CN113817856B - Primer pair, kit and method for detecting archaea Candidatus Methanoliparum - Google Patents
Primer pair, kit and method for detecting archaea Candidatus Methanoliparum Download PDFInfo
- Publication number
- CN113817856B CN113817856B CN202111273466.5A CN202111273466A CN113817856B CN 113817856 B CN113817856 B CN 113817856B CN 202111273466 A CN202111273466 A CN 202111273466A CN 113817856 B CN113817856 B CN 113817856B
- Authority
- CN
- China
- Prior art keywords
- candidatus
- methanoliparum
- archaea
- seq
- amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the field of microorganism detection, in particular to a primer pair, a kit and a method for detecting archaea Candidatus Methanoliparum. The primer pair has one or more of the sequences shown in SEQ ID NO.1 and SEQ ID NO.2, the sequences shown in SEQ ID NO.1 and SEQ ID NO.3 and the sequences shown in SEQ ID NO.1 and SEQ ID NO. 4. The invention can realize rapid qualitative and quantitative detection of archaea Candidatus Methanoliparum by proper primer design, and the method has high sensitivity, strong accuracy and good repeatability, and the linear range of quantitative detection can reach 10 1 ‑10 8 Copy/. Mu.L, and rapidly identify archaea Candidatus Methanoliparum in the reservoir environment.
Description
Technical Field
The invention relates to the field of microorganism detection, in particular to a primer pair, a kit and a method for detecting archaea Candidatus Methanoliparum.
Background
Anaerobic microorganisms in oil reservoirs are important driving forces for crude oil bio-gasification (crude oil biodegradation methanogenesis), and play an important role in carbon bio-geochemistry of underground biospheres. In the past, the research shows that the biological gasification of crude oil can be completed by the cooperation of bacteria and archaea, and the specific process is that hydrocarbon degradation bacteria metabolize petroleum hydrocarbon to generate simple substrates, such as acetic acid, formic acid, hydrogen and the like, and methane is generated by metabolism of methanogenic archaea. Thermodynamic calculations have shown that crude oil bio-gasification is an exothermic reaction, and theoretically the process can be performed spontaneously in a microorganism.
In 2016, scientists Laso-Perez et al found that Candidatus Syntrophoarchaeum butanovorans archaea contained an alkyl coenzyme M reductase gene (alkyl coenzyme M reductase, ACR) that initiated butane, and could initiate butane activation to produce butane coenzyme M, which was then used in concert with sulfate reducing bacteria to carry out butane anaerobic degradation (Laso-Perez et al 2016). In 2019, chen et al scientists found that ACR has the function of activating ethane in Candidatus Argoarchaeum ethanivorans archaea, and also required participation of sulfate-reducing bacteria for ethane degradation (Chen et al, 2019). In 2019 Laso-purez et al found that the genome of Cadidatus Methanoliparia contained intact degraded long-chain alkane methanogenic metabolic pathways comprising ACR genes activated by starting hydrocarbons, genes of long-chain alkyl oxidation pathways and classical methanogenic pathway metabolic genes (methyl coenzyme M reductase, MCR) indicated that Cadidatus Methanoliparia might have the ability to degrade alkyl hydrocarbon methanogenesis, microscopic observation Cadidatus Methanoliparia accumulated on oil droplets alone and not with other bacteria or archaea, while the lack of cytochrome c genes in the genome that perform the cross-nutrient electron transfer, all indicated that Cadidatus Methanoliparia might have the ability to complete degradation of alkyl hydrocarbon methanogenesis alone in vivo (Laso-purez et al 2019). But there is currently no physiological or cultural evidence of this capability.
The applicant subject group of the application finds archaea of Candidatus Methanoliparum in an oil reservoir environment, the genome of the archaea contains complete genes for degrading long-chain alkane methanogenesis ways, and generates intermediate metabolites of alkyl hydrocarbon degradation and methane in the process of adding alkyl hydrocarbon for culture, and the high expression of genes such as ACR, MCR and the like combined with the alkyl hydrocarbon degradation methanogenesis ways in transcriptome data Candidatus Methanoliparum shows that the archaea of Candidatus Methanoliparum has the capability of independently degrading alkyl hydrocarbon methanogenesis, and is an alkyl hydrocarbon degradation archaea.
The current methods for identifying alkyl hydrocarbon degrading archaea employ high throughput sequencing and genome sequencing methods, but these techniques are not universally applicable due to high cost and long time consumption. In view of this, there is a need for a method that enables rapid, simple, quantitative, specific and sensitive detection of archaea Candidatus Methanoliparum.
Disclosure of Invention
The invention aims to provide a primer pair and a kit for detecting archaea Candidatus Methanoliparum, which are used for rapidly, simply, quantitatively, specifically and sensitively detecting archaea Candidatus Methanoliparum.
In order to achieve the above object, the first technical solution adopted in the present invention is to provide a primer pair for detecting archaea Candidatus Methanoliparum:
the upstream primer ZZ1F:5'-GGGAATTCGACTAAGCCATGCAA-3' (SEQ ID NO. 1);
downstream primer ZZ1R:5'-CCCGGCCCTTTCTATTAGGTG-3' (SEQ ID NO. 2);
downstream primer ZZ2R:5'-CCCGGCCCTTTCTATTAAGTG-3' (SEQ ID NO. 3);
downstream primer ZZ3R:5'-CCCGGCCCTTTCTATTGGATG-3' (SEQ ID NO. 4).
2. The second technical scheme provided by the invention is as follows: a kit for detecting archaea Candidatus Methanoliparum, comprising the primer pair, a fluorescent reagent and a positive control. Preferably, the kit comprises a primer pair, a SYBR Green Mix fluorescent reagent and a positive control.
The positive control is preferably one or more, and when the positive control is multiple, the positive control comprises the CT value of the amplification cycle number measured by the archaea Candidatus Methanoliparum under different concentration gradients, so that the quantitative detection of the archaea Candidatus Methanoliparum content can be realized.
3. The third technical scheme provided by the invention is as follows: the use of the primer pair or the kit for detecting archaea Candidatus Methanoliparum.
4. The fourth technical scheme provided by the invention is as follows: a method for detecting archaea Candidatus Methanoliparum, comprising the step of performing PCR amplification using the primer pair described above.
Preferably, the method comprises the steps of: extracting genome DNA of a sample to be detected as a template, adding the primer pair of claim 1, performing PCR reaction, and judging whether archaea Candidatus Methanoliparum is contained in the sample to be detected after the reaction is finished.
More preferably, the method comprises the steps of: extracting genome DNA of a sample to be detected as a template, adding the detection primer in the claim 1, mixing with a fluorescent reagent to form an amplification reaction system, performing fluorescent quantitative PCR reaction, and if the amplification curve has a typical fluorescent amplification curve and the CT value is less than 33 after the reaction is finished, indicating that the sample to be detected contains archaea Candidatus Methanoliparum and quantifying archaea Candidatus Methanoliparum; if the amplification curve does not have a typical fluorescence amplification curve, the sample to be detected does not contain archaea Candidatus Methanoliparum.
Further, each 10. Mu.L of the amplification system comprises 5. Mu.L of the fluorescent reagent, 5-20. Mu. Mol/L of the primer pair, 0.01-0.2. Mu.g of the template and the balance of ultrapure water, and the amplification reaction is carried out and detected on a fluorescent quantitative PCR instrument.
Further, the amplification reaction procedure was: pre-denaturation at 94-98 ℃ for 5-10min; 94-98 deg.c for 15-30s; annealing at 55-65 ℃ for 15-30s; extending at 72 ℃ for 15-30s for 30-40 cycles; finally, the mixture is extended for 5 to 10 minutes and stored at the temperature of 4 to 12 ℃.
5. The fifth technical scheme of the invention: a method of quantifying archaea Candidatus Methanoliparum, comprising the steps of:
(1) Connecting partial sequences shown as SEQ ID NO.5-8 to plasmids to construct recombinant positive plasmids, carrying out gradient dilution on the positive plasmids to serve as DNA templates of different initial plasmid concentration gradients, and carrying out fluorescence quantitative PCR reaction according to the method; obtaining amplification cycle number CT values corresponding to the initial plasmid concentration templates after the reaction is finished, and obtaining qPCR standard curves of archaea Candidatus Methanoliparum according to the linear relation between the CT values and the common logarithm of the initial plasmid concentration;
(2) Extracting genome DNA of a sample to be detected as a DNA template, obtaining a CT value according to the method, substituting the CT value into a qPCR standard curve of archaea Candidatus Methanoliparum, and calculating to obtain the abundance of archaea Candidatus Methanoliparum in the sample to be detected.
Compared with the prior art, the invention has the advantages that: the invention can realize rapid qualitative and quantitative detection of archaea Candidatus Methanoliparum by proper primer design, and the method has high sensitivity, strong accuracy and good repeatability, and the linear range of quantitative detection can reach 10 1 -10 8 Copy/. Mu.L, the presence of the alkyl hydrocarbon degrading archaea Candidatus Methanoliparum genus in the reservoir environment can be rapidly identified.
Drawings
FIG. 1 is a graph showing agarose gel electrophoresis results;
FIG. 2 is a graph showing the results of the dissolution curves, wherein graphs a, b and c are respectively the results of the dissolution curves of the primer pairs ZZ1F/1R, ZZ1F/2R and ZZ 1F/3R;
FIG. 3 is a graph of amplification kinetics;
FIG. 4 is a qPCR standard curve;
FIG. 5 is a graph showing the results of the fluorescent quantitative detection, wherein graphs a, b and c are the results of the fluorescent quantitative detection of the primer pairs ZZ1F/1R, ZZ1F/2R and ZZ1F/3R, respectively, 1 and 2 in graphs a, b and c are the results of the fluorescent quantitative detection of the samples, 3 is bacteria Escherichia coli DH5 alpha, 4 is archaea Methanoculleus receptaculi ZC-2, and 5 is the result of the fluorescent quantitative detection of the negative control.
Detailed Description
The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention. The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise indicated.
Example 1
1. Design of primer pairs: the present example provides detection primer pairs for the Candidatus Methanoliparum genus of 4 species, the following are specific primer design methods:
the applicant ' S subject group obtained samples in the oil soil environment of the victory oil field (37 DEG 54' N,118 DEG 33' E), and the genome of Candidatus Methanoliparum genus 4 clusters was obtained by metagenome sequencing and splicing, and 16S rRNA gene sequences (the 16S rRNA sequences of Candidatus Methanoliparum cluster1-4 are SEQ ID:5-8 in sequence) were extracted, and in combination with sequences having a similarity of more than 95% with the 16S rRNA sequence of Candidatus Methanoliparum in the GenBank database, specific primer design was performed using Oligo7, the length of the amplified fragment was expected to be 427bp, and the upstream primer and downstream nucleotide sequences obtained for Candidatus Methanoliparum genus 4 clusters were designed as follows:
the upstream primer ZZ1F (5 '- > 3') against Candidatus Methanoliparum cluster1 and 4, SEQ ID NO 1: GGGAATTCGACTAAGCCATGCAA; the downstream primer ZZ1R (5 '- > 3'), SEQ ID NO:2: CCCGGCCCTTTCTATTAGGTG;
upstream primer ZZ1F (5 '- > 3') against Candidatus Methanoliparum cluster2, SEQ ID NO 1: GGGAATTCGACTAAGCCATGCAA; the downstream primer ZZ2R (5 '- > 3'), SEQ ID NO:3: CCCGGCCCTTTCTATTAAGTG;
upstream primer ZZ1F (5 '- > 3') against Candidatus Methanoliparum cluster, SEQ ID NO 1: GGGAATTCGACTAAGCCATGCAA; the downstream primer ZZ3R (5 '- > 3'), SEQ ID NO:4: CCCGGCCCTTTCTATTGGATG.
2. Extraction of sample genomic DNA:
taking 0.5mL of sample liquid in a 2mL screw cap tube, centrifuging at 13000rpm at room temperature for 5min, and removing the supernatant; 0.5g glass beads was added, 750. Mu.L PB and 250. Mu.L TNS were added, wall breaking was performed twice with rapid shaking for 6.5m/s 45s, and after centrifugation at 13000rpm for 10min at room temperature, the supernatant was transferred to a 2mL EP tube (800-900. Mu.L); adding an equal volume of mixed solution of phenol, chloroform and isoamyl alcohol (phenol: chloroform: isoamyl alcohol=25:24:1), shaking and mixing uniformly, centrifuging at 13000rpm and 4 ℃ for 5min, and transferring the supernatant into a new 2mL EP tube (700-800 mu L); adding an equal volume of chloroform and isoamyl alcohol mixed solution (chloroform: isoamyl alcohol=24:1), shaking and uniformly mixing at 13000rpm, centrifuging at 4 ℃ for 5min, and transferring the supernatant to a new 1.5mL EP tube (550-650 mu L); adding 0.7 times of cold isoamyl alcohol, standing at-80 ℃ for 30min at 13000rpm, and centrifuging at 4 ℃ for 1h; discarding the supernatant, adding 500 μl of cold 70% ethanol, mixing, centrifuging at 13000rpm at 4deg.C for 5min; the supernatant was discarded, dried in a fume hood for 10min, 50-100. Mu.L of double distilled water was added, and the mixture was stored at-20℃to obtain a DNA template solution.
The PB comprises the following components: 12.13g of disodium hydrogen phosphate dihydrate, 0.333g of sodium dihydrogen phosphate dihydrate, 300mL of double distilled water (pH 8.0) was added; TNS 8.88g of tris hydrochloride, 5.3g of tris base, 1.169g of sodium chloride, 20g of sodium dodecyl sulfate, 200ml of double distilled water (pH 8.0).
PCR amplification:
1) The PCR amplification system (10-50. Mu.L) was: specifically comprises 0.01-1 mug of the DNA template solution, 0.1-1.5 mu mol/L of forward and reverse primers, 1-5 mu L of 10 Xamplification buffer solution, 0.1-0.4mmol/L of dNTP and 1.5-3mol/L of MgCl 2 0.5-2.5U Taq polymerase, 0.1-1.5. Mu. Mol/L BSA (bovine serum albumin), and finally ultrapure water was added to 10-50. Mu.L.
In regard to the selective addition of the primers, it is not known whether the archaea is contained in the sample or not before the detection, and it is not known that several archaea are contained, and three pairs of primers are added to amplify each.
2) The PCR reaction conditions were: pre-denaturation at 94-98 ℃ for 5-10min; 94-98 deg.c for 15-30s; annealing at 55-65 ℃ for 15-30s; extending at 72 ℃ for 15-30s for 30-40 cycles; finally, the mixture is extended for 5 to 10 minutes and stored at the temperature of 4 to 12 ℃.
3) Electrophoretic analysis of PCR amplified products: preparing agarose gel, weighing 0.5-1.0g agarose by an analytical balance, adding 50mL of 1% TAE buffer solution, heating for 1-2min by a microwave oven to completely dissolve the agarose, preparing 1% -2% agarose gel, finally adding 0.5-2 mu L of nucleic acid dye, mixing uniformly, pouring into a glue groove of a glue making plate, inserting a comb, cooling at room temperature, standing for 30-60min for solidification, and pulling out the comb to prepare the agarose gel.
The prepared gel was placed in a TAE buffer with 1% added and covered with gel. Adding 3-6 mu L of 100bp marker, mixing 3-6 mu L of amplified sample to be detected with 6×loading buffer or 10×loading buffer at a ratio of 5:1-1:1, adding into gel hole, performing 120-180V constant voltage electrophoresis for 15-30min, observing and recording amplified bands of each sample to be detected by gel imaging system, and analyzing and identifying result. After the electrophoresis observation result, the sample positive to the PCR result is sent to Beijing engine biotechnology Co., ltd for sequencing, and the sequencing result is compared with the 16S rRNA of Candidatus Methanoliparum.
Experimental results: according to the experiment, candidatus Methanoliparum primer specificity detection is carried out on an oil and sand mixed flora sample, an electrophoresis observation result is shown in a figure 1, a single target strip can be obtained by detecting the oil sample or the oil and sand sample through PCR, in the figure 1,2,3 and 4 are respectively the amplification results of Candidatus Methanoliparum clusters 1,2,3 and 4, the sizes are all 427bp, and M is 100bp marker; sequencing results showed a partial sequence of Candidatus Methanoliparum 16S rRNA, demonstrating that the three pairs of primers of the invention are capable of specifically amplifying the Candidatus Methanoliparum cluster of 16S rRNA gene sequences.
4. Fluorescent quantitative PCR establishment
(1) Preparation of positive plasmid standard
Three pairs of primers ZZ1F/1R, ZZ1F/2R and ZZ1F/3R were amplified, ligated with PMD19-T vector (Takara Bio-engineering Co., ltd.) using TaKaRa Cloning Kit, and transformed into E.coli competent cells (Takara Bio-engineering Co., ltd.), plated onto plates containing 100. Mu.g/mL of ampicillin for screening, and then colony PCR was performed to identify recombinant positive clones. The recombinant positive clones are selected and amplified, then plasmid extraction reagent boxes (Tiangen Biotechnology Co., ltd.) are used to extract recombinant plasmids Puc-ZZ1, puc-ZZ2 and Puc-ZZ3, the obtained three recombinant positive plasmids are sent to Beijing qing Ke biological technology Co., ltd for sequencing, and the PCR amplified product fragment is confirmed to be inserted into the recombinant plasmid, the recombinant plasmid is the standard plasmid, the concentration of the standard plasmid is measured by using an ultra-micro spectrophotometer, and the copy number of the standard plasmid is calculated according to a formula I.
Equation one: standard plasmid copy number (copy number/mL) =6.02x10 23 (copy number/mol). Times.the concentration of the target plasmid (ng/. Mu.L)/(number of bases of target plasmid. Times.660) (g/mol)
(2) Establishment of fluorescent quantitative PCR reaction standard curve
The 3 prepared marker plasmids Puc-ZZ1, puc-ZZ2 and Puc-ZZ3 were diluted to 10 1 -10 8 Fluorescence quantitative PCR detection is carried out by concentration gradient of copy/mL: the amplification system included SYBR Green Mix 5. Mu.L, 0.25. Mu.L each of the upstream and downstream primers at a concentration of 10. Mu. Mol/L, 1. Mu.L of the standard plasmid solution, and double distilled water was added to 10. Mu.L. Performing amplification reaction and detection on a fluorescent quantitative PCR instrument, wherein the amplification reaction comprises the following steps: the first step: pre-denaturation at 95 ℃ for 180s; and a second step of: denaturation at 95℃for 15s, annealing at 55-65℃for 15s, extension at 72℃for 10s, collecting fluorescence signal intensity, repeating 45 cycles;
1 in each sub-graph of FIG. 3 is 10 8 Copy/. Mu.L, 2 is 10 7 Copy/. Mu.L, 3 is 10 6 Copy/. Mu.L, 4 is 10 5 Copy/. Mu.L, 5 is 10 4 Copy/. Mu.L, 6 is 10 3 Copy/. Mu.L, 7 is 10 2 Copy/. Mu.L, 8 is 10 1 After the fluorescent quantitative PCR is finished, the dissolution curve and the kinetic curve are analyzed, the results of the dissolution curves of the three pairs of primers are shown in FIG. 2, and the kinetic curve is shown in FIG. 3. After the reaction, the corresponding amplification cycle number CT value of each initial plasmid concentration template was obtained, and a qPCR standard curve of Candidatus Methanoliparum was prepared, and the result is shown in FIG. 4.
Fluorescent quantitative PCR standard curve equation:
primer pair ZZ1F/1R: y= -3.532x+38.291, e=91.9%, R 2 ＝0.999；
Primer pair ZZ1F/2R: y= -3.494x+37.804, e=93.3%, R 2 ＝0.999；
Primer pair ZZ1F/3R: y= -3.598x+40.734, e=89.6%, R 2 ＝0.999；
x is the usual logarithm of the starting plasmid concentration and y is the CT number.
As can be seen from the standard curve equation, the common logarithm of the concentration gradient of different plasmid is linearly related to the CT value, and R 2 All 0.999, correlationGood primer amplification efficiency up to 89.6% -93.3%.
From this, the dissolution curves of the concentration gradients of the plasmids show the same peak, indicating strong primer specificity; as can be seen from FIG. 3, the exponential growth phase curves are parallel, indicating that the amplification efficiency of fluorescent quantitative PCR is similar, the CT values between different dilutions differ uniformly, and the CT values show a good linear relationship with the common logarithm of plasmid concentration.
According to the result, the method for carrying out fluorescence quantitative PCR by using the three pairs of primers has high sensitivity, strong accuracy and good repeatability, and the linear range of quantitative detection can reach 10 1 -10 8 Copy/. Mu.L.
(3) Detection of fluorescent quantitative PCR
Enrichment cultures containing Candidatus Methanoliparum genus, archaea Methanoculleus receptaculi ZC-2 and bacteria Escherichia coli DH5α were detected by fluorescent quantitative PCR method, wherein 1 and 2 are enrichment cultures containing 4 clusters of Candidatus Methanoliparum genus, 3 and 4 are control of archaea Methanoculleus receptaculi ZC-2 and bacteria Escherichia coli DH5α, and 5 are blank control, respectively, and the result is shown in FIG. 5, enrichment cultures containing 4 clusters of Candidatus Methanoliparum genus have fluorescent signals, respectively, with CT value less than 30, indicating that amplification occurred. The control archaea Methanoculleus receptaculi ZC-2 and bacteria Escherichia coli DH. Alpha. Are not amplified and do not have fluorescence, and the CT value is more than 35, so that the three pairs of primers have good specificity for 4 cluster in Candidatus Methanoliparum.
The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, and alternatives falling within the spirit and principles of the invention.
Sequence listing
<110> institute of biogas science in Ministry of agriculture
<120> a primer set, kit and method for detecting archaea Candidatus Methanoliparum
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
gggaattcga ctaagccatg caa 23
<210> 2
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
cccggccctt tctattaggt g 21
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
cccggccctt tctattaagt g 21
<210> 4
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
cccggccctt tctattggat g 21
<210> 5
<211> 1476
<212> DNA
<213> Candidatus Methanoliparum cluster1
<400> 5
ttgatcctgc cggaggccac tgctatggga attcgactaa gccatgcaag ttgagggcac 60
ctttttagga gacccagcga actgctcagt aacacgtgga taatctgccc acaggatggg 120
gataatcctg ggaaactggg aataataccc aatagatcat tggcactgga atgtcctttg 180
atccaaatgc ttttcttacg cctgtggatg agtctgcgtc cgattaggct gttgttgggg 240
taacggccca acaaacctat gatcggtacg ggtcgtgaga gcgatcgccc ggagattgga 300
tctgagatat gatcctaggc cctacggggt gcagcaggcg cgaaaacttt acaatgtggg 360
aaaccatgat aagggaattc ccagtgttcc tacatagtag gaactgttta ggtgcgtaaa 420
aaacacctaa tagaaagggc cgggtaagac cggtgccagc cgccgcggta ataccggtgg 480
ctcgagtggt ggccgctatt attgggtcta aagggtccgt agccggcttg ataagttacc 540
tggaaaatcc ggtggcctaa ccattgggcg gccaggtgat actatcaggc ttgggactag 600
gagagaccag aggtactcat gaggtagggg tgaaatcctg taatcttatg aggaccacca 660
gtggcgaagg cgtctggtta gaataggtcc gacggtgatg gacgaaggct gggggcgcaa 720
accggattag atacccgggt agtcccagca gtaaacgatg ccagctatgt gttgctgaaa 780
ccatgggttt cagcagtgcc gaagggaagc cgtgaagctg gccacctggg aagtacggcc 840
gcaaggctga aacttaaagg aattggcggg ggagtaccac aaccggtgga gcctgcggtt 900
taattggata caacgccggg aatcttaccg gaggggacag cagtatgaag gtcaggctaa 960
agaccttacc agatcagctg agaggaggtg catggccgtc gccagttcgt accgtgaggc 1020
atcctgttta gtcaggcaac gatcgagacc cgtagtctta tttgccagca tgccctctgg 1080
ggtgtatggg gacaataaga cgaccgtcag cgctaagctg aaggaaggag cgggctacgg 1140
taggtcagca tgccctgaat cctccgggat acacgcgggc tacaatggtc aggacaaaag 1200
gtatcgacct cgaaagagtg agataatccc ataaacctga tctcagtccg gatcgaaggc 1260
tgcaactcgc cttcgtgaag atggaatcgg tagtaatcgt gactcaaaat gtcacggtga 1320
atatgtccct gctccttgca cacaccgccc gtcaaatcac ccgagtggga tctggaggag 1380
gtctttctcg cagaggaaga tcgaatctgg attctgcaag gggggttaag tcgtaacaag 1440
gtagccgtag gggaacctgc ggctggatca cctcct 1476
<210> 6
<211> 1475
<212> DNA
<213> candidatus methanoliparum cluster2
<400> 6
ttgatcctgc cggaggccac tgctatggga attcgactaa gccatgcaag ttgagggcac 60
ctttttagga gacccagcga actgctcagc aacacgtgga taatctgccc acaggacggg 120
gataatcccg ggaaactggg aataataccc gataggtcat tggtactgga atgtcctttg 180
gcctaaatgc tttttctacg cctgtggatg agtctgcgtc cgattaggct gttgttgggg 240
taacggccca acaaacctac gatcggtacg ggtcgtgaga gcgattgccc ggagatggga 300
tctgagatat gatcctaggc cctacggggt gcagcaggcg cgaaaacttt acaatgtggg 360
aaaccatgat aagggaattc ccagtgttcc tacatagtag gaactgttta ggtgtgtaaa 420
aagcacttaa tagaaagggc cgggtaagac cggtgccagc cgccgcggta ataccggtgg 480
ctcgagtggt ggccgctatt attgggtcta aagggtccgt agccggcttg ataagttacc 540
tgggaaatcc ggtggcctaa ccatcgggcg gccgggtaat actatcgagc ttgggactag 600
gagagaccag aggtactcat gaggtaggag tgaaatcctg taatcttatg aggaccacca 660
gtggcgaagg cgtctggtta gaataggtcc gacggtgagg gacgaaggct gggggcgcaa 720
accggattag atacccgggt agtcccagca gtaaacgatg ccagctatgt gttgctgaaa 780
ccatgggttc cagcagtgcc gaagggaagc cgtgaagctg gccacctggg aagtacggtc 840
gcaaggctga aacttaaagg aattggcggg ggagtaccac aaccggtgga gcctgcggtt 900
taattggata caacgccggg aatcttaccg gaggggacag cagtatgaag gccaggctaa 960
agaccttgcc agatcagctg agaggaggtg catggccgtc gccagttcgt accgtgaggc 1020
atcctgttta gtcaggcaac gatcgagacc cgcagtctta tttgccagca tgccccctgg 1080
ggtgtatggg tacaataaga cgactgccag cgctaagctg gaggaaggag cgggctacgg 1140
taggtcagca tgccccgaat cctccgggat acacgcgggc tacaatggtc aggacaaaag 1200
gtaccgacct cgaaagagtg aggtaatcca caaacctgat ctcagtccgg atcgaaggct 1260
gcaactcgcc ttcgtgaaga tggaatcggt agtaatcgtg actcaaaatg tcacggtgaa 1320
tatgtccctg ctccttgcac acaccgcccg tcaaaccacc cgagtggggc ctggaggagg 1380
ttcctctctt tgagagggat caaatctggg ttctgcaagg ggggttaagt cgtaacaagg 1440
tagccgtagg ggaacctgcg gctggatcac ctcct 1475
<210> 7
<211> 1476
<212> DNA
<213> candidatus methanoliparum cluster3
<400> 7
ttgatcctgc cggaggtcac tgctatggga attcgactaa gccatgcaag ttgagggcac 60
cttttatagg agacccagca aactgctcag taacgcgcgg ataatctgcc cacaggacgg 120
ggataacccc gggaaactgg gagtaatacc cgataggtca ttgatactgg aatgttcttt 180
gatctaaatg ctctttttac gcctgtggat gagtctgcgt ccgattaggc tgttgttggg 240
gtaatggccc aacaaaccta cgatcggtac gggtcgtgag agcgattgcc cggagatggg 300
atctgagata tgatcctagg ccctacgggg tgcagcaggc gcgaaaactt tacaatgtgg 360
gaaaccatga taagggaatt cccagtgttc ctacaaagta ggaactgttt gggtgtgtaa 420
aaagcatcca atagaaaggg ccgggtaaga ccggtgccag ccgccgcggt aataccggtg 480
gctcgagtgg tgaccgcttt tattgggtct aaagcgtccg tagccggcct aaaaagttac 540
ctgggaaatc cggtggccta accatcgggc ggccgggtga tactattagg cttgggacta 600
ggagagacca gaggtactca tgaggtagga gtgaaatcct gtaatcttat gaggaccacc 660
agtggcgaag gcgtctggtt agaataggtt cgacggtgag ggacgaaggc tgggggcgca 720
aaccggatta gatacccggg tagtcccagc agtaaacgat gccagctatg tgttgctgga 780
accatgggtt ctagcagtgc cgaagggaag ccgtgaagct ggccacctgg gaagtacggc 840
cgcaaggctg aaacttaaag gaattggcgg gggagtacca caaccggtgg agcctgcggt 900
ttaattggat aaaacgccgg aaatcttacc ggaggggaca gcagtatgaa ggtcaggcta 960
aagaccttac cagatcagct gagaggaggt gcatggccgt cgccagttcg taccgtgagg 1020
catcctgttt agtcaggcaa cgagcgagac ccgcggtctt atttgccagc ataccccctg 1080
gggtgtatgg gtacaataag acgaccgcca gcgctaagct ggaggaagga gcgggctacg 1140
gtaggtcagc atgccccgaa tcctccggga tacacgcggg ctacaatggt caggacaaaa 1200
ggtaccaatc tcgaaagagt gaggtaatcc acaaacctga tcccagtccg gatcgaaggc 1260
tgcaactcgc cttcgtgaag atggaatcgg tagtaatcgt gcctcaaaat gtcacggtga 1320
atatgtccct gctccttgca cacaccgccc gtcaaatcac ccgagtgagg tctggaggag 1380
gttttcctct atgagaaaaa tcaaatctgg gtcttgcaag gggggttaag tcgtaacaag 1440
gtagccgtag gggaacctgc ggctggatca cctcct 1476
<210> 8
<211> 1475
<212> DNA
<213> candidatus methanoliparum cluster3
<400> 8
ttgatcctgc cggaggtcac tgctatggga attcgactaa gccatgcaag ttgagggcac 60
ctttttagga gacccagcga actgctcagc aacacgtgga taatctgccc acaggacggg 120
gataatcccg ggaaactggg aataataccc gatagatcat tggtactgga atgtcctttg 180
atctaaatgc tctttctacg cctgtggatg agtctgcgtc cgattaggct gttgttgggg 240
taacggccca acaaacctac gatcggtacg ggtcgtgaga gcgattgccc ggagatggga 300
tctgagatat gatcctaggc cctacggggt gcagcaggcg cgaaaacttt acaatgtggg 360
aaaccatgat aagggaattc ccagtgttcc tacatagtag gaactgttta ggtgtgtaaa 420
aagcacctaa tagaaagggc cgggtaagac cggtgccagc cgccgcggta ataccggtgg 480
ctcgagtggt ggccgctatt attgggtcta aagggtccgt agccggcttg ataagttacc 540
tgggaaatcc ggtggcctaa ccatcgggcg gccaggtaat actatcaggc tcgggactag 600
gagagaccag aggtactcat gaggtaggag tgaaatcctg taatcttatg aggaccacca 660
gtggtgaaga cgtctggtta gaataggtcc gacggtgagg gacgaaggct gggggcgcaa 720
accggattag atacccgggt agtcccagca gtaaacgatg ccagctatgt gttgctggaa 780
ccatgggttc cagcagtgcc gaagggaagc cgtgaagctg gccacctggg aagtacggtc 840
gcaaggctga aacttaaagg aattggcggg ggagtaccac aaccggtgga gcctgcggtt 900
taattggata caacgccggg aatcttaccg gaggggacag cagtatgaag gccaggctaa 960
agaccttgcc agatcagctg agaggaggtg catggccgtc gccagttcgt accgtgaggc 1020
atcctgttta gtcaggcaac gatcgagacc cgcagtctta tttgccagca tgccctttgg 1080
ggtgtatggg tacaataaga cgaccgccag cgctaagctg gaggaaggag cgggctacgg 1140
taggtcagca tgccccgaat cctccgggat acacgcgggc tacaatggtc aggacaaaag 1200
gtaccgacct cgaaagagtg aggtaatcca caaacctgat ctcagtccgg atcgaaggct 1260
gcaactcgcc ttcgtgaaga tggaatcggt agtaatcgtg actcaaaatg tcacggtgaa 1320
tatgtccctg ctccttgcac acaccgcccg tcaaaccacc cgagtggggt ctggaggagg 1380
tcgctctcta tgagagcgat caaatctggg ttctgcaagg ggggttaagt cgtaacaagg 1440
tagccgtagg ggaacctgcg gctggatcac ctcct 1475
Claims (10)
1. A primer pair for detecting archaea Candidatus Methanoliparum, characterized in that: the primer pair has one or more of the sequences shown in SEQ ID NO.1 and SEQ ID NO.2, the sequences shown in SEQ ID NO.1 and SEQ ID NO.3 and the sequences shown in SEQ ID NO.1 and SEQ ID NO. 4.
2. A kit for detecting archaea Candidatus Methanoliparum, characterized in that: a kit comprising the primer pair of claim 1.
3. The kit of claim 2, wherein: fluorescent reagents and positive controls are also included.
4. A kit according to claim 3, wherein: the positive control included the amplification cycle number CT values of archaea Candidatus Methanoliparum measured at different concentration gradients.
5. Use of the primer pair of claim 1 or the kit of any one of claims 2-4 for detecting archaea Candidatus Methanoliparum.
6. A method for detecting archaea Candidatus Methanoliparum, characterized by: comprising the step of performing PCR amplification using the primer set of claim 1.
7. The method according to claim 6, wherein: the method comprises the following steps: extracting genome DNA of a sample to be detected as a template, adding the primer pair of claim 1, performing PCR reaction, and judging whether archaea Candidatus Methanoliparum is contained in the sample to be detected after the reaction is finished.
8. The method according to claim 7, wherein: the method comprises the following steps: extracting genome DNA of a sample to be detected as a template, adding the detection primer in the claim 1, mixing with a fluorescent reagent to form an amplification reaction system, performing fluorescent quantitative PCR reaction, and if the amplification curve has a typical fluorescent amplification curve and the CT value is less than 33 after the reaction is finished, indicating that the sample to be detected contains archaea Candidatus Methanoliparum and quantifying archaea Candidatus Methanoliparum; if the amplification curve does not have a typical fluorescence amplification curve, the sample to be detected does not contain archaea Candidatus Methanoliparum.
9. The method according to claim 7 or 8, characterized in that: wherein each 10. Mu.L of the amplification system comprises 5. Mu.L of the fluorescent reagent, 5 to 20. Mu. Mol/L of the primer set as claimed in claim 1, 0.01 to 0.2. Mu.g of the template, and the balance of ultrapure water.
10. The method according to claim 7 or 8, characterized in that: the amplification reaction procedure was: pre-denaturation at 94-98 ℃ for 5-10min; 94-98 deg.c for 15-30s; annealing at 55-65 ℃ for 15-30s; extending at 72 ℃ for 15-30s for 30-40 cycles; finally, the mixture is extended for 5 to 10 minutes and stored at the temperature of 4 to 12 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111273466.5A CN113817856B (en) | 2021-10-29 | 2021-10-29 | Primer pair, kit and method for detecting archaea Candidatus Methanoliparum |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111273466.5A CN113817856B (en) | 2021-10-29 | 2021-10-29 | Primer pair, kit and method for detecting archaea Candidatus Methanoliparum |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113817856A CN113817856A (en) | 2021-12-21 |
| CN113817856B true CN113817856B (en) | 2023-06-16 |
Family
ID=78917556
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111273466.5A Active CN113817856B (en) | 2021-10-29 | 2021-10-29 | Primer pair, kit and method for detecting archaea Candidatus Methanoliparum |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113817856B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116179722B (en) * | 2022-09-22 | 2023-10-10 | 广东海洋大学 | Primer pair, kit and method for detecting archaea Hadesarchaea |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110241240A (en) * | 2019-06-25 | 2019-09-17 | 广东省微生物研究所（广东省微生物分析检测中心） | Detection primer, kit and the quantitative approach of cable bacterium Candidatus Electronema |
| CN112646902A (en) * | 2020-12-24 | 2021-04-13 | 山西大学 | Kit and method for rapidly detecting archaea |
-
2021
- 2021-10-29 CN CN202111273466.5A patent/CN113817856B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110241240A (en) * | 2019-06-25 | 2019-09-17 | 广东省微生物研究所（广东省微生物分析检测中心） | Detection primer, kit and the quantitative approach of cable bacterium Candidatus Electronema |
| CN112646902A (en) * | 2020-12-24 | 2021-04-13 | 山西大学 | Kit and method for rapidly detecting archaea |
Non-Patent Citations (5)
| Title |
|---|
| Zhuo Zhou, Cui-Jing Zhang, Peng-Fei Liu, Lin Fu, Rafael Laso-Pérez, Lu Yang, Li-Ping Bai, Jiang Li, Min Yang, Jun-Zhang Lin, Wei-Dong Wang, Gunter Wegener, Meng Li, Lei Cheng.Non-syntrophic methanogenic hydrocarbon degradation by an archaeal species.Nature.2021,第601卷(第7892期),257-262. * |
| 承磊 ; 郑珍珍 ; 王聪 ; 张辉.产甲烷古菌研究进展.微生物学通报.2016,第43卷(第05期),1143-1164. * |
| 来守超 ; 方晓瑜 ; 涂波 ; 陈浩 ; 邓泽 ; 李贵中 ; 陈振宏 ; 张辉 ; 承磊.典型煤层水微生物产甲烷潜力及其群落结构研究.微生物学报.2020,第60卷(第04期),727-738. * |
| 段昌海 ; 张翠景 ; 孙艺华 ; 李猛 ; .新型产甲烷古菌研究进展.微生物学报.2019,59(第06期),981-995. * |
| 陈金全 ; 郑燕平 ; 姜丽晶 ; 王风平 ; .珠江口海岸带沉积物氨氧化细菌和古菌组成及定量研究.安徽农业科学.2012,40(第22期),11382-11385. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113817856A (en) | 2021-12-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101818192B (en) | Compound amplification kit of 20 short tandem repeats | |
| Klintschar et al. | Evaluation of an alkaline lysis method for the extraction of DNA from whole blood and forensic stains for STR analysis | |
| CN104131072B (en) | A kind of method and system unknown sample being carried out to individual recognition and paternity identification | |
| CN112359093B (en) | Method and kit for preparing and expressing and quantifying free miRNA library in blood | |
| CN108018301B (en) | Method for determining core promoter of miR-27a gene and binding site of transcription factor Myod thereof | |
| CN107354211B (en) | Forest musk deer four-base microsatellite genetic marker locus and screening method thereof | |
| WO2020258531A1 (en) | Detection primer, kit and quantitative measurement method for cable bacteria candidatus electronema | |
| CN112481417B (en) | Rapid detection method and kit for new coronavirus typing and mutation sites | |
| CN113817856B (en) | Primer pair, kit and method for detecting archaea Candidatus Methanoliparum | |
| CN112322733A (en) | Nucleic acid composition and kit for detecting EGFR gene mutation and method for detecting EGFR gene mutation | |
| Watanabe et al. | Evaluation of a co-extraction method for real-time PCR-based body fluid identification and DNA typing | |
| WO2017185758A1 (en) | Primer, probe, kit, and method for microchimerism assay and individual recognition | |
| CN106086223B (en) | A kind of STR parting kit based on ZNA primer | |
| CN111286320A (en) | Fluorescent dye for nine-color fluorescent STR typing, specific amplification primer pair and typing method | |
| CN110863033A (en) | Standard substance for quantitatively detecting microcystis and preparation and detection methods thereof | |
| CN100485046C (en) | ABO blood type gene and short tandem repetitive locus composite amplification system | |
| CN103667264A (en) | Preparation method of deoxyribonucleic acid (DNA) Marker | |
| CN113637799B (en) | RPA detection method for chrysanthemum B virus | |
| CN113862394B (en) | RPA detection method for tomato infertility virus | |
| CN105018604A (en) | Kit for detecting drug resistance gene polymorphism at a room temperature by probe | |
| CN114134212A (en) | Primer probe combination and kit for plasmid quantification | |
| CN115725756A (en) | RPA primer group, reagent and kit for detecting treponema pallidum and application of RPA primer group, reagent and kit | |
| CN114622041A (en) | Primer and TaqMan probe for detecting canine torque teno virus and application thereof | |
| CN111575386B (en) | Fluorescent composite amplification kit for detecting human Y-SNP locus and application thereof | |
| US20090311677A1 (en) | Identification of contaminating bacteria in industrial ethanol fermentations |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |