screening technique | |
| CN110923333B (en) | Haplotype marker related to lambing number in first intron of goat ZBP1 gene and application thereof | |
| CN108642201B (en) | SNP (Single nucleotide polymorphism) marker related to millet plant height character as well as detection primer and application thereof | |
| CN113832237B (en) | SNP molecular marker related to cholesterol metabolism of meat rabbits and application thereof | |
| CN113718041B (en) | SNP molecular marker related to muscle drip loss character of meat rabbits and application thereof | |
| CN111518896A (en) | Primer group, application, product and method for detecting nicotine dependence related SNP site | |
| CN108707685B (en) | SNP (Single nucleotide polymorphism) marker related to tillering number character of millet as well as detection primer and application thereof | |
| CN109825600A (en) | One kind SNP marker relevant to Suhuai pig muscle drip loss and detection method | |
| CN113025702B (en) | Early screening method and kit for ankylosing spondylitis susceptibility genes | |
| CN113718040B (en) | SNP molecular marker related to immunity traits of meat rabbits and application thereof | |
| CN112592972B (en) | Early screening method and kit for diffuse toxic goiter susceptibility genes | |
| CN108642203B (en) | SNP (Single nucleotide polymorphism) marker related to millet stem thickness character as well as detection primer and application thereof | |
| CN108715901B (en) | SNP marker related to millet plant height character and detection primer and application thereof | |
| CN112410441A (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288479.1-95621 | |
| CN108728566B (en) | SNP (Single nucleotide polymorphism) marker related to thousand grain weight traits of millet as well as detection primer and application thereof | |
| Amr et al. | Targeted hybrid capture for inherited disease panels | |
| CN108642198B (en) | SNP (Single nucleotide polymorphism) marker related to tillering number character of millet as well as detection primer and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |