CN113817856A - Primer pair, kit and method for detecting archaea Candidatus Methanoparum - Google Patents

Abstract

The invention relates to the field of microbial detection, in particular to a primer pair, a kit and a method for detecting an archaea Candidatus Methanoparum. The primer pair sequence is one or more of the sequences shown in SEQ ID NO.1 and SEQ ID NO.2, the sequences shown in SEQ ID NO.1 and SEQ ID NO.3, and the sequences shown in SEQ ID NO.1 and SEQ ID NO. 4. The method can realize rapid qualitative and quantitative detection of the Candidatus Methanoparum by proper primer design, has high sensitivity, strong accuracy and good repeatability, and the linear range of quantitative detection can reach 10¹‑10⁸copying/mu.L, and quickly identifying the archaea Candidatus Methanoloprum in the oil reservoir environment.

Description

Primer pair, kit and method for detecting archaea Candidatus Methanoparum

Technical Field

The invention relates to the field of microbial detection, in particular to a primer pair, a kit and a method for detecting an archaea Candidatus Methanoparum.

Background

The anaerobic microorganisms in the oil reservoir are an important driving force for crude oil biogasification (a process of producing methane by crude oil biodegradation), and play an important role in carbon biogeochemistry of an underground biosphere. In past researches, crude oil biogasification needs the mutual operation of bacteria and archaea to be completed, and the specific process is that hydrocarbon degradation bacteria metabolize petroleum hydrocarbon to generate simple substrates such as acetic acid, formic acid, hydrogen and the like, and then methane is generated through the metabolism of methanogenic archaea. Thermodynamic computational analysis shows that the crude oil biogasification is an exothermic reaction, and theoretically, the process can be spontaneously completed in a microorganism.

In 2016, scientists Laso-Perez et al discovered that Candida syntrophorchaeus butanovorans archaea contains the alkyl coenzyme M reductase gene (ACR) for the initiation of butane, which initiates butane activation to produce butane coenzyme M and then cooperates with sulfate reducing bacteria to perform butane anaerobic degradation (Laso-Perez et al, 2016). In 2019, Chen et al scientists found ACR in Candidatus Argoarchaeum ethanovorans archaea to have the function of activating ethane, and also required sulfate reducing bacteria to participate in ethane degradation (Chen et al, 2019). In 2019, Laso-Perez et al found that Cadidatus Methanolia genome contains complete ACR genes activated by starting hydrocarbon substances, long-chain alkyl oxidation pathway genes and classical methanogenic pathway metabolic genes (MCR) in the genome of Cadidatus Methanolia in a petroleum hydrocarbon-rich environment, which indicates that Cadidatus Methanolia may have the ability to degrade alkyl hydrocarbons to produce methane, and that Cadidatus Methanolia alone aggregates on oil droplets and does not aggregate with other bacteria or archaea, while the absence of cytochrome c and other genes in the genome which perform interoperable electron transfer indicates that Cadidatus Methanolia may have the ability to complete the degradation of alkyl hydrocarbons to produce methane alone in vivo (Laso-Perez et al, 2019). But currently there is no physiological and cultural evidence to demonstrate this ability.

The problem group of the applicant of the application discovers archaea of Candidatus Methanolideum in the oil reservoir environment, the genome of the archaea contains complete genes for degrading long-chain alkane methanogenesis pathways, the generation of intermediate metabolites for degrading alkyl hydrocarbon and methane is detected in the process of adding alkyl hydrocarbon culture, and the genes such as ACR and MCR of the alkyl hydrocarbon degradation methanogenesis pathways in Candidatus Methanolideum combined with transcriptome data are all highly expressed, so that the archaea of Candidatus Methanolideum has the capability of independently degrading alkyl hydrocarbon and producing methane, and is one kind of the archaea of the alkyl hydrocarbon degradation.

The existing methods for identifying the alkyl hydrocarbon degrading archaea adopt high-throughput sequencing and genome sequencing methods, but the methods cannot be generally applied due to high cost and long time consumption of the technologies. In view of the above, there is a need for a method for detecting Candidatus Methanolinium rapidly, simply, quantitatively, specifically and sensitively.

Disclosure of Invention

The invention aims to provide a primer pair and a kit for detecting the archaea Candidatus Methanoparum, which are used for quickly, simply, quantitatively, specifically and sensitively detecting the archaea Candidatus Methanoparum.

In order to achieve the above object, the first technical solution adopted by the present invention is to provide a primer pair for detecting the archaea candida methanoparum:

the upstream primer ZZ 1F: 5'-GGGAATTCGACTAAGCCATGCAA-3' (shown in SEQ ID NO. 1);

the downstream primer ZZ 1R: 5'-CCCGGCCCTTTCTATTAGGTG-3' (shown in SEQ ID NO. 2);

the downstream primer ZZ 2R: 5'-CCCGGCCCTTTCTATTAAGTG-3' (shown in SEQ ID NO. 3);

the downstream primer ZZ 3R: 5'-CCCGGCCCTTTCTATTGGATG-3' (shown in SEQ ID NO. 4).

2. The second technical scheme provided by the invention is as follows: a kit for detecting the archaea Candidatus Methanoloprum comprises the primer pair, a fluorescent reagent and a positive control. Preferably, the kit comprises a primer pair, a SYBR Green Mix fluorescent reagent and a positive control.

The positive control is preferably one or more, and when the positive control is multiple, the positive control comprises the CT value of the amplification cycle number of the archaea Candidatus Methanoparum under different concentration gradients, so that the quantitative detection of the content of the archaea Candidatus Methanoparum can be realized.

3. The third technical scheme provided by the invention is as follows: the primer pair or the kit is used for detecting the archaea Candidatus Methanoloprum.

4. The fourth technical scheme provided by the invention is as follows: a method for detecting the archaea Candidatus Methanoloprum comprises the step of carrying out PCR amplification by using the primer pair.

Preferably, the method comprises the steps of: extracting genome DNA of a sample to be detected as a template, adding the primer pair of claim 1, carrying out PCR reaction, and judging whether the sample to be detected contains the archaea Candidatus Methanolideum or not after the reaction is finished.

More preferably, the method comprises the steps of: extracting genome DNA of a sample to be detected as a template, adding the detection primer as claimed in claim 1, mixing with a fluorescent reagent to form an amplification reaction system, carrying out fluorescent quantitative PCR reaction, and after the reaction is finished, if the amplification curve has a typical fluorescent amplification curve and the CT value is less than 33, indicating that the sample to be detected contains the archaea Candidatus Methanolide and quantifying the archaea Candidatus Methanolide; if the amplification curve has no typical fluorescence amplification curve, the sample to be tested does not contain the archaea Candidatus Methanoloprum.

Furthermore, each 10 mu L of amplification system comprises 5 mu L of fluorescent reagent, 5-20 mu mol/L of the primer pair, 0.01-0.2 mu g of the template and the balance of ultrapure water, and the amplification reaction and the detection are carried out on a fluorescent quantitative PCR instrument.

Further, the amplification reaction procedure is as follows: pre-denaturation at 94-98 deg.C for 5-10 min; 15-30s at 94-98 ℃; annealing at 55-65 deg.C for 15-30 s; extending for 15-30s at 72 ℃ for 30-40 cycles; finally, extending for 5-10min, and storing at 4-12 ℃.

5. The fifth technical proposal of the invention is as follows: a method for quantifying the ancient fungus Candidatus Methanoparum is characterized by comprising the following steps:

(1) connecting partial sequences shown as SEQ ID NO.5-8 to plasmids to construct recombinant positive plasmids, performing gradient dilution on the positive plasmids to serve as DNA templates with different initial plasmid concentration gradients, and performing fluorescence quantitative PCR reaction according to the method; obtaining the CT value of the amplification cycle number corresponding to each initial plasmid concentration template after the reaction is finished, and obtaining a qPCR standard curve of the archaea Candidatus Methanoparum according to the linear relation between the CT value and the common logarithm of the initial plasmid concentration;

(2) extracting genome DNA of a sample to be detected as a DNA template, obtaining a CT value according to the method, substituting the CT value into a qPCR standard curve of the archaea Candidatus Methanoparum, and calculating to obtain the abundance of the archaea Candidatus Methanoparum in the sample to be detected.

Compared with the prior art, the invention has the advantages that: the method can realize rapid qualitative and quantitative detection of the Candidatus Methanoparum by proper primer design, has high sensitivity, strong accuracy and good repeatability, and the linear range of quantitative detection can reach 10¹-10⁸The copy/. mu.L can rapidly identify the existence of the alkyl hydrocarbon degrading archaea Candidatus methanolopanarum in the oil reservoir environment.

Drawings

FIG. 1 is a diagram showing the results of agarose gel electrophoresis;

FIG. 2 is a result chart of the dissolution curves, in which FIGS. a, b and c are the result charts of the dissolution curves of primer pair ZZ1F/1R, ZZ1F/2R and ZZ1F/3R, respectively;

FIG. 3 is a graph of amplification kinetics;

FIG. 4 is a qPCR standard curve;

FIG. 5 is a diagram showing the results of fluorescent quantitative detection, wherein, a, b, c are the results of fluorescent quantitative detection of primer pairs ZZ1F/1R, ZZ1F/2R, ZZ1F/3R amplification, respectively, 1 and 2 in a, b, c are the results of fluorescent quantitative detection of samples, 3 are the results of fluorescent quantitative detection of bacteria Escherichia coli DH5 alpha, 4 are the results of fluorescent quantitative detection of archaea Metanoculleus receptaculi ZC-2, and 5 are negative controls.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention. Unless otherwise indicated, the technical means used in the examples are conventional means well known to those skilled in the art.

Example 1

1. Designing a primer pair: this example provides detection primer pairs for 4 species of Candidatus Methanoloprum, and the following is a specific primer design method:

the applicant ' S topic group obtains samples in oil and soil environments of a Shengli oil field (37 ℃ 54 ' N, 118 ℃ 33 ' E) and obtains genomes of 4 clusters of Candidatus Methanolide by metagenome sequencing and splicing, extracts a 16S rRNA gene sequence (the 16S rRNA sequence of the Candidatus Methanolide cluster1-4 is SEQ ID: 5-8 in sequence) and combines a sequence with similarity of more than 95 percent with the 16S rRNA sequence of the Candidatus Methanolide in a GenBank database, carries out specific primer design by using Oligo7, predicts the length of an amplified fragment to be 427bp, and designs upstream primers and downstream nucleotide sequences obtained aiming at the 4 clusters of the Candidatus Methanolide as follows:

upstream primer ZZ1F (5 '- > 3') for Candidatus Methanolideum cluster1 and 4, SEQ ID NO: 1: GGGAATTCGACTAAGCCATGCAA, respectively; the downstream primer ZZ1R (5 '- > 3'), namely SEQ ID NO: 2: CCCGGCCCTTTCTATTAGGTG, respectively;

the upstream primer ZZ1F (5 '- > 3') for Candidatus Methanolideum cluster2, SEQ ID NO: 1: GGGAATTCGACTAAGCCATGCAA, respectively; the downstream primer ZZ2R (5 '- > 3'), namely SEQ ID NO: 3: CCCGGCCCTTTCTATTAAGTG, respectively;

the upstream primer ZZ1F (5 '- > 3') for Candidatus Methanolideum cluster3, SEQ ID NO: 1: GGGAATTCGACTAAGCCATGCAA, respectively; the downstream primer ZZ3R (5 '- > 3'), namely SEQ ID NO: 4: CCCGGCCCTTTCTATTGGATG are provided.

2. Extraction of sample genomic DNA:

taking 0.5mL of sample liquid in a 2mL screw cap tube, centrifuging at 13000rpm at room temperature for 5min, and removing a supernatant; adding 0.5g of glass beads, adding 750 mu L of PB and 250 mu L of TNS, quickly shaking to break the wall for 6.5m/s and 45s twice, centrifuging at 13000rpm for 10min at room temperature, and transferring the supernatant to a 2mL EP tube (800-; adding a mixed solution of phenol, chloroform and isoamyl alcohol with the same volume (phenol: chloroform: isoamyl alcohol is 25:24:1), shaking and uniformly mixing, centrifuging at 13000rpm at 4 ℃ for 5min, and transferring the supernatant into a new 2mL EP tube (700-; adding a mixed solution of chloroform and isoamyl alcohol with the same volume (chloroform: isoamyl alcohol is 24:1), shaking and uniformly mixing at 13000rpm, centrifuging at 4 ℃ for 5min, and transferring the supernatant to a new 1.5mL EP tube (550-; adding 0.7 times volume of cold isoamyl alcohol, standing at-80 deg.C for 30min, 13000rpm, and centrifuging at 4 deg.C for 1 h; discarding the supernatant, adding 500 μ L cold 70% ethanol, mixing, centrifuging at 13000rpm at 4 deg.C for 5 min; the supernatant was discarded, dried in a fume hood for 10min, and 50-100. mu.L of double distilled water was added thereto, and the mixture was stored at-20 ℃ to obtain a DNA template solution.

The PB comprises the following components: 12.13g disodium hydrogenphosphate-dodecahydrate, 0.333g sodium dihydrogenphosphate-dihydrate, 300mL double distilled water (pH8.0) was added; TNS (Trimethylol aminomethane) 8.88g, trihydroxymethylaminomethane base 5.3g, sodium chloride 1.169g, sodium dodecylsulfonate 20g, and double distilled water 200ml (pH 8.0).

PCR amplification:

1) the PCR amplification system (10-50. mu.L) was: specifically comprises 0.01-1 mu g of DNA template solution, 0.1-1.5 mu mol/L of forward and reverse primers, 1-5 mu L of 10 multiplied by amplification buffer solution, 0.1-0.4mmol/L of dNTP and 1.5-3mol/L of MgCl₂0.5-2.5U Taq polymerase, 0.1-1.5. mu. mol/L BSA (bovine serum albumin), and finally, 10-50. mu.L ultrapure water.

The primers were selected and added, and it was not known whether or not the archaea was contained in the sample or several types of the archaea were contained before the detection, and three pairs of primers were added to amplify the archaea.

2) The PCR reaction conditions are as follows: pre-denaturation at 94-98 deg.C for 5-10 min; 15-30s at 94-98 ℃; annealing at 55-65 deg.C for 15-30 s; extending for 15-30s at 72 ℃ for 30-40 cycles; finally, extending for 5-10min, and storing at 4-12 ℃.

3) Electrophoretic analysis of PCR amplification products: preparing agarose gel, weighing 0.5-1.0g of agarose by using an analytical balance, adding 50mL of 1% TAE buffer solution, heating by a microwave oven for 1-2min to completely dissolve the agarose, preparing 1% -2% agarose gel, finally adding 0.5-2 mu L of nucleic acid dye, uniformly mixing, pouring into a rubber groove of a rubber plate, inserting a comb, cooling at room temperature, standing for 30-60min for solidification, and removing the comb to prepare the agarose gel.

The prepared gel was placed in 1% TAE buffer and covered with gel. Adding 3-6 mu L of 100bp marker, mixing 3-6 mu L of amplification sample to be detected with 6 Xloading buffer or 10 Xloading buffer in a ratio of 5:1-1:1, adding the mixture into a gel hole, performing 120-180V constant voltage electrophoresis for 15-30min, observing and recording amplification bands of each sample to be detected through a gel imaging system, and analyzing and identifying results. After the electrophoresis observation result, the sample with positive PCR result is sent to Beijing Optimalaceae Biotechnology Co., Ltd for sequencing, and the sequencing result is compared with the 16S rRNA of Candidatus Methanoloprum.

The experimental results are as follows: in the experiment, a Candidatus Methanolide primer specificity detection is carried out on an oil sediment mixed flora sample, the electrophoresis observation result is shown in figure 1, a single target strip can be obtained by PCR detection of an oil sample or an oil sediment sample, in figure 1, 2, 3 and 4 are amplification results of 4 clusters 1, 2, 3 and 4 of Candidatus Methanolide respectively, the size of the amplification results is 427bp, and M is 100bp marker; the sequencing result shows that the primer is a partial sequence of the 16S rRNA of Candidatus Methanoparum, and the three pairs of primers can specifically amplify the 16S rRNA gene sequences of 4 clusters of Candidatus Methanoparum.

4. Establishment of fluorescent quantitative PCR

(1) Preparation of positive plasmid standard product

Three pairs of primers ZZ1F/1R, ZZ1F/2R and ZZ1F/3R are used for amplifying PCR amplification products, TaKaRa Cloning Kit is used for being connected with a PMD19-T vector (Takara bioengineering Daiz limited company), the products are transformed into escherichia coli competent cells (Takara bioengineering Daiz limited company), the cells are coated on a plate containing 100 mu g/mL of ampicillin for screening, and then colony PCR is carried out to identify the recombinant positive clone. Selecting recombinant positive clones, carrying out amplification culture, extracting recombinant plasmids Puc-ZZ1, Puc-ZZ2 and Puc-ZZ3 by using a plasmid extraction kit (Tiangen Biotechnology limited company), sending the three obtained recombinant positive plasmids to Beijing Optimalaceae biotechnology limited company for sequencing, confirming that PCR amplification product fragments are inserted into recombinant plasmids, wherein the recombinant plasmids are standard plasmids, measuring the concentration of the standard plasmids by using an ultramicro spectrophotometer, and calculating the copy number of the standard plasmids according to a formula I.

The formula I is as follows: copy number of standard plasmid (copy number/mL) ═ 6.02X 10²³(copy number/mol). times.Standard plasmid concentration (ng/. mu.L)/(number of Standard plasmid bases. times.660) (g/mol)

(2) Establishment of standard curve of fluorescent quantitative PCR reaction

3 prepared standard plasmids Puc-ZZ1, Puc-ZZ2 and Puc-ZZ3 are diluted to 10¹-10⁸copy/mL concentration gradient for fluorescent quantitative PCR detection: the amplification system comprises 5 mu L of SYBR Green Mix, 0.25 mu L of each upstream primer and downstream primer with the concentration of 10 mu mol/L, 1 mu L of standard plasmid solution, and 10 mu L of double distilled water. Carrying out amplification reaction and detection on a fluorescent quantitative PCR instrument, wherein the amplification reaction program is as follows: the first step is as follows: pre-denaturation at 95 ℃ for 180 s; the second step is that: denaturation at 95 ℃ for 15s, annealing at 55-65 ℃ for 15s, and extension at 72 ℃ for 10s, collecting fluorescence signal intensity, and repeating 45 cycles;

in each of the sub-figures 1 in FIG. 3 is 10⁸Copy/. mu.L, 2 is 10⁷Copy/. mu.L, 3 is 10⁶Copy/. mu.L, 4 is 10⁵Copy/. mu.L, 5 is 10⁴Copy/. mu.L, 6 is 10³Copy/. mu.L, 7 is 10²Copy/. mu.L, 8 is 10¹Copy/. mu.L, analysis of the lysis curve and kinetic curve after the fluorescent quantitative PCR is finished, the results of the lysis curve for the three pairs of primers are shown in FIG. 2, and the kinetic curve is shown in FIG. 3. After the reaction, the CT value of the amplification cycle number corresponding to each initial plasmid concentration template was obtained, and a qPCR standard curve of Candidatus Methanolideum was prepared, and the results are shown in FIG. 4.

Fluorescence quantitative PCR standard curve equation:

primer pair ZZ 1F/1R: y-3.532 x +38.291, E91.9%, R²＝0.999；

Primer pair ZZ 1F/2R: y-3.494 x +37.804, E93.3%, R²＝0.999；

Primer pair ZZ 1F/3R: y-3.598 x +40.734, E-89.6%, R²＝0.999；

x is the common logarithm of the starting plasmid concentration and y is the CT value.

As can be seen from the standard curve equation, the common logarithm of the concentration gradient of different plasmids is linearly related to the CT value, and R²All are 0.999, the correlation is good, and the amplification efficiency of the primer is up to 89.6-93.3%.

Therefore, the dissolution curves of the concentration gradients of the plasmids show the same peak value, which indicates that the specificity of the primers is strong; as can be seen from FIG. 3, the exponential growth curves are parallel, which indicates that the amplification efficiency of the fluorescence quantitative PCR is similar, the difference of the CT values between different dilutions is uniform, and the CT value and the common logarithm of the plasmid concentration present a good linear relationship.

According to results, the method for carrying out fluorescence quantitative PCR by using the three pairs of primers has the advantages of high sensitivity, strong accuracy, good repeatability and quantitative detection linear range of 10¹-10⁸Copies/. mu.L.

(3) Detection of fluorescent quantitative PCR

The enriched cultures containing Candidatus Methanolideum, archaea receptaculi ZC-2 and Escherichia coli DH5 alpha were respectively detected by a fluorescent quantitative PCR method, wherein 1 and 2 are enriched cultures containing 4 clusters of Candidatus Methanolideum, 3 and 4 are controls of archaea receptaculi ZC-2 and Escherichia coli DH5 alpha, respectively, and 5 is a blank control, and the results are shown in FIG. 5, the enriched cultures containing 4 clusters of Candidatus Methanolideum respectively have fluorescence signals, and CT values are both less than 30, indicating that amplification has occurred. And the control group archaea Methanovuleus receptaculi ZC-2 and the bacteria Escherichia coli DH5 alpha are not amplified and do not emit fluorescence, and the CT value is more than 35, which shows that the three pairs of primers have good specificity to 4 clusters in Candidatus Methanolideum.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Sequence listing

<110> institute of biogas science of Ministry of agriculture

<120> primer pair, kit and method for detecting archaea Candidatus Methanoparum

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gggaattcga ctaagccatg caa 23

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cccggccctt tctattaggt g 21

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cccggccctt tctattaagt g 21

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cccggccctt tctattggat g 21

<210> 5

<211> 1476

<212> DNA

<213> Candidatus Methanoliparum cluster1

<400> 5

ttgatcctgc cggaggccac tgctatggga attcgactaa gccatgcaag ttgagggcac 60

ctttttagga gacccagcga actgctcagt aacacgtgga taatctgccc acaggatggg 120

gataatcctg ggaaactggg aataataccc aatagatcat tggcactgga atgtcctttg 180

atccaaatgc ttttcttacg cctgtggatg agtctgcgtc cgattaggct gttgttgggg 240

taacggccca acaaacctat gatcggtacg ggtcgtgaga gcgatcgccc ggagattgga 300

tctgagatat gatcctaggc cctacggggt gcagcaggcg cgaaaacttt acaatgtggg 360

aaaccatgat aagggaattc ccagtgttcc tacatagtag gaactgttta ggtgcgtaaa 420

aaacacctaa tagaaagggc cgggtaagac cggtgccagc cgccgcggta ataccggtgg 480

ctcgagtggt ggccgctatt attgggtcta aagggtccgt agccggcttg ataagttacc 540

tggaaaatcc ggtggcctaa ccattgggcg gccaggtgat actatcaggc ttgggactag 600

gagagaccag aggtactcat gaggtagggg tgaaatcctg taatcttatg aggaccacca 660

gtggcgaagg cgtctggtta gaataggtcc gacggtgatg gacgaaggct gggggcgcaa 720

accggattag atacccgggt agtcccagca gtaaacgatg ccagctatgt gttgctgaaa 780

ccatgggttt cagcagtgcc gaagggaagc cgtgaagctg gccacctggg aagtacggcc 840

gcaaggctga aacttaaagg aattggcggg ggagtaccac aaccggtgga gcctgcggtt 900

taattggata caacgccggg aatcttaccg gaggggacag cagtatgaag gtcaggctaa 960

agaccttacc agatcagctg agaggaggtg catggccgtc gccagttcgt accgtgaggc 1020

atcctgttta gtcaggcaac gatcgagacc cgtagtctta tttgccagca tgccctctgg 1080

ggtgtatggg gacaataaga cgaccgtcag cgctaagctg aaggaaggag cgggctacgg 1140

taggtcagca tgccctgaat cctccgggat acacgcgggc tacaatggtc aggacaaaag 1200

gtatcgacct cgaaagagtg agataatccc ataaacctga tctcagtccg gatcgaaggc 1260

tgcaactcgc cttcgtgaag atggaatcgg tagtaatcgt gactcaaaat gtcacggtga 1320

atatgtccct gctccttgca cacaccgccc gtcaaatcac ccgagtggga tctggaggag 1380

gtctttctcg cagaggaaga tcgaatctgg attctgcaag gggggttaag tcgtaacaag 1440

gtagccgtag gggaacctgc ggctggatca cctcct 1476

<210> 6

<211> 1475

<212> DNA

<213> candidatus methanoliparum cluster2

<400> 6

ttgatcctgc cggaggccac tgctatggga attcgactaa gccatgcaag ttgagggcac 60

ctttttagga gacccagcga actgctcagc aacacgtgga taatctgccc acaggacggg 120

gataatcccg ggaaactggg aataataccc gataggtcat tggtactgga atgtcctttg 180

gcctaaatgc tttttctacg cctgtggatg agtctgcgtc cgattaggct gttgttgggg 240

taacggccca acaaacctac gatcggtacg ggtcgtgaga gcgattgccc ggagatggga 300

tctgagatat gatcctaggc cctacggggt gcagcaggcg cgaaaacttt acaatgtggg 360

aaaccatgat aagggaattc ccagtgttcc tacatagtag gaactgttta ggtgtgtaaa 420

aagcacttaa tagaaagggc cgggtaagac cggtgccagc cgccgcggta ataccggtgg 480

ctcgagtggt ggccgctatt attgggtcta aagggtccgt agccggcttg ataagttacc 540

tgggaaatcc ggtggcctaa ccatcgggcg gccgggtaat actatcgagc ttgggactag 600

gagagaccag aggtactcat gaggtaggag tgaaatcctg taatcttatg aggaccacca 660

gtggcgaagg cgtctggtta gaataggtcc gacggtgagg gacgaaggct gggggcgcaa 720

accggattag atacccgggt agtcccagca gtaaacgatg ccagctatgt gttgctgaaa 780

ccatgggttc cagcagtgcc gaagggaagc cgtgaagctg gccacctggg aagtacggtc 840

gcaaggctga aacttaaagg aattggcggg ggagtaccac aaccggtgga gcctgcggtt 900

taattggata caacgccggg aatcttaccg gaggggacag cagtatgaag gccaggctaa 960

agaccttgcc agatcagctg agaggaggtg catggccgtc gccagttcgt accgtgaggc 1020

atcctgttta gtcaggcaac gatcgagacc cgcagtctta tttgccagca tgccccctgg 1080

ggtgtatggg tacaataaga cgactgccag cgctaagctg gaggaaggag cgggctacgg 1140

taggtcagca tgccccgaat cctccgggat acacgcgggc tacaatggtc aggacaaaag 1200

gtaccgacct cgaaagagtg aggtaatcca caaacctgat ctcagtccgg atcgaaggct 1260

gcaactcgcc ttcgtgaaga tggaatcggt agtaatcgtg actcaaaatg tcacggtgaa 1320

tatgtccctg ctccttgcac acaccgcccg tcaaaccacc cgagtggggc ctggaggagg 1380

ttcctctctt tgagagggat caaatctggg ttctgcaagg ggggttaagt cgtaacaagg 1440

tagccgtagg ggaacctgcg gctggatcac ctcct 1475

<210> 7

<211> 1476

<212> DNA

<213> candidatus methanoliparum cluster3

<400> 7

ttgatcctgc cggaggtcac tgctatggga attcgactaa gccatgcaag ttgagggcac 60

cttttatagg agacccagca aactgctcag taacgcgcgg ataatctgcc cacaggacgg 120

ggataacccc gggaaactgg gagtaatacc cgataggtca ttgatactgg aatgttcttt 180

gatctaaatg ctctttttac gcctgtggat gagtctgcgt ccgattaggc tgttgttggg 240

gtaatggccc aacaaaccta cgatcggtac gggtcgtgag agcgattgcc cggagatggg 300

atctgagata tgatcctagg ccctacgggg tgcagcaggc gcgaaaactt tacaatgtgg 360

gaaaccatga taagggaatt cccagtgttc ctacaaagta ggaactgttt gggtgtgtaa 420

aaagcatcca atagaaaggg ccgggtaaga ccggtgccag ccgccgcggt aataccggtg 480

gctcgagtgg tgaccgcttt tattgggtct aaagcgtccg tagccggcct aaaaagttac 540

ctgggaaatc cggtggccta accatcgggc ggccgggtga tactattagg cttgggacta 600

ggagagacca gaggtactca tgaggtagga gtgaaatcct gtaatcttat gaggaccacc 660

agtggcgaag gcgtctggtt agaataggtt cgacggtgag ggacgaaggc tgggggcgca 720

aaccggatta gatacccggg tagtcccagc agtaaacgat gccagctatg tgttgctgga 780

accatgggtt ctagcagtgc cgaagggaag ccgtgaagct ggccacctgg gaagtacggc 840

cgcaaggctg aaacttaaag gaattggcgg gggagtacca caaccggtgg agcctgcggt 900

ttaattggat aaaacgccgg aaatcttacc ggaggggaca gcagtatgaa ggtcaggcta 960

aagaccttac cagatcagct gagaggaggt gcatggccgt cgccagttcg taccgtgagg 1020

catcctgttt agtcaggcaa cgagcgagac ccgcggtctt atttgccagc ataccccctg 1080

gggtgtatgg gtacaataag acgaccgcca gcgctaagct ggaggaagga gcgggctacg 1140

gtaggtcagc atgccccgaa tcctccggga tacacgcggg ctacaatggt caggacaaaa 1200

ggtaccaatc tcgaaagagt gaggtaatcc acaaacctga tcccagtccg gatcgaaggc 1260

tgcaactcgc cttcgtgaag atggaatcgg tagtaatcgt gcctcaaaat gtcacggtga 1320

atatgtccct gctccttgca cacaccgccc gtcaaatcac ccgagtgagg tctggaggag 1380

gttttcctct atgagaaaaa tcaaatctgg gtcttgcaag gggggttaag tcgtaacaag 1440

gtagccgtag gggaacctgc ggctggatca cctcct 1476

<210> 8

<211> 1475

<212> DNA

<213> candidatus methanoliparum cluster3

<400> 8

ttgatcctgc cggaggtcac tgctatggga attcgactaa gccatgcaag ttgagggcac 60

ctttttagga gacccagcga actgctcagc aacacgtgga taatctgccc acaggacggg 120

gataatcccg ggaaactggg aataataccc gatagatcat tggtactgga atgtcctttg 180

atctaaatgc tctttctacg cctgtggatg agtctgcgtc cgattaggct gttgttgggg 240

taacggccca acaaacctac gatcggtacg ggtcgtgaga gcgattgccc ggagatggga 300

tctgagatat gatcctaggc cctacggggt gcagcaggcg cgaaaacttt acaatgtggg 360

aaaccatgat aagggaattc ccagtgttcc tacatagtag gaactgttta ggtgtgtaaa 420

aagcacctaa tagaaagggc cgggtaagac cggtgccagc cgccgcggta ataccggtgg 480

ctcgagtggt ggccgctatt attgggtcta aagggtccgt agccggcttg ataagttacc 540

tgggaaatcc ggtggcctaa ccatcgggcg gccaggtaat actatcaggc tcgggactag 600

gagagaccag aggtactcat gaggtaggag tgaaatcctg taatcttatg aggaccacca 660

gtggtgaaga cgtctggtta gaataggtcc gacggtgagg gacgaaggct gggggcgcaa 720

accggattag atacccgggt agtcccagca gtaaacgatg ccagctatgt gttgctggaa 780

ccatgggttc cagcagtgcc gaagggaagc cgtgaagctg gccacctggg aagtacggtc 840

gcaaggctga aacttaaagg aattggcggg ggagtaccac aaccggtgga gcctgcggtt 900

taattggata caacgccggg aatcttaccg gaggggacag cagtatgaag gccaggctaa 960

agaccttgcc agatcagctg agaggaggtg catggccgtc gccagttcgt accgtgaggc 1020

atcctgttta gtcaggcaac gatcgagacc cgcagtctta tttgccagca tgccctttgg 1080

ggtgtatggg tacaataaga cgaccgccag cgctaagctg gaggaaggag cgggctacgg 1140

taggtcagca tgccccgaat cctccgggat acacgcgggc tacaatggtc aggacaaaag 1200

gtaccgacct cgaaagagtg aggtaatcca caaacctgat ctcagtccgg atcgaaggct 1260

gcaactcgcc ttcgtgaaga tggaatcggt agtaatcgtg actcaaaatg tcacggtgaa 1320

tatgtccctg ctccttgcac acaccgcccg tcaaaccacc cgagtggggt ctggaggagg 1380

tcgctctcta tgagagcgat caaatctggg ttctgcaagg ggggttaagt cgtaacaagg 1440

tagccgtagg ggaacctgcg gctggatcac ctcct 1475

Claims (10)

1. A primer pair for detecting the archaea Candidatus Methanoloprum is characterized in that: the primer pair sequence is one or more of the sequences shown in SEQ ID NO.1 and SEQ ID NO.2, the sequences shown in SEQ ID NO.1 and SEQ ID NO.3, and the sequences shown in SEQ ID NO.1 and SEQ ID NO. 4.

2. A kit for detecting the archaea Candidatus Methanoloprum is characterized in that: a kit comprising the primer set according to claim 1.

3. The kit of claim 2, wherein: also included are fluorescent reagents and positive controls.

4. The kit of claim 3, wherein: the positive control included the CT number of amplification cycles measured by the archaea Candidatus Methanolopram at different concentration gradients.

5. Use of the primer set according to claim 1 or the kit according to any one of claims 2 to 4 for detecting the archaea candida methanoparum.

6. A method for detecting the archaea Candidatus Methanoloprum is characterized in that: comprising the step of performing PCR amplification using the primer set of claim 1.

7. The method of claim 6, wherein: the method comprises the following steps: extracting genome DNA of a sample to be detected as a template, adding the primer pair of claim 1, carrying out PCR reaction, and judging whether the sample to be detected contains the archaea Candidatus Methanolideum or not after the reaction is finished.

8. The method of claim 7, wherein: the method comprises the following steps: extracting genome DNA of a sample to be detected as a template, adding the detection primer as claimed in claim 1, mixing with a fluorescent reagent to form an amplification reaction system, carrying out fluorescent quantitative PCR reaction, and after the reaction is finished, if the amplification curve has a typical fluorescent amplification curve and the CT value is less than 33, indicating that the sample to be detected contains the archaea Candidatus Methanolide and quantifying the archaea Candidatus Methanolide; if the amplification curve has no typical fluorescence amplification curve, the sample to be tested does not contain the archaea Candidatus Methanoloprum.

9. The method according to claim 7 or 8, characterized in that: wherein, each 10 μ L of amplification system comprises 5 μ L of fluorescent reagent, 5-20 μmol/L of the primer pair in claim 1, 0.01-0.2 μ g of the template and the balance of ultrapure water.

10. The method according to claim 7 or 8, characterized in that: the amplification reaction procedure was: pre-denaturation at 94-98 deg.C for 5-10 min; 15-30s at 94-98 ℃; annealing at 55-65 deg.C for 15-30 s; extending for 15-30s at 72 ℃ for 30-40 cycles; finally, extending for 5-10min, and storing at 4-12 ℃.

Images