CN113817749B - Arabidopsis thaliana clubroot disease candidate related gene AT3G22970 and application thereof - Google Patents

Abstract

The invention provides an arabidopsis thaliana susceptibility related gene AT3G22970 and application thereof, belonging to the technical field of plant genetic engineering. The CDS sequence of the Arabidopsis AT3G22970 is shown as SEQ ID No. 1. The T-DNA insertion mutant material of the gene is more resistant to clubroot than that of Columbia type wild Arabidopsis thaliana, AT3G22970 with an enhanced promoter is transformed into Col-type Arabidopsis thaliana through agrobacterium infection, an AT3G22970 over-expression Arabidopsis thaliana strain is obtained, and as a result, the over-expression of AT3G22970 can cause the Arabidopsis thaliana to be more susceptible to the clubroot, and the phenotype is particularly generated because the gene participates in supporting the growth and development of pathogens in plant roots. Research shows that AT3G22970 of arabidopsis thaliana has close incidence relation with clubroot, and the gene and homologous genes thereof in other crucifers can be applied to crucifer breeding, so that the method has good application prospect.

Description

Arabidopsis thaliana clubroot disease candidate related gene AT3G22970 and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to arabidopsis AT3G22970 and application thereof in a plant disease resistance process.

Background

Arabidopsis thaliana (Arabidopsis thaliana) is a cruciferous model plant and has significant research implications in plant foundation science. The brassica tumefaciens (Plasmodiophora brassicae) belongs to the kingdom of protist, the phylum of the brassica tumefaciens, the class of the brassica tumefaciens, the order of the brassica tumefaciens, the brassica tumefaciens caused by the brassica tumefaciens, the brassicaceae plant clubroot (club root) specially occurs at the root of the brassicaceae plant, the abnormal change of plant hormone in different disease stages is caused, the abnormal expansion of the plant root is finally caused, the abnormal expansion of the root can not absorb moisture and nutrient substances, and the whole plant of the disease plant dies in severe cases. Clubroot disease in cruciferae is widely distributed throughout the world and poses a serious threat to the production of cruciferae crops.

In the brassica crop seed market, hybrids have great advantages, which also lead to our breeding efforts, tending to select for the dominant resistance gene, but the resistance inherited by the single dominant gene preferentially selected is easily overcome by the process of co-evolution of pathogenic hosts and cannot last. A disease-causing gene is a widely occurring gene in plants that can be involved in promoting plant disease or supporting pathogen compatibility with plants. Three general categories can be distinguished according to the stage of involvement in the disease. The first category supports disease before early penetration, there are some genes related to stratum corneum and cell wall composition; still other plant genes that regulate membrane dynamics are established by pathogens that aid in their haustorium, the second category being genes that encode negative regulators of immune signaling pathways. Inhibit PTI and DTI processes and antagonism of jasmonic acid salicylic acid. Inhibiting calcium ion and lipid mediated immunity and ETI. The third class is genes that support long-acting compatibility, genes that support viral replication in plants, involved in sugar transport, in metabolite biosynthesis, in internal replication, cell expansion, and can increase metabolic output potential. Most of these infectious genes play a role in plants, but are utilized by pathogens to support the pathogenicity. Loss of a disease-causing gene relative to a disease-resistant gene often means that a delicate balance between plant and pathogen is broken, resulting in a resistance phenotype similar to that of a non-host. Co-evolution cannot repair this disruption. Therefore, the deletion of the disease-causing gene can provide a broader spectrum and durable resistance which is not easy to overcome by pathogens.

The prediction of the functional elements of the promoter shows that the promoter of AT3G22970 contains a plurality of hormone response elements, GO comments in an Arabidopsis database show that the gene codes unknown proteins, and AT3G22970 up-regulates expression 24 hours after the Arabidopsis is infected by the rhizopus.

Disclosure of Invention

The invention aims to provide arabidopsis AT3G22970 and application thereof.

The invention provides a clubroot disease susceptibility gene AT3G22970, which is: a gene cloned from a columbia-type wild arabidopsis thaliana, having:

1) A nucleotide sequence shown as SEQ ID No. 1; or (b)

2) The nucleotide sequence shown in SEQ ID No.1 is substituted, deleted and/or added with one or several nucleotides; or (b)

3) Nucleotide sequence which hybridizes under stringent conditions to the DNA sequence defined in 1).

The invention provides a biological material containing the arabidopsis AT3G22970, wherein the biological material is an expression vector, an expression cassette, a host cell or engineering bacteria.

The invention provides application of the Arabidopsis AT3G22970 or the corresponding biological material thereof in screening clubroot resistant plants and/or regulating and controlling the clubroot resistant functions of the plants.

Further, the application is specifically:

plants are susceptible to clubroot by over-expressing the plant AT3G22970, and under-expressing or knocking out the plant AT3G22970 to combat clubroot.

Plants resistant to clubroot are obtained by screening plants that do not or poorly express AT3G 22970.

The invention provides application of the arabidopsis AT3G22970 or the corresponding biological material thereof in preparing transgenic plants.

Further, the clubroot is caused by the brassica clubroot.

The sequence of the Arabidopsis AT3G22970 provided by the invention is shown as SEQ ID No. 1. Through pathogen injection inoculation, the T-DNA insertion mutant material of AT3G22970 is found to be more disease-resistant than wild Columbia type Arabidopsis thaliana, AT3G22970 with an enhanced promoter is transformed into the Columbia type Arabidopsis thaliana through agrobacterium infection, an AT3G22970 over-expression Arabidopsis thaliana strain is obtained, and disease resistance analysis experiments show that the over-expression of the Arabidopsis thaliana AT3G22970 can promote root swelling caused by the infection of root of Arabidopsis thaliana. Research shows that the Arabidopsis AT3G22970 has close relation with the cruciferous clubroot, and the gene and the homologous genes thereof in other cruciferous plants are applied to cruciferous plant breeding, thereby having good application prospect.

Drawings

FIG. 1 is a quantitative analysis column diagram of AT3G22970 for 24h (24 hai) and 48h (48 hai) after infection of Columbia type wild Arabidopsis thaliana with Rhizopus and non-infected control group (ck).

FIG. 2 is a PCR electrophoresis chart of CDS clones of Arabidopsis AT3G 22970. Wherein the left M lane is marker, and the right 1, 2,3,4 lanes are target fragments.

FIG. 3 is a schematic diagram of AT3G22970 over-expression vector (A) and its promoter fusion GUS expression vector (B).

FIG. 4 shows a screening PCR schematic of homozygous strain of T-DNA insertion mutant material salk_085849, wherein M is marker, lanes 1, 2,3,4 and 9 are homozygous strains, lanes 5, 6 and 7 are identical to wild type wt lanes, and lane 8 is heterozygous.

FIG. 5 is a comparison of growth of mutant plants after pathogen inoculation with control plants, wt-mock is a negative control of 1ml of nutrient solution inoculated with wild type Arabidopsis thaliana, wt-ck is a positive control of 1ml of dormant spore suspension of plasmodium rhizomatosum inoculated with wild type Arabidopsis thaliana, salk_085849-mock is a negative control of 1ml of nutrient solution inoculated with salk_085849 mutant plants, salk_085849 is a negative control of 1ml of dormant spore suspension of plasmodium rhizomatosum inoculated with salk_085849 mutant plants, and images were taken 21d after inoculation.

FIG. 6 is a root condition comparison of 21 days (21 d) salk_085849 mutant plants after pathogen inoculation with control plants, wt-mock was a negative control for 1ml of nutrient solution inoculated from wild type Arabidopsis thaliana, wt-ck was a positive control for 1ml of a dormant spore suspension of P.tumefaciens inoculated from wild type Arabidopsis thaliana, salk_085849-mock was a negative control for 1ml of nutrient solution inoculated from salk_085849 mutant plants, salk_085849 was 1ml of dormant spore suspension of P.tumefaciens inoculated from salk_085849 mutant plants, and images were taken at 21d after inoculation.

FIG. 7 is a bar graph of disease index investigation analysis of the gene over-expressed plants and mutant material and control plants after pathogen inoculation. The conditions of the over-expression plants and pBI121 empty-load transformed plants on the left side are respectively 5.10 in inoculation concentration ⁶ And 10 ⁷ Disease index in two independent experiments of concentration; on the right is the disease index of AT3G22970 mutant material salk_085849 and control plant in three independent experiments (adjustment of seed concentration to fall AT 10) ⁷ ～5*10 ⁷ Between the concentrations, 3 replicates were set per experiment, each replicate was for 12 plants, representing significant differences in t-test, error bars were standard errors).

FIG. 8 shows the schematic representation of the histochemical staining of the AT3G22970 promoter and GUS fusion expression vector transformed Arabidopsis positive plants, A being seedlings, B being leaves, C being root tissue, D being inflorescence, E being Hordeum vulgare.

FIG. 9 is a graph of expanded root sections of mutant material salk_085849 and 21d after pathogen inoculation of wild type Arabidopsis, A, B, E, F for wild type Arabidopsis, C, D, G, H for salk_085849, A and C scales of 200 μm, B, D for 100 μm, and E, F, G, H for 50. Mu.m.

Detailed Description

The present invention is illustrated by the following specific examples, in which technical means not described in detail are conventional techniques well known to those skilled in the art. The examples are intended to be illustrative of the present invention and not to be construed as limiting the scope of the invention, as other examples are intended to be within the scope of the invention without undue burden by those skilled in the art.

The embodiment of the invention provides a clubroot disease gene AT3G22970, which is cloned from Columbia type wild Arabidopsis thaliana, and the gene sequence of the gene is shown as SEQ ID No. 1.

The embodiment of the invention also provides application of the arabidopsis AT3G22970 in controlling clubroot of cruciferous plants, and the application is specifically described below.

Example 1 real-time fluorescent quantitative PCR

1. Enough Columbia type wild Arabidopsis thaliana is planted, grown for about 3 weeks, and inoculated with pathogen as a treatment group. (specific steps are described in example 5 below).

2. Real-time fluorescent quantitative PCR

Real-time fluorescence quantitative PCR analysis of 24h and 48h after pathogen infection of Arabidopsis thaliana, variation of the expression level of AT3G 22970: mixing at least 10 strains of wild arabidopsis thaliana of the treatment (24 h and 48h after pathogen inoculation) and the control group, taking materials, washing roots, marking, quickly placing the materials into liquid nitrogen for fixation, extracting total RNA after all the materials are taken, reversely transcribing the total RNA into cDNA, and carrying out qRT-PCR analysis. Primers used for qRT-PCR analysis were designed by Primer Premier 6 as shown in Table 1. The reaction system was 15. Mu.L: 7.5. Mu.L of SYBR Green Master Mix, 0.3. Mu.L of each forward and reverse primer, 1. Mu.L of template, 5.9. Mu.L of double distilled water. qRT-PCR reaction scheme: 95 ℃ C:: 30s,40 cycles (95 ℃ C.: 5s,55 ℃ C.: 45 s). The specificity of the reaction is determined by a melting curve, the internal reference gene is atacin 7, and the relative expression quantity of the gene passes through 2 ^-ΔΔCt And (5) calculating a method. (three biological replicates were performed during sampling)

The results (FIG. 1) show that the gene is differentially expressed 24h and 48h after infection of Arabidopsis thaliana by Rhizopus, with up-regulated expression at 24h compared to the control group.

TABLE 1 primers used in qRT-PCR analysis of Arabidopsis plants

Primer name	Primer sequence (5 '-3')
		22970-F	CGGTGCTCAAATCTCGTCT(SEQ ID No.2)
22970-R	ATGGTTTCTCGGTGGTTGT(SEQ ID No.3)
		AtActin7-F	GGAACTGGAATGGTGAAGGCTG(SEQ ID No.4)
AtActin7-R	CGATTGGATACTTCAGAGTGAGGA(SEQ ID No.5)

EXAMPLE 2 construction of AT3G22970 overexpression vector

1. pBI121 vector double enzyme digestion

Double enzyme cutting of BamHI and XbaI, electrophoresis separation of large fragment strips and rubber cutting recovery;

2. trizol method for extracting RNA

Wild type Arabidopsis root tissue sampling, trizol method for RNA extraction: calculating the number of samples, preparing a corresponding mortar pestle and a small iron ladle, and wrapping tin foil paper and baking at 180 ℃ for 4-5 hours; 1.5ml centrifuge tube (RNAFree), gun and gun head of RNAFree, liquid nitrogen, centrifuge tube plate, and autoclaving at 121℃for 40min. Taking the corresponding number of centrifuge tubes, and numbering; adding 1ml of Trizol into each tube in a fume hood, and placing on ice; adding nitrogen into the pre-cooled mortar, grinding for 3-5 times to powder, transferring into Trizol, and vibrating thoroughly; 200ml of chloroform is added into a fume hood, and the mixture is vigorously shaken for 15s and then is frozen for 5min; centrifuging at 12000rpm at 4deg.C for 10min, transferring 600 μl supernatant into a new 1.5ml centrifuge tube, adding 1 times volume isopropanol, mixing, standing at-20deg.C for 30min; centrifuging at 12000rpm at 4deg.C for 10min, and removing supernatant; adding 1ml of pre-cooled DEPC water-dissolved 75vol% ethanol, centrifuging at 4 ℃ and 12000rpm for 10min, and pouring out the supernatant; air-separating for 20sec, sucking out liquid, and air-drying in a kitchen for 30min. Add 50. Mu.l DEPC water to dissolve RNA precipitate and determine the concentration for later use.

3. Preparation of cDNA

Takara reverse transcription kit removes genomic DNA: the system contained 2.0. Mu.l 5xgDNA Eraser Buffer,1.0. Mu.l gDNA Eraser, 1.0. Mu.g/. Mu.l Tatal RNA, 6.0. Mu.l RNAFree ddH ₂ O, metal bath at 42 ℃ for 2min; reverse transcription: the reaction system contained 10. Mu.l of the above-obtained genomic DNA-removed product, 4.0. Mu.l 5xPrimerscript Buffer,1.0. Mu. l Primerscript RT Enzyrne Mix, 1.0. Mu.l RT Primer Mix, 4.0. Mu.l RNase Free ddH ₂ O, reacting for 5sec at 37 ℃ for 20min at 85 ℃ and preserving at-20 ℃ for standby.

4. Designing a specific primer (the primer sequence information is shown in table 2), amplifying the CDS sequence of AT3G22970 by high-fidelity KOD enzyme, separating a PCR product by agarose gel electrophoresis with the concentration of 0.8%, and recovering rubber cuts (figure 2).

5. Homologous recombination ligation

The linearization vector and the PCR amplified and purified fragment are connected by homologous recombination: the single-piece homologous recombination reagent box C112 of the nupraise is used, and the system is as follows: 4 μl 5xCE II Buffer,2 μl Exase II, 200ng of double digested linearized vector, 20ng CDS fragment of AT3G22970, ddH ₂ O was made up to 20. Mu.l; the reaction was carried out at 37℃for 30min.

6. Transforming escherichia coli, culturing the obtained bacterial liquid, performing PCR verification, extracting target plasmid sequencing verification (primers are shown in table 3), verifying that the successfully-compared plasmid is transformed into agrobacterium competent by electrotransformation, and culturing the successfully-transformed bacterial liquid with a strip by PCR, so that the volume is enlarged; extracting plasmid sequencing verification (final carrier map is shown in figure 3-A), and preserving strain in the strain solution and keeping the mother solution at 4deg.C for storage.

TABLE 2 primers for construction of heterologous expression vectors

EXAMPLE 3 transformation by Arabidopsis thaliana flower dipping and screening of positive transformants

1. Transformation of Arabidopsis thaliana by flower dipping

The bacterial liquid is verified by sequencing, and the agrobacterium GV3101 bacterial liquid of the pBI121 empty vector plasmid is used as a mother liquid to transform the arabidopsis through a floral dip method, and the steps are as follows: 500 μl of agrobacteria liquid containing the objective vector is added into 200ml of liquid LB containing kanamycin and rifampicin (50 mg/L), shaking is carried out at 28 ℃ and 200rpm for about 30 hours until OD600 is 1.2; centrifuging at 8000rpm for 10min to obtain agrobacterium precipitate, 200ml 5% sucrose re-suspension; adding Silwet-77 to a final concentration of 200 μl/L, and shaking at 28deg.C at 200rpm for 2min; removing the blooming flowers and the horns of the wild arabidopsis thaliana, immersing the buds in the bacterial liquid for 30sec, sucking up more bacterial liquid, carrying out moisture preservation and dark culture at 25 ℃ for 24h, then carrying out normal culture, and repeating the blooming once after one week.

2. Preparing kanamycin sowing culture medium

2.22g of MS powder, 10g of sucrose 2M NaOH, regulating the pH to 5.8 to obtain an MS culture medium, adding 4g of agar powder, sterilizing by high-pressure steam at 121 ℃ for 20min, cooling to 50-60 ℃ in an ultra-clean workbench, adding kanamycin to a final concentration of 75mg/L, and pouring into a solid flat plate.

3. Screening of Positive transformants

The T1 generation of the arabidopsis seeds obtained by the flower dipping is sown on a kanamycin sowing culture medium, and the steps are as follows: 10vol% NaClO disinfection for 2min; washing seeds with 75vol% ethanol for 2min; washing with sterile water for 5 times and 1min each time; sowing on kanamycin seed sowing culture medium, sealing, culturing at 22deg.C (16 hr light, 8 hr dark), removing positive plant with strong growth vigor and dark green leaf color, and PCR detection and verification (primer shown in Table 3).

TABLE 3 primers for PCR detection of transgenic Arabidopsis thaliana

Primer name	Primer sequence (5 '-3')
		pBI121-Oe-F	CCACGTCTTCAAAGCAAGTG(SEQ ID No.8)
pBI121-Oe-R	TTGTAACGCGCTTTCCCAC(SEQ ID No.9)

EXAMPLE 4 selection of T-DNA insertion mutant Material

1. DNA extraction by rapid DNA extraction method: adding 200ul of DNA extraction buffer solution and magnetic beads into a centrifuge tube with Arabidopsis leaves, and crushing tissues (65 Hz,120 s) by a crusher; after grinding, transferring all tissue fluid into a 1.5ml centrifuge tube, and centrifuging at 13000rpm for 8min; preparing a new 1.5ml centrifuge tube, adding 100 mu l of isopropanol into each tube, transferring 100 mu l of supernatant into the centrifuge tube containing the isopropanol with equal volume, gently shaking for about 50 times, and standing at room temperature for 5min; centrifuging at 13000rpm for 6min, and removing supernatant; washing the precipitate with 1ml 70vol% ethanol twice (shaking up and down for 20 times, centrifuging at 13000rpm for 3min, discarding supernatant, repeating for one time; air-separating for 1 min), sucking out the liquid, air-drying the precipitate for 5min, and adding 25-50 μl ddH ₂ O, standby at-20 ℃.

2. Three-primer PCR assay (primers see Table 4): 1.1xT3Super Mix PCR the reaction system is as follows: 44 μl 1.1xT3super Mix,2 μl Template,2 μl Primer F,2 μl Primer R; the procedure is set to be 2min 30sec at 98 ℃, and the amplification is carried out in 35 circles of circulation (10 sec for denaturation at 98 ℃,10 sec for annealing at 55 ℃ and 10sec for extension at 72 ℃), and finally the amplification of the complete fragment is ensured by full extension at 72 ℃ for 2min; the PCR product amplified by the LP+RP primer and the PCR product amplified by the RP+BP primer were uniformly mixed and separated by 0.8wt% agarose gel electrophoresis. The homozygous individual containing only a single small fragment (fig. 4) was the mutant material salk_085849, and the seeds were harvested for subsequent experiments.

TABLE 4T-DNA insertion mutant materials screening primers

Primer name	Primer sequence (5 '-3')
		T-DNA-BP	ATTTTGCCGATTTCGGAAC(SEQ ID No.10)
Salk_085849-LP	ATGTCTTCCGTGAACATCGTC(SEQ ID No.11)
		Salk_085849-RP	CCCATTTTGATTTGCAGATTG(SEQ ID No.12)

EXAMPLE 5 pathogen vaccination and disease index investigation

1. Reagent preparation

2% chloramine T:2g chloramine T in 100ml ddH ₂ O, note should be used at present.

Vancomycin hydrochloride mother liquor (50 mg/ml): in an ultra clean bench, 0.25g vancomycin hydrochloride was dissolved in 5ml ddH ₂ Filtering, sterilizing, and packaging in 1.5ml centrifuge tube at-20deg.C.

Colistin sulfate mother liquor (20 mg/ml): in a super clean bench, 0.2g colistin sulfate was dissolved in 10ml ddH ₂ Filtering, sterilizing, and packaging in 1.5ml centrifuge tube at-20deg.C.

Cefotaxime sodium mother liquor (250 mg/ml): 2.5g of cefotaxime sodium dissolved in 10ml of ddH in an ultra clean bench ₂ Filtering, sterilizing, and packaging in 1.5ml centrifuge tube at-20deg.C.

Antibiotic working solution: 100ml ddH ₂ To O water was added 2. Mu.l of vancomycin hydrochloride mother liquor (50 mg/ml), 5. Mu.l of colistin sulfate mother liquor (20 mg/ml), 2.4. Mu.l of cefotaxime sodium mother liquor (250 mg/ml).

10% NaClO:10ml NaClO with 90ml ddH ₂ O dilution.

50% sucrose solution: 50g sucrose was dissolved in 100ml ddH ₂ O。

Hoagland nutrient solution: in the ultra clean bench, prepared A, B, C solutions were purchased from the Internet, dissolved in 1L of sterile water as a mother solution, and 10ml of each of A, B, C working solutions was used and dissolved in 1L of sterile water.

2. Collection of root of disease

The root collecting period is important, the disease occurrence during collecting is required to be ensured to reach the later stage of onset of massive generation of dormant spores, the concentration and purity of spore suspension are greatly influenced by the root in a proper period, the collected root is cleaned of surface soil, and the absorbent paper is wiped dry. Resting spores can be extracted after decomposing for 2-3d at room temperature. The rest can be frozen at-20deg.C for use. (the pathogenic materials used in this example were all collected from Jiangsu Yixing, the physiological minitypes were ECD28/31/31 physiological minitypes, namely P4 physiological minitypes)

3. Preparation of spore suspensions (modified by density gradient centrifugation according to Yang Peiwen et al) (Yang Peiwen et al, 2002):

(1) And cleaning and thoroughly decomposing the collected disease roots, and filling a 50ml centrifuge tube.

(2) 1min with 70vol% alcohol, 20min with 10vol% NaClO, and 3 washes with sterile water.

(3) Squeezing the root nodule into paste with a juicer, fixing eight layers of gauze on the can bottle mouth, and filtering for the first time.

(4) Spreading eight layers of gauze on the funnel, and filtering the filtrate again.

(5) The filtrate is collected in a 50ml centrifuge tube, leveled to 45ml and centrifuged for 15min, and the supernatant is removed.

(6) Adding sterile water to 40ml, centrifuging at 4000rpm for 10min, and removing supernatant; repeating once.

(7) The pellet was dissolved in 5ml of 50% sucrose solution and centrifuged at 3100rpm for 10min, and the supernatant and the off-white pellet, which tended to dissolve, were transferred to a new 50ml centrifuge tube.

(8) Adding sterile water to 45ml; centrifuge at 4000rpm for 10min and discard supernatant.

(9) Dissolving the precipitate in 30ml of sterile water, and centrifuging at 3100rpm for 10min; repeating for 2-3 times until the color is clear.

(10) Dissolving the obtained precipitate in 10-15ml of sterile water (water is added according to the amount of spore precipitate), and preserving at 4deg.C; or directly surface-disinfecting for standby.

(11) Surface disinfection of spores:

A. adding 30ml of 2% chloramine T, shaking uniformly, and treating at room temperature for 20min;

centrifuging at 3100rpm for 7min, removing supernatant, adding 30ml sterile water, and mixing;

centrifuging at 3100rpm for 7min, removing supernatant, adding 30ml of antibiotic working solution, and mixing;

d, dark incubation at 25 ℃ for 24 hours, centrifugation at 3100rpm for 7min, supernatant removal, and uniform mixing with 30ml of sterile water;

e.3100rpm for 7min, removing the supernatant;

F. 10-15ml of sterile water is added for 2-10 days.

(12) Blood cell counting plate (model 1/400 mm) ² ) Counting (total number of line pressing spores on the left upper two lines of each middle lattice), and measuring and calculating the concentration of spore suspension:

concentration (individual/ml) = (upper left + lower left + middle + upper right + lower right) total number of resting spores in 80 cells/80 x 400 x 104 x dilution

4. Pathogen inoculation and water and fertilizer management

The offspring of the wild arabidopsis and the homozygous mutant are sown on seedling raising blocks, the offspring of the over-expression positive plants and the offspring of the pBI121 empty-load transformant are sown on kanamycin sowing culture medium, marks are correspondingly made, 36 plants (three repetitions and 12 plants each repetition) are transferred into a sterilization matrix according to a random block design principle after two weeks, independent positive control (the wild arabidopsis Col-0 is infected by the same concentration and volume) and negative control (the wild arabidopsis and the mutant arabidopsis are inoculated by the same volume of sterile nutrient solution) are set in each independent experiment, and seedlings are buffered for 5-6d; preparing spore suspension, and placing the sterilized spore suspension at room temperature for 2-6d in a dark place for use; diluting the spore suspension with Hoagland nutrient solution to a concentration of 10 according to the concentration counted by the hemocytometer ⁷ -5*10 ⁷ Individual/ml; pouring a sufficient amount of water before inoculation, injecting the mixture into root parts near hypocotyl positions by a disposable 1ml syringe, and injecting 1ml spore suspension of each strain simultaneouslyStirring the spore suspension to ensure uniform distribution of dormant spores; and (3) after inoculation, placing the culture medium back into an incubator for normal culture for 48 hours without watering, recovering normal management later, regularly watering without supplementing nutrient solution, and observing and photographing after 21 days to record root morbidity.

5. GA/LA disease index investigation and analysis

Photographs recorded from photographs of each plant were processed with ImageJ to calculate maximum leaf length and root swelling area, GA/LA disease index for each plant was calculated according to the formula (Gravot et al 2012;Gravot et al, 2016), mean and standard error were calculated, t-test analysis differences were visualized as a bar graph, as shown in fig. 7.

The calculation formula is as follows: GA/LA Disease Index = area of the swollen root/(maximum leaf length) 2 x 5000 (Gravot et al 2012; gravot et al 2016)

The results show that: mutant material salk_085849 of AT3G22970 had no obvious side effect phenotype (yellowing, premature senescence, dwarf plants, etc.) (fig. 5). And part of the plants were significantly more resistant to clubroot than wild type arabidopsis (fig. 6), the mutant material salk_085849 of AT3G22970 showed significantly lower overall average disease index than wild type in independent experiments of three pathogen vaccinations, and after over-expressing the gene in wild type arabidopsis, the over-expressed plants showed more susceptibility to disease than pBI121 empty (fig. 7).

EXAMPLE 6 analysis of Arabidopsis AT3G22970 space-time expression Pattern

(1) The 1301 vector is cut by KPNI and NcoI, large fragment strips are separated by electrophoresis, and rubber cutting is recovered.

(2) The DNA is rapidly extracted from the wild arabidopsis, a special primer (the primer is shown in table 5) is designed AT about 1500bp upstream of the AT3G22970 gene, the promoter sequence of the corresponding gene is amplified by high-fidelity KOD enzyme, the PCR products are separated by agarose gel electrophoresis with the concentration of 0.8%, the length is consistent, and only the single fragment of the PCR products are used for product purification.

(3) The linearized vector and the PCR amplified purified fragment are connected by homologous recombination. Performing PCR verification on the transformed escherichia coli bacterial liquid, extracting target plasmid, performing sequencing verification, verifying that the transformed agrobacterium is competent by a successfully-compared plasmid electrotransformation method, performing PCR on the transformed bacterial liquid with strips, and performing volume culture; extracting plasmid sequencing verification (final vector map is shown in figure 3-B), verifying that the successful bacterial liquid is preserved into bacterial and preserving the mother liquid for standby at 4 ℃, culturing agrobacterium to carry out tobacco transient transformation, and after verifying promoter activity, continuously culturing agrobacterium to dip flower and transform arabidopsis; screening positive plants by using herbicide: the arabidopsis is sowed in a matrix, normal plant cultivation is carried out in an incubator, 0.01% of herbicide Basta is sprayed when two small true leaves emerge, three days of continuous spraying are carried out, the positive plant leaves are still dark green after three days of continuous cultivation, the positive plant leaves grow normally, and the positive plant leaves are moved to a new matrix for continuous cultivation.

(4) GUS dye liquor base solution: analytical balance weigh 0.78g NaH ₂ PO ₄ ·2H ₂ O，0.71g Na ₂ HPO ₄ ，16.5g K ₃ [Fe(CN) ₆ ]，21.9g K ₄ [Fe(CN) ₆ ]·3H ₂ O was dissolved in 50ml of sterile water, 100. Mu.l Triton-100 and 2ml of 0.5M EDTA at pH=8.0 were added, and the sterile water was made up to 88ml.

GUS dye liquor working solution: 7.04ml of base solution, 800. Mu.l of formaldehyde, 160. Mu.l of X-gluc mother liquor (100 mg of X-gluc in 2ml of dimethylformamide).

(5) Histochemical staining: and (3) taking roots, stems, leaves, flowers, horns and young plants of the positive transformation arabidopsis plants, carrying out histochemical staining, soaking in GUS (GUS dye liquor) working solution, dyeing at 37 ℃ for 48h, rinsing with alcohol, decoloring for 2-3d, and continuously replacing alcohol until the leaves are cleaned off in a green way. And a photograph was taken under the light of a fluorescence microscope Bai Chang.

The results show that: histochemical staining showed that the AT3G22970 promoter was not expressed in young plants in cotyledonary stage, and that in mature plants, strong expression was found in leaf surface, hypocotyl, root, etc., and weak expression was found in anther and pod basal part (FIG. 8).

Arabidopsis thaliana is infected by plasmodiophora brassicae, and hypocotyls and main roots of severe cases are enlarged, so that the potential of the enlargement of the hypocotyls is even higher. The mutant material showed a smaller expansion of the hypocotyl than that of the wild type, and the expression characteristics shown by the results of the promoter analysis were consistent with those of the disease sites obtained in example 5.

TABLE 5 promoter amplification and fusion vector detection primers

Example 7 mutant intraspecific pathogen observation

Frozen section samples were fixed and embedded: fixing 4% paraformaldehyde solution; the material (root tissue of 21d after infection with plasmodiophora radicle removed) was transferred into 30% sucrose solution and treated overnight; the mixture was shifted into 30% sucrose/oct=1:1 (v/v) for 1h; replacing new pure OCT for more than 12 hours, stacking small cubes with tinfoil paper, pouring OCT, taking out the processed material, placing the processed material into the cubes, placing the processed material in the cubes according to the direction, and preserving the processed material in an ultralow temperature refrigerator at-80 ℃ for later use.

The Thermo-Fisher cryomicrotome was kept at-20deg.C for slicing to a thickness of 10 μm. Sealing and observing: the slide glass is attached to the slice to be adsorbed, the slide glass with a plurality of slices adsorbed is marked, the slide glass is sealed by 10% glycerol, and the slide glass is observed under the light of a fluorescence microscope Bai Chang, and the picture is taken.

The results show that: compared with wt, the mutant material salk_085849 of AT3G22970 has little in-root pathogen reaching the hypnospores stage. As shown in FIG. 9, the diameter of the section of the wt root is larger, and the cortex in the section is almost 2/3 filled with the pathogen of the plasmodiophora brassicae, and more than half of the cells are filled with dormant spores. The mutant has less pathogenic biomass, only rarely reaches the period of resting spores, and the cell wall of the host cortex is obviously thickened compared with the wild type.

While the foregoing is directed to the preferred embodiments of the present invention, it is evident that many alternatives and modifications are possible and will be apparent to those skilled in the art. Accordingly, all such modifications and improvements made upon the present invention are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Hangzhou Xiao Shanou agricultural (forest) technical popularization center

Hainan Zhejiang University Research Institute

WUXI DIMODE BIOLOGICAL SEED INDUSTRY TECHNOLOGY Co.,Ltd.

<120> Arabidopsis thaliana clubroot disease candidate related gene AT3G22970 and application thereof

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1113

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 1

atgccattta cgatgaagat ccaaccgatt gatatcgatt cttcaccaac cgtagctaga 60

gctgaatcag gaaacaaacc ggtgctcaaa tctcgtctca aacgtttgtt tgatcggccg 120

tttacaaacg tattgagaaa ctcaacaact acaaccaccg agaaaccatt cgttgtcacc 180

ggtggtgaag ttcaatgcgg cggagtagtg acggagttcg agccgagttc tgtttgctta 240

gcgaagatgg tacagaactt cattgaagaa aacaacgaga aacaagctaa atgtggacgt 300

aatcgttgta attgctttaa cggcaacaac gatggttctt ccgatgatga atcagatcta 360

ttcggtggtt caatcgacgg ttgcgacgct tctgatcatc tcaagagttt gattccgtgc 420

acaaccgtcg gagagaggaa tctgttagcc gacgcggcga agattgtaga taagaacaaa 480

tcggtgaaac gaaaagacga tatgaagaag atcgtcaatg aaggactctt atcacttaat 540

tacaattctt caatctgcaa atcaaaatgg gataaatctc cttcgttccc agctggtgaa 600

tacgagtaca tagatgtgat aatcggagaa gaaaggttaa taatcgatgt agatttccga 660

tcagagttcg atatagcgag acaaacgagt ggttacaagg tgttgcttca atctctaccg 720

ttcattttcg tcggaaaatc tgatcggtta agtcagatcg tgtttttgat atcggaggcg 780

gcgaaacaga gtttgaagaa gaaaggaatg ccttttcctc cgtggaggaa agctgagtac 840

atgcgatcta aatggctctc ttcttatacg cgagcttccg ttgttgttgt cgatgagacg 900

gtgacggtga cggatgttac ggcggcggat gcggcggtgg agaaggaggt ggatagtgta 960

gagattgagc tggtttttga ggagaaatgt ttatctccga gagtgattgt taattcttcc 1020

tcctctccaa ccgacggcga tgatgacgtg gcggtggaga gagaagtgaa ggctgtcacc 1080

ggattagctt cactctttaa ggaaaagccc taa 1113

<210> 2

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

cggtgctcaa atctcgtct 19

<210> 3

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atggtttctc ggtggttgt 19

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

ggaactggaa tggtgaaggc tg 22

<210> 5

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

cgattggata cttcagagtg agga 24

<210> 6

<211> 43

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

gagaacacgg gggactctag aatgccattt acgatgaaga tcc 43

<210> 7

<211> 44

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

ggactgacca cccggggatc cgggcttttc cttaaagagt gaag 44

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

ccacgtcttc aaagcaagtg 20

<210> 9

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

ttgtaacgcg ctttcccac 19

<210> 10

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

attttgccga tttcggaac 19

<210> 11

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

atgtcttccg tgaacatcgt c 21

<210> 12

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

cccattttga tttgcagatt g 21

<210> 13

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

acgaattcga gctcggtacc gcatggcaca attttggaca 40

<210> 14

<211> 42

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

ttaccctcag atctaccatg gagctcacga agaagaagat ct 42

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

gagcgcaacg caattaatgt 20

<210> 16

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

ttgtaacgcg ctttcccac 19

Claims (2)

1. The application of the arabidopsis thaliana clubroot disease candidate gene AT3G22970 in screening clubroot disease-resistant arabidopsis thaliana or regulating the clubroot disease-resistant function of arabidopsis thaliana is characterized in that the nucleotide sequence of the arabidopsis thaliana clubroot disease candidate gene AT3G22970 is shown as SEQ ID No. 1.

2. The application of the biological material containing the arabidopsis thaliana clubroot disease candidate gene AT3G22970 in regulating and controlling the clubroot disease resistance of the arabidopsis thaliana is characterized in that the nucleotide sequence of the arabidopsis thaliana clubroot disease candidate gene AT3G22970 is shown as SEQ ID No. 1.

Images