CN113832237A - SNP molecular marker related to cholesterol metabolism of meat rabbits and application thereof - Google Patents
SNP molecular marker related to cholesterol metabolism of meat rabbits and application thereof Download PDFInfo
- Publication number
- CN113832237A CN113832237A CN202111103066.XA CN202111103066A CN113832237A CN 113832237 A CN113832237 A CN 113832237A CN 202111103066 A CN202111103066 A CN 202111103066A CN 113832237 A CN113832237 A CN 113832237A
- Authority
- CN
- China
- Prior art keywords
- molecular marker
- meat
- snp molecular
- cholesterol
- rabbits
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Meat, Egg Or Seafood Products (AREA)
Abstract
The invention relates to an SNP molecular marker related to cholesterol metabolism of meat rabbits and application thereof, wherein the SNP molecular marker is positioned in the 3 rd intron region of a meat rabbit CAST gene, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID No.1, a G/T mutation site exists at the 190 th base of the sequence, the mutation causes the nucleotide of the shown sequence to generate polymorphism, and when the genotype of the site is GG, the meat rabbits to be detected belong to individuals with low contents of cholesterol and low-density lipoprotein in blood plasma.
Description
Technical Field
The invention belongs to the technical field of preparation of rabbit molecular markers, and particularly relates to a meat rabbit cholesterol metabolism related SNP molecular marker and application thereof.
Background
The meat rabbit not only has good economic value, but also has good medicinal value, the medicinal value of the rabbit is comprehensively introduced in the medical treasury 'Bencao gang mu' of Li Shizhen of ancient medical scientists in China, and if the meat of the rabbit is used as a medicine, the meat of the rabbit can play a good role in tonifying middle-jiao and Qi, relieving heat and damp arthralgia, quenching thirst and strengthening spleen, and suppressing erysipelas; the rabbit blood is used as a medicine, and has good effects of cooling blood and activating blood, relieving heat toxin in the fetus, and promoting spawning; the rabbit liver has good effects of improving eyesight and tonifying fatigue after being used as a medicine. However, the medicinal value of meat rabbits is limited because of the strong wild nature, small size, slow growth rate and relatively high cholesterol. Therefore, the development and utilization of new molecular breeding markers to improve the medicinal value of the meat rabbits have important significance for the cultivation of high-quality meat rabbits.
With the development of molecular quantitative genetics and biotechnology, nucleic acid hybridization and high-throughput sequencing technologies have been widely applied to animal breeding, and Single Nucleotide Polymorphism (SNP) molecular genetic markers have the advantages of wide distribution, genetic stability and suitability for high-throughput automated analysis, and become important means for animal breeding improvement. Therefore, the molecular marker related to the cholesterol metabolism of the meat rabbits provides a feasible way for improving the medicinal value of the meat rabbits.
Disclosure of Invention
The invention aims to provide an SNP molecular marker related to cholesterol metabolism of meat rabbits and application thereof.
In order to achieve the purpose, the invention adopts the following technical scheme:
SNP molecular marker related to cholesterol metabolism of meat rabbits, and the molecular marker is derived from meat rabbitsCASTThe 3 rd intron region (NC-013679.1) of the gene was cloned and its nucleotide sequence was as follows:
5’-CTTATGTTGATGTGAGCGTTTGCGCTTGGCTCTCTTGTTAAGGTGTTGTCCCTCATCGAAACCCATGTTTTCTGTTTCCAAGAAAAAGGCAGCCAGCCTCGGGAGCGGTCAGTCTTCCAGAACCAGCACTGGTGGAGCAGTCCCAGCGGCCAAGGTCAGTCACTTTCCAAGCAGGGAGAGACCCCTGCTBTTCCTCCTGGCACACAGGCCTGGGTGT-3’（SEQ ID No.1）；
b at 190bp in the above nucleotide sequence is G or T, resulting in polymorphism.
The B at 190bp in the nucleotide sequence is related to the content of cholesterol in the plasma of the meat rabbit.
The B at 190bp in the nucleotide sequence is also related to the content of low-density lipoprotein in the plasma of the meat rabbit.
A primer pair for identifying the SNP molecular marker, wherein the nucleotide sequence of the primer pair is as follows:
upstream primer (SEQ ID No. 2): 5'-CTTATGTTGATGTGAGCGTTTGC-3' the flow of the air in the air conditioner,
downstream primer (SEQ ID No. 3): 5'-CGCAGTGACACCCAGGCC-3' are provided.
The SNP molecular marker related to the content of cholesterol or low-density lipoprotein in blood plasma is applied to breeding of high-quality meat rabbits.
The SNP molecular marker related to the content of cholesterol or low-density lipoprotein in plasma is applied to detecting the content of cholesterol or low-density lipoprotein in the plasma of meat rabbits.
The primer pair is applied to breeding of high-quality meat rabbits.
The primer pair is applied to detecting the content of cholesterol or low-density lipoprotein in the plasma of the meat rabbit.
The invention has the advantages that: the SNP marker locus provided by the invention is related to the content of cholesterol in the plasma of the meat rabbit and also related to the content of low-density lipoprotein in the plasma of the meat rabbit, and a molecular marker and a primer developed based on the SNP marker locus can be used for detecting SNP, so that a low-cholesterol meat rabbit strain can be screened by identifying the SNP marker, and the SNP marker has positive significance for improving meat rabbit varieties and improving medicinal use.
Drawings
FIG. 1 shows cloned meat rabbits of the present inventionCASTThe sequence fragment of the 3 rd intron region of the gene, i.e. the nucleotide sequence of the molecular marker screened by the invention, has a sequence length of 217bp, and B at the 190 base position of the sequence has a G/T allele mutation, which is marked by x in the figure.
FIG. 2 is a distribution plot of different genotypes across a rabbit population.
Detailed Description
The present invention will be described in further detail with reference to examples, but the embodiments of the present invention are not limited thereto.
Example 1
1. Source of experimental animal
The experimental rabbit breeds used in this example were as follows:
fujian yellow rabbit, provided by natural ecological agricultural test field of Lianjiang Yuhuashan in Fujian province;
the Min southwest black rabbit is provided by Tongxian rabbit industry development limited company in Longyan city;
new Zealand white rabbits and Fujian white rabbits are provided by the Fujian white rabbit breeding field in Wudong Yuan village in Wu Ping county.
2. Determination of cholesterol content and low-density lipoprotein content of meat rabbit
Collecting 1-2mL of ear vein blood of fasting meat rabbit and procoagulant vacuum blood collection tube (before blood collection, test animal fasts for 12h, and simultaneously lets it drink water freely, and takes ear vein blood collection under waking state), and flicking tube bottom to make blood fully anticoagulated and avoid hemolysis.
Collecting 5mL of the jugular vein of an empty belly rabbit, collecting the blood in a procoagulant vacuum blood collection tube, standing for 30min, centrifuging for 15min at 3000r/min, sucking supernatant, storing at 2-8 ℃ for later use, and measuring the CHOL and LDL contents by using a BECKMAN COULTER AU2700 large-scale full-automatic biochemical analyzer and a Ningbo Kangmei biochemical kit (reference documents: Chendongkin, Chenyanfeng, Xiping, and the like.
3. Meat rabbit genomic DNA extraction
The method adopts a whole blood genome DNA extraction kit (Beijing holotype gold biotechnology, Inc.) to extract the genome DNA of the meat rabbit, and comprises the following specific steps:
collecting 1mL of rabbit ear venous blood in an ethylene diamine tetraacetic acid dipotassium (EDTA-K2) anticoagulation vacuum tube, fully and uniformly mixing the rabbit ear venous blood with the anticoagulation agent, then taking 250 mu L of anticoagulation agent to a new 2mL eppendorf tube, adding 20 mu L of proteinase K and 500 mu L of BB3 lysate into the anticoagulation agent, fully and uniformly mixing, and incubating for 10min at room temperature; adding all the solution into a centrifugal column, centrifuging at 12000g for 1min, and discarding the effluent; adding 500 μ L CB3 equilibrium solution into the centrifugal column, centrifuging at 12000g for 30s, and discarding the effluent; adding 500 μ L WB3 rinse solution into the centrifugal column, centrifuging at 12000g for 30s, discarding the effluent, repeating once, centrifuging at 12000g for 2min, and completely removing the residual WB3 rinse solution; adding 50-200 μ L preheated EB eluent (preheated at 60-70 deg.C before use) into centrifugal column, standing at room temperature for 1min, centrifuging at 12000g for 1min, and eluting DNA; the concentration and quality of the extracted DNA are detected, and the qualified DNA sample is diluted to 100-300 ng/mu L and stored at-20 ℃ for later use.
The protease K, BB3 lysate, CB3 equilibrium solution, WB3 rinsing solution and EB eluent are all provided by matching with a DNA extraction kit.
4. SNP site screening and genotyping
Meat rabbits were processed using Primer premier5.0 softwareCASTA primer was designed for the 3 rd intron sequence (NC-013679.1) of the gene and was synthesized by Shanghai Invitrogen Biotech Ltd. The sequences of the primer pairs are as follows:
upstream primer (SEQ ID No. 2): 5'-CTTATGTTGATGTGAGCGTTTGC-3', respectively;
downstream primer (SEQ ID No. 3): 5'-CGCAGTGACACCCAGGCC-3' are provided.
PCR amplification is carried out using the extracted DNA as a template and based on the designed primers. PCR reaction 10. mu.L: 5U/. mu.L Taq enzyme 0.1. mu.L, 1. mu.L upstream primer 1. mu.L 1. mu.M downstream primer 1. mu.L template DNA 2. mu.L 10 XBuffer 1. mu.L 2.5mM dNTP 0.8. mu.L 100mM Mg2+ 1 μ L, supplement ddH2O to a final volume of 10. mu.L. The running program of the PCR was as follows: 15min at 95 ℃; 30s at 94 ℃, 90s at 60 ℃ and 30s at 72 ℃ for 35 cycles; 10min at 72 ℃. The PCR product was detected by 2% agarose gel electrophoresis, and the amplified target fragment was 217bp in size, and the electrophoretogram is shown in FIG. 1. The remaining amplification products were mixed together and sent to the GJN Biotechnology Co., Ltd, Shanghai for sequencing by cloning, and the SNPs were searched by using ChromasPro software, and the G/T mutation was detected at 190bp, as shown in FIG. 1.
By using the primers, the individual DNA of 165 Fujian white rabbits, 84 Fujian southwest black rabbits, 116 New Zealand white rabbits and 80 Fujian yellow rabbits is used as a template to detect the genotype of the SNP site.
Firstly, three rounds of PCR amplification are carried out on genome DNA of meat rabbits in Fujian province.First round PCR reaction 10. mu.L: 10 XBuffer 1 uL, 50nM upstream primer 1 uL, 50nM downstream primer 1 uL, 2.5mM dNTP 0.8 uL, hot start Taq enzyme 0.5U, template DNA 2 uL, 100mM Mg2+ 1 μ L, supplement ddH2O to a final volume of 10. mu.L; the running program of the PCR was as follows: 15min at 95 ℃; 30s at 94 ℃, 10min at 60 ℃ and 30s at 72 ℃ for 4 cycles; 30s at 94 ℃, 1min at 60 ℃ and 30s at 72 ℃ for 20 cycles. Second round PCR reaction 10. mu.L: 3. mu.L of the product obtained in the first round of PCR, 1. mu.L of 10 XBuffer, 0.8. mu.L of 2.5mM dNTP, 0.5U of hot start Taq enzyme, and 100mM Mg2+ 1 μ L, supplement ddH2O to a final volume of 10. mu.L; the running program of the PCR was as follows: 15min at 95 ℃; 30s at 94 ℃, 10min at 60 ℃ and 30s at 72 ℃ for 4 cycles; 30s at 94 ℃, 1min at 65 ℃ and 30s at 72 ℃ for 40 cycles. The third PCR reaction system was 20. mu.L: 10. mu.L, 10 XBuffer 2. mu.L, 2. mu.M Barcode 3.6. mu.L, 2.5mM dNTP 0.8. mu.L, hot start Taq enzyme 0.5U, 100mM Mg2+ 1 μ L, supplement ddH2O to a final volume of 20. mu.L; the running program of the PCR was as follows: 15min at 95 ℃; 30s at 94 ℃, 4min at 60 ℃ and 30s at 72 ℃ for 4 cycles; 30s at 94 ℃, 1min at 65 ℃ and 30s at 72 ℃ for 40 cycles. After the third round of amplification is finished, the PCR product is subjected to agarose gel electrophoresis detection, and 5 mu L of the PCR product is loaded.
Then, PCR products were recovered. Transferring 5 mu L of qualified PCR amplification products obtained by amplifying 373 Fujian local meat rabbit DNA samples to the same U-shaped groove respectively for mixing, then transferring 200 mu L of the mixture to a new round-bottom centrifuge tube, carrying out vortex oscillation for 30S, fixing the centrifuge tube on a shaking table, and carrying out oscillation at normal temperature and 250rpm overnight. And then carrying out agarose gel electrophoresis on the mixed sample library, recovering a gel block containing the target fragment after electrophoresis, and temporarily storing the recovered product at 4 ℃ for later use.
Then SNP typing was performed. And (3) entrusting the product stored at the temperature of 4 ℃ to Shanghai wing Synbiotic Limited company to perform second-generation sequencing and typing (NGS) through an ILLumina X-10 sequencing platform, and performing image identification and genotyping and statistics on the sequencing result by utilizing Illumina RTA and Illumina bcl2fastq software. The genotype of the SNP sites related to the cholesterol and low density lipoprotein content in the plasma of 373 meat rabbits is shown in FIG. 2. The distribution frequency of different genotypes and alleles in 373 Fujian meat rabbits is shown in Table 1, with a GG genotype frequency of 0.14, a TT genotype frequency of 0.40, a GT genotype frequency of 0.46, a G allele frequency of 0.63, and a T allele frequency of 0.37.
TABLE 1 genotype and allele frequencies of different meat rabbit populations
5. Correlation analysis of SNP molecular marker and cholesterol and low-density lipoprotein content in meat rabbit plasma
And performing variance analysis by using a GLM model of SAS 9.4 software, and performing correlation analysis on each genotype of the polymorphic sites, the area of muscle fibers of the dorsal muscles and the contents of cholesterol and low-density lipoprotein in blood. The analytical model is:
Yijkl=μ+ Gi+Bj+Pk+Sl+eijkl
wherein, YijklFor trait observations, μ is the mean, GiFor genotype effects, BjFor the species effect, PkFor batch effect, Si is a sex effect vector, eijklIs a random error. The results of the analysis were verified using a Bonferrroni multiple comparison.
The results are shown in Table 2, the content of low-density lipoprotein in the plasma of the individual with GG genotype is 40.32 percent lower than that of the individual with TT genotype in the meat rabbit population, and the significant level is shown in the value (P<0.01), 32.73% lower than that of the GT genotype individual, at a significant level (P<0.05); the content of cholesterol in the plasma of the individual with GG genotype is 18.40 percent lower than that of the individual with TT genotype, and the obvious level is shown (P<0.05) 11.92% lower than in the GT genotype individuals, but without significant difference. Therefore, in the meat rabbit population, GG genotype individuals are subcultured and bred, so that the contents of low-density lipoprotein and cholesterol in the plasma of the meat rabbits can be gradually reduced, and the aim of improving the medicinal value of the meat rabbits is fulfilled. And when the 190bp G/T mutation site from the 5' end of the nucleotide sequence shown by the meat rabbit individual SEQ ID No.1 is GG type, the meat rabbit can be judgedBelongs to individuals with low cholesterol content and low density lipoprotein content in blood plasma.
TABLE 2 correlation analysis of genotype of SNP site with content of cholesterol and low-density lipoprotein in plasma of meat rabbit
Note: the difference in the upper lower case letters indicates significant difference (P<0.05), the difference between capital letters indicates that the difference is extremely significant (P<0.01）。
SEQUENCE LISTING
<110> animal husbandry and veterinary institute of agricultural academy of sciences of Fujian province
<120> SNP molecular marker related to cholesterol metabolism of meat rabbits and application thereof
<130>
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 217
<212> DNA
<213> Artificial sequence
<400> 1
cttatgttga tgtgagcgtt tgcgcttggc tctcttgtta aggtgttgtc cctcatcgaa 60
acccatgttt tctgtttcca agaaaaaggc agccagcctc gggagcggtc agtcttccag 120
aaccagcact ggtggagcag tcccagcggc caaggtcagt cactttccaa gcagggagag 180
acccctgctb ttcctcctgg cacacaggcc tgggtgt 217
<210> 2
<211> 23
<212> DNA
<213> Artificial sequence
<400> 2
cttatgttga tgtgagcgtt tgc 23
<210> 3
<211> 18
<212> DNA
<213> Artificial sequence
<400> 3
cgcagtgaca cccaggcc 18
Claims (9)
1. An SNP molecular marker related to cholesterol metabolism of meat rabbits, which is characterized in that: the nucleotide sequence of the SNP molecular marker is as follows:
5’-CTTATGTTGATGTGAGCGTTTGCGCTTGGCTCTCTTGTTAAGGTGTTGTCCCTCATCGAAACCCATGTTTTCTGTTTCCAAGAAAAAGGCAGCCAGCCTCGGGAGCGGTCAGTCTTCCAGAACCAGCACTGGTGGAGCAGTCCCAGCGGCCAAGGTCAGTCACTTTCCAAGCAGGGAGAGACCCCTGCTBTTCCTCCTGGCACACAGGCCTGGGTGT-3’。
2. the SNP molecular marker according to claim 1, wherein: b at 190bp in the SNP molecular marker nucleotide sequence is G or T, resulting in polymorphism.
3. The SNP molecular marker according to claim 2, wherein: b at 190bp in the SNP molecular marker nucleotide sequence is related to the content of cholesterol in the plasma of the meat rabbit.
4. The SNP molecular marker according to claim 3, wherein: the B at the 190bp position in the SNP molecular marker nucleotide sequence is also related to the content of low-density lipoprotein in the plasma of the meat rabbit.
5. A primer pair for amplifying the SNP molecular marker of claim 1, comprising: the nucleotide sequence of the primer pair is as follows:
an upstream primer: 5'-CTTATGTTGATGTGAGCGTTTGC-3' the flow of the air in the air conditioner,
a downstream primer: 5'-CGCAGTGACACCCAGGCC-3' are provided.
6. The use of the SNP molecular markers according to claim 1 for breeding high-quality meat rabbits.
7. The use of the SNP molecular markers according to claim 1 for detecting the content of cholesterol or low density lipoprotein in plasma of meat rabbits.
8. The use of the primer pair of claim 5 in breeding high-quality meat rabbits.
9. The use of the primer pair of claim 5 for detecting the content of cholesterol or low-density lipoprotein in the plasma of meat rabbits.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111103066.XA CN113832237B (en) | 2021-09-18 | 2021-09-18 | SNP molecular marker related to cholesterol metabolism of meat rabbits and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111103066.XA CN113832237B (en) | 2021-09-18 | 2021-09-18 | SNP molecular marker related to cholesterol metabolism of meat rabbits and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113832237A true CN113832237A (en) | 2021-12-24 |
| CN113832237B CN113832237B (en) | 2023-07-28 |
Family
ID=78960037
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111103066.XA Active CN113832237B (en) | 2021-09-18 | 2021-09-18 | SNP molecular marker related to cholesterol metabolism of meat rabbits and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113832237B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003060151A2 (en) * | 2002-01-09 | 2003-07-24 | Iowa State University Research Foundation, Inc. | Novel calpastatin (cast) alleles |
| WO2007012119A1 (en) * | 2005-07-26 | 2007-02-01 | Commonwealth Scientific And Industrial Research Organisation | A method for assessing traits selected from longissimus dorsi peak force, intramuscular fat, retail beef yield and net feed intake in bovine animals |
| CN101942438A (en) * | 2010-09-10 | 2011-01-12 | 中国农业科学院北京畜牧兽医研究所 | Sheep back fat trait-related SNP and application thereof |
| CN112322753A (en) * | 2020-11-27 | 2021-02-05 | 广西扬翔股份有限公司 | SNP molecular marker related to pork intramuscular fat and application thereof |
-
2021
- 2021-09-18 CN CN202111103066.XA patent/CN113832237B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003060151A2 (en) * | 2002-01-09 | 2003-07-24 | Iowa State University Research Foundation, Inc. | Novel calpastatin (cast) alleles |
| WO2007012119A1 (en) * | 2005-07-26 | 2007-02-01 | Commonwealth Scientific And Industrial Research Organisation | A method for assessing traits selected from longissimus dorsi peak force, intramuscular fat, retail beef yield and net feed intake in bovine animals |
| CN101942438A (en) * | 2010-09-10 | 2011-01-12 | 中国农业科学院北京畜牧兽医研究所 | Sheep back fat trait-related SNP and application thereof |
| CN112322753A (en) * | 2020-11-27 | 2021-02-05 | 广西扬翔股份有限公司 | SNP molecular marker related to pork intramuscular fat and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 蒋秋斐;顾亚玲;: "牛肉质性状候选基因研究进展", 生物技术, no. 05 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113832237B (en) | 2023-07-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107385059B (en) | Molecular marker related to growth traits of broiler chickens and application thereof | |
| CN106755527B (en) | SNP marker, primer and evaluation method for evaluating growth performance of grass carp | |
| CN111286543B (en) | Haplotype marker related to egg shell quality traits in KRT14 gene and application thereof | |
| CN109825598B (en) | SNP (Single nucleotide polymorphism) marker remarkably related to Australian white sheep hair thickness, molecular marker and application | |
| CN113502335B (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN111286541B (en) | Haplotype marker related to lambing number in 3' UTR of goat ZBP1 gene and application thereof | |
| CN111440878B (en) | Haplotype marker related to quality traits of egg shells in CDH17 genes and application | |
| CN110923333B (en) | Haplotype marker related to lambing number in first intron of goat ZBP1 gene and application thereof | |
| CN111996264A (en) | Application of pig SNP molecular marker in pig breeding character screening and pig breeding | |
| CN107641657B (en) | Method for detecting cattle ACVR1 gene insertion/deletion and application thereof | |
| CN113913530A (en) | Molecular marker related to sheep body height and application thereof | |
| CN112195253A (en) | SNP (Single nucleotide polymorphism) locus for increasing content of fatty acid C14:0 in chicken and method for breeding high-quality chicken strain by using SNP locus | |
| CN113549700A (en) | Molecular marker related to porcine intramuscular fat character and application of molecular marker in pig breeding | |
| CN117327804A (en) | Method for improving meat quality of meat and mutton by utilizing SNP molecular marker locus of MYBPC1 gene | |
| CN113718041B (en) | SNP molecular marker related to muscle drip loss character of meat rabbits and application thereof | |
| CN113832237B (en) | SNP molecular marker related to cholesterol metabolism of meat rabbits and application thereof | |
| Nguyen et al. | Effects of myogenic factor 5 (MYF5) gene on carcass and meat quality of Mong Cai pigs | |
| CN113718040B (en) | SNP molecular marker related to immunity traits of meat rabbits and application thereof | |
| CN108841971B (en) | Method for detecting cattle SH3PXD2B gene insertion/deletion marker | |
| CN111454958A (en) | SNPs (single nucleotide polymorphisms) of fast-growing high-quality grass carp and application thereof | |
| CN110468215B (en) | Haplotype marker related to porcine semen quality character in tenth intron of porcine SPATA6 gene and application | |
| CN110373480B (en) | Molecular marker related to quality traits of boar semen in eighth intron of pig SPATA6 gene and application | |
| CN112126688B (en) | Multiple allele molecular marker related to reproductive traits in pig OLR1 gene and application | |
| CN110468214B (en) | Molecular marker related to quality traits of porcine semen in tenth intron of porcine SPATA6 gene and application thereof | |
| CN117587146A (en) | Application of milk goat STARD5 gene single nucleotide polymorphism marker in early selection of milk production traits |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |