CN113801947A - SNP (Single nucleotide polymorphism) marker related to growth speed character of basha fish, detection primer and application - Google Patents
SNP (Single nucleotide polymorphism) marker related to growth speed character of basha fish, detection primer and application Download PDFInfo
- Publication number
- CN113801947A CN113801947A CN202111312972.0A CN202111312972A CN113801947A CN 113801947 A CN113801947 A CN 113801947A CN 202111312972 A CN202111312972 A CN 202111312972A CN 113801947 A CN113801947 A CN 113801947A
- Authority
- CN
- China
- Prior art keywords
- snp marker
- basha
- snp
- growth speed
- fish
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application discloses an SNP marker related to the growth speed character of the basha fish, a detection primer and application. The SNP marker related to the growth rate trait of Bassa albo-marginata of the present application is that the 301 th base from the 5' end of the sequence shown in SeqID No.1 is G or T. The SNP marker related to the growth speed character of the basha fish can be used for molecular marker assisted breeding of the growth speed character of the basha fish, the growth speed of the basha fish can be predicted through SNP marker detection, scientific basis is provided for early identification or screening breeding of the growth speed character of the basha fish, and important theoretical and practical guiding significance is achieved for accelerating genetic breeding or improvement process of basha fish varieties. The primer pair for detecting the SNP markers can be used for typing the genotype of the growth speed of the basha fish and detecting the difference of SNP expression.
Description
Technical Field
The application relates to the technical field of breeding of the basha, in particular to an SNP marker related to the growth speed character of the basha, a detection primer and application.
Background
The basha fish belongs to order Clariales and genus Parasilurus, and is an important freshwater aquaculture breed in southeast Asia countries. The Basha fish has strong adaptability to water quality environment and low requirement on culture technology, and is popular in the aquatic product market at present as an increasingly popular culture variety. In 2017, the global production of basha fish was only 110 ten thousand tons. The yield reaches 287 ten thousand tons in 2018. In 2019, the global production of the basha fish can break through 300 ten thousand tons. With the small expansion of the breeding scale of the basha fish, the phenomenon of close breeding of the basha fish species is prominent, so that the phenomena of germplasm degradation, variety mixing and the like are caused, the economic characters of the basha fish seeds are declined, the yield improvement and the market competitiveness of the industry are influenced, and the continuous and healthy development of the basha fish industry is restricted. Therefore, it is imperative to develop improved breeding of Pacific saury.
The traditional fish breeding method completely depends on phenotype, and has the insurmountable obstacles of long period, low efficiency and the like. Molecular breeding, namely molecular marker-assisted selective breeding, refers to the selection of breeding materials by using DNA molecular markers, the comprehensive improvement of important economic characters of breeding species, and is a breeding method organically combining traditional genetic breeding and modern molecular biology. The molecular breeding opens up a new way for fish breeding, and with the development of modern biotechnology, the function of molecular markers in fish breeding is increasingly prominent. In breeding of Pacific fish, it is desired to achieve a greater genetic progress by selection of DNA markers closely related to growth traits and closely linked to quantitative traits to achieve the goal of early seed selection and improvement of breeding accuracy.
However, molecular markers related to growth traits that can be effectively used for breeding of Pacific carps at the present stage are still to be explored.
Disclosure of Invention
The application aims to provide a novel SNP marker related to the growth speed character of the basha fish, a detection primer and application.
In order to achieve the purpose, the following technical scheme is adopted in the application:
one aspect of the present application discloses an SNP marker associated with the growth rate trait of Baccharis sanderi, wherein the base 301 from the 5' end of the sequence shown in Seq ID No.1 is G or T.
The research of the application finds that the SNP marker is closely linked with the growth speed character of the basha, and the genotype of the SNP marker directly influences the growth speed of the basha. In particular, studies of the present application have shown that the SNP marker is a growth rate in individuals with the GT genotype higher than that of individuals with the TT or GG genotype.
It should be noted that, the inventor of the present application found that the body weight of the basha with heterozygous GT genotype at the SNP site of the present application is significantly higher than that of the basha with homozygous TT genotype; because the basha fishes used for research are individuals of the same batch and the same age, the growth environment and the growth time are the same; thus, an individual with the SNP marker of the present application as GT genotype may be considered to have a higher growth rate than individuals with TT or GG genotypes. That is, by detecting the genotype of the above-mentioned SNP site of the Pacific saury, the growth rate thereof can be efficiently determined. Specifically, as described above, the weight of the basha fish with the heterozygous GT at the SNP site is significantly higher than that of the basha fish with the homozygous TT at the SNP site, for example, when the genotype of the SNP site is GT, it can be determined that the basha fish to be detected belongs to an individual with a fast growth rate. Therefore, the inventor determines that the SNP marker of the application is closely related to the growth rate of the basha, and can be effectively used for molecular marker assisted breeding of the basha. And then the growth speed can be selected according to the actual breeding requirement to carry out early selection on the breeding material of the basha, the breeding efficiency and accuracy can be further effectively improved, the genetic level of a breeding population of the basha is improved, and therefore the excellent variety of the basha can be accurately and efficiently bred. In addition, according to some embodiments of the present application, the molecular marker-assisted breeding of the barcoded fish using the SNP marker of the present application has the advantages of early screening, time saving, low cost and high accuracy.
The other side of the application discloses a primer pair for detecting the SNP marker of the application, wherein an upstream primer of the primer pair is a sequence shown by Seq ID No.2, and a downstream primer of the primer pair is a sequence shown by Seq ID No. 3;
Seq ID No.2：5’-CTCCTTGTGTGCGTCCTGGTGTGTCTAA-3’
Seq ID No.3：5’-AAAACATTGCTGTTTGTTATTTAAAA-3’。
it should be noted that, according to the embodiments of the present application, the primer pair of the present application can be used to effectively perform PCR amplification on the fragment of the pausamys japonicas to be detected where the SNP marker related to the growth rate is located, so that the detection of the SNP marker can be effectively realized through sequencing, the genotype of the SNP marker site of the pausamys japonicas to be detected is determined, and further, the growth rate of the pausamys japonicas to be detected can be effectively determined. Specifically, the growth speed of the basha fish with the genotype of heterozygous GT at the SNP marker locus is obviously higher than that of the basha fish with the genotype of homozygous TT or GG at the SNP marker locus, for example, when the genotype of the SNP marker locus is GT, the individual with high growth speed of the to-be-detected basha fish can be determined. Therefore, the primer pair for detecting the SNP marker of the invention can be effectively used for molecular marker assisted breeding of the basha, and further can assist in early breeding of fine varieties of the basha in a short time, at low cost and with high accuracy.
The other side of the application discloses a kit for detecting the SNP marker of the application, and the kit comprises the primer pair of the application.
Preferably, the kit of the present application further comprises reagents for PCR amplification.
It should be noted that, according to the embodiments of the present application, the primer pair included in the kit of the present application can effectively implement the polymorphism detection of the SNP marker related to the growth rate of the pakah under test, determine the genotype of the SNP marker site of the pakah under test, and further can effectively determine the growth rate of the pakah under test. Specifically, the growth speed of the basha fish with the genotype of heterozygous GT at the SNP marker locus is obviously higher than that of the basha fish with the genotype of homozygous TT or GG at the SNP marker locus, for example, when the genotype of the SNP marker locus is GT, the basha fish to be detected can be determined to belong to an individual with high growth speed. Therefore, the kit for detecting the SNP marker of the application can be effectively used for molecular marker assisted breeding of the basha, and further can assist in early breeding of fine varieties of the basha in a short time, at low cost and with high accuracy.
The application also discloses a method for detecting the SNP marker, which comprises the steps of carrying out PCR amplification on the genomic DNA of the millet to be detected by adopting the primer pair or the kit, and obtaining the base condition of the SNP marker according to the sequencing result of the PCR amplification product.
The application also discloses a method for predicting the growth speed of the basha, which comprises the steps of obtaining the base condition of the SNP marker of the object to be detected, and predicting the growth speed of the basha according to the base condition of the SNP marker.
It should be noted that the SNP sites of the present application are closely related to the growth rate of basha, and therefore, the growth rate of basha can be effectively predicted according to the base condition of the SNP markers of the present application. According to the embodiment of the application, the method determines the growth speed of the basha to be detected by detecting the SNP marker of the application on the basha to be detected. Specifically, the basha to be detected may be subjected to PCR amplification and sequencing by using a reagent that can be used for detecting the SNP marker related to the growth rate of the basha of the present application, for example, a primer pair of the present application or a kit containing the primer pair, so as to detect and determine the genotype of the SNP marker of the basha to be detected, and further, the growth rate of the basha to be detected can be effectively determined based on the obtained genotype. Specifically, the growth rate of the basha fish with the genotype of heterozygous GT at the SNP marker locus is significantly higher than that of the basha fish with the genotype of homozygous TT or GG at the SNP marker locus, for example, when the genotype of the SNP marker locus is GT, the to-be-detected basha fish belongs to an individual with a high growth rate. Therefore, the method for detecting the growth speed of the basha can quickly, efficiently and accurately detect the growth speed of the basha, and can be effectively used for molecular marker-assisted breeding of the basha, so that the method can assist in early-stage breeding of fine varieties of the basha in a short time, at low cost and with high accuracy.
Preferably, in the method for predicting the growth rate of the basha fish, the obtaining of the base condition of the SNP marker of the subject to be detected specifically includes performing PCR amplification on the genomic DNA of the subject to be predicted by using the primer pair of the present application or the kit of the present application, and obtaining the base condition of the SNP marker of the subject to be detected by using the sequencing result of the PCR amplification product.
Preferably, in the method for predicting the growth rate of the basha, the growth rate of the basha is predicted according to the base condition of the SNP marker, and specifically, when the SNP marker is a GT genotype, an individual with a higher growth rate of the object to be detected than other genotypes is predicted.
It should be noted that the method for detecting the growth rate of the basha fish of the present application may further have the following additional technical features:
according to embodiments of the present application, the method of performing SNP marker detection on the pausamystus to be detected is not particularly limited. SNP detection can be realized by technologies such as sequencing, single strand conformation polymorphism polymerase chain reaction (PCR-SSCP), restriction fragment length polymorphism polymerase chain reaction (PCR-restriction fragment length polymorphism, PCR-RFLP), time-of-flight mass spectrometry and the like. The sequencing is a detection technology with highest accuracy, strong flexibility, large flux and short detection period. Only one pair of primers is designed on both sides of the SNP locus to amplify a product of 200-1000bp, and then the genotype of the SNP locus can be directly detected by sequencing. Therefore, the method for sequencing is adopted for SNP marker detection. According to some specific examples of the present application, the determining the growth rate of the basha to be detected by performing the detection of the SNP marker of the present application on the basha to be detected further comprises: extracting the genome DNA of the brown sandfish to be detected; carrying out PCR amplification on the genomic DNA of the basha fish to be detected by using the primer pair so as to obtain a PCR amplification product; sequencing the PCR amplification product so as to obtain a sequencing result; determining the genotype of the SNP marker of the application of the Basha fish to be detected based on the sequencing result; and determining the growth speed of the Baker to be detected based on the genotype of the SNP marker of the Baker to be detected. Therefore, the efficiency of detecting the growth speed of the basha fish can be effectively improved.
According to the embodiments of the present application, the method for extracting the genomic DNA of the basha fish to be tested is not particularly limited, and may be performed using any known genomic DNA extraction method or kit. According to some specific examples of the present application, the genomic DNA of the basha to be tested was extracted using a conventional phenol chloroform method. Therefore, the genomic DNA with good quality and high purity can be effectively obtained, and the subsequent steps can be conveniently carried out.
According to the embodiment of the present application, the conditions for performing PCR amplification on the genomic DNA of the basha to be tested are not particularly limited. According to some specific examples of the present invention, the amplification system of the PCR amplification is 25 μ L: 1 mu L of template DNA with the concentration of 50-100 ng/mu L, 1 mu L of each of the upstream and downstream primers shown in SEQ ID NO.2 and SEQ ID NO.3 with the concentration of 10 pmol/mu L, 2.0 mu L of dNTPs mix with the concentration of 10mmol/L, 0.125 mu L of Taq DNA polymerase with the concentration of 5U/mu L, 2.5 mu L of 10 XPCR reaction buffer solution and the balance of double distilled water; the reaction conditions for the PCR amplification are as follows: 5 minutes at 94 ℃; 30 cycles of 94 ℃ for 30 seconds, 53 ℃ for 30 seconds, 72 ℃ for 30 seconds; 5 minutes at 72 ℃. Therefore, the fragment where the SNP marker is located can be rapidly, efficiently and accurately amplified to obtain a target amplification product, and the subsequent steps can be conveniently carried out.
According to the embodiments of the present application, the method of sequencing the PCR amplification product is not particularly limited as long as the sequence of the PCR amplification product, i.e., the fragment where the SNP marker is located, can be efficiently obtained. According to some specific examples of the present application, the PCR amplification product may be sequenced using at least one selected from the group consisting of hipseq and single molecule sequencing methods. Therefore, the sequencing result can be obtained quickly, efficiently and accurately in high flux.
According to the embodiment of the application, based on the sequencing result, by comparing the reference genome sequence of the basha, the genotype of the SNP marker of the to-be-detected basha can be effectively determined to be TT, GG or GT.
According to embodiments of the present application, the growth rate of the subject with the SNP markers of the present application is significantly higher than that of the subjects with the TT or GG genotypes. That is, the SNP marker of the present application is closely related to the growth rate of the Pacific saury. Therefore, the growth speed, namely the growth speed character of the Baker to be detected can be accurately and effectively determined based on the determined genotype of the SNP marker of the Baker to be detected, for example, when the genotype of the SNP locus is GT, the Baker to be detected belongs to an individual with a high growth speed. Furthermore, the method can be effectively used for molecular marker assisted breeding of the basha, so that the method can assist in early breeding of fine varieties of the basha in a short time, at low cost and with high accuracy.
It should be noted that the SNP marker related to the growth rate of basha fish and the application thereof of the present application have the following advantages:
(1) the SNP marker provided by the application is not limited by the age, sex and the like of the Pacific saury, can be used for early breeding of the Pacific saury, and can remarkably promote the breeding process of the Pacific saury;
(2) the method for detecting the 301 th SNP site from the 5' end of the basha fish as shown in SEQ ID NO.1 is accurate, reliable and convenient to operate;
(3) the detection of the 301 th SNP site from the 5' end of the basha as shown in SEQ ID NO.1 provides scientific basis for the marker-assisted selection of the growth traits of the basha.
The application further discloses application of the SNP marker, the primer pair or the kit in prediction of the growth speed of the Bassa, early identification of the growth speed of the Bassa or molecular assisted screening breeding related to the growth speed character of the Bassa.
Due to the adoption of the technical scheme, the beneficial effects of the application are as follows:
the SNP marker related to the growth speed character of the basha fish can be used for molecular marker assisted breeding of the growth speed character of the basha fish, the growth speed of the basha fish can be predicted through SNP marker detection, scientific basis is provided for early identification or screening breeding of the growth speed character of the basha fish, and important theoretical and practical guiding significance is achieved for accelerating genetic breeding or improvement process of basha fish varieties. The primer pair for detecting the SNP markers can be used for typing the genotypes related to the growth speed of the basha fish and detecting the difference of SNP expression.
Drawings
FIG. 1 is an electrophoretogram of genomic DNA of Baccharis sandra in the present example, wherein the first lane is lane M, and the remaining lanes are the result of electrophoresis of genomic DNA of each individual Baccharis sandra.
Detailed Description
The present application is described in further detail below with reference to specific embodiments and the attached drawings. The following examples are intended to be illustrative of the present application only and should not be construed as limiting the present application.
Unless otherwise defined, all terms used herein have the same meaning as commonly understood in the art to which this application belongs. The specific techniques or conditions are not specified in the examples and are generally performed according to conventional experimental conditions, such as the Molecular cloning handbook, Sambrook et al (Sambrook J & Russell DW, Molecular cloning: a laboratory Manual,2001), or according to the manufacturer's instructions. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.
Example acquisition of SNP marker related to growth speed of Bass Sand
1.1 obtaining of a population of Pacific Saxifraga
The adopted groups are the Pacific carps hatched in a certain Pacific carp breeding field in Hainan Lingshui within 2017, 6 months and 15 days, and within 2017, 8 months and 2 days, 60,000 identical-age fries are transferred to a 10-mu pond for continuous breeding. In 2018, 5, 8 months and 500 individuals are randomly selected from the pond, and fin rays on the back fins of the fish body are cut, cleaned and disinfected by 95 percent ethanol, and then stored at the temperature of-20 ℃ for genome DNA extraction; 500 individuals were weighed in advance before cutting the fin-fin line of the fish.
1.2 Bass salsa genomic DNA extraction
The test adopts a conventional phenol chloroform method to extract genome DNA in the fin ray of the Pacific saury, and comprises the following specific steps:
(1) taking 0.3-0.5 g of fin ray into a 1.5mL Eppendorf tube, shearing, and uncovering and drying on a super-clean workbench for 20 min;
(2) after ethanol is basically volatilized, washing the mixture for 1-2 times by using TE buffer solution (10mmol/mL Tris, 1mmol/mL EDTA, SDS 5 percent and pH 8.0), adding 600 mu L of DNA extract (0.001mol/L Tris-Cl, 0.1mol/L EDTA, SDS 5 percent and pH 8.0) and 3 mu L of proteinase k (200mg/mL), digesting the mixture for about 3 hours in a water bath at the temperature of 55 ℃, slightly shaking the centrifugal tube for 1 time every 10min for the first 30min, and digesting the liquid in the tube until the liquid in the tube is clear;
(3) add 600. mu.L of self-prepared phenol in chloroform (phenol: chloroform: isoamyl alcohol 25: 24: 1), invert the tube gently back and forth for 10min, and centrifuge at 12000r for 10 min. Taking the upper aqueous phase, and re-extracting with the phenol chloroform with the same volume until no white precipitate exists between the aqueous phase and the organic phase;
(4) extracting with chloroform for 1 time, taking out supernatant, adding 2 times volume of precooled absolute ethanol to precipitate DNA, reversing and mixing uniformly, standing at 4 ℃ for 30min, centrifuging at 12000r for 10min, washing the precipitate with 70% ethanol, centrifuging, drying, precipitating, and adding 50 mu L of sterile water to dissolve. Storing at 4 deg.C for use or storing at-20 deg.C for a long time.
1.3 construction of simplified genomic sequencing (RAD-seq) library and sequencing to obtain the weight-related SNP marker of the Pacific saury
Based on Hiseq2500 high-throughput sequencing platform, 500 individual DNA samples are sequenced by RAD simplified genome sequencing method, each individual generates about 1G data volume, and 1 × of Bass salsa genome is covered on average. Through sequencing and information analysis, 224,168 SNP markers were obtained from the sequencing results of 500 individuals in this experiment.
According to the sequencing results and weighing results of 500 individuals, data are processed and screened by adopting PLINK software, then GWAS (global warming potential) analysis is carried out by using EMMAX software based on a mixed linear model, and an SNP site which is obviously related to the weight is found from 224,168 SNPs in the test. The SNP site is located at a 301bp site of a sequence shown in SEQ ID NO.1, the site is represented by Y in the sequence shown in SEQ ID NO.1, and the base of the site is G or T. The results show that the weight of the basha fish with the genotype of heterozygous GT at the SNP locus is obviously higher than that of the basha fish with the genotype of homozygous TT or GG.
Example two verification and application of SNP marker related to growth speed of Bass Sand
2.1 extraction of genomic DNA from fin-rays of Pacific Saury to be tested
Selecting 200 newly-selected basha fishes randomly from the basha fish population to be detected in the first embodiment, and extracting genome DNA according to the DNA extraction method in the first embodiment; similarly, the 200-tailed salmonids were weighed prior to cutting the dorsal fin line of the fish.
2.2 amplification of nucleotide fragments containing SNP sites
According to the SNP locus which is obviously related to the body weight and is obtained in the first embodiment, the test designs a primer pair which can specifically amplify the SNP locus, wherein an upstream primer of the primer pair is a sequence shown by Seq ID No.2, and a downstream primer of the primer pair is a sequence shown by Seq ID No. 3;
Seq ID No.2：5’-CTCCTTGTGTGCGTCCTGGTGTGTCTAA-3’
Seq ID No.3：5’-AAAACATTGCTGTTTGTTATTTAAAA-3’。
and performing PCR amplification on the extracted genomic DNA of the 200-tailed sardine by using the designed primer pair. The PCR reaction system was 25. mu.L, and included: mu.L of 50-100 ng/. mu.L template DNA, 1. mu.L of each of 10 pmol/. mu.L upstream and downstream primers, 2.0. mu.L of 10mmol/L dNTPs mix, 0.125. mu.L of 5U/. mu.L Taq DNA polymerase, 2.5. mu.L 10 XPCR reaction buffer, and the balance of double distilled water. The PCR reaction conditions are as follows: 5 minutes at 94 ℃; 30 cycles of 94 ℃ for 30 seconds, 53 ℃ for 30 seconds, 72 ℃ for 30 seconds; 5 minutes at 72 ℃.
The PCR amplification product was stored at 4 ℃. A portion of each PCR amplification product was subjected to 1% agarose gel electrophoresis, and the results are shown in FIG. 1. The results in FIG. 1 show that the designed primer pair can amplify target fragments corresponding to expectations for genomic DNA of Baccharis sanderi.
2.3 sequencing and identification of SNP site genotypes
And (3) performing one-way sequencing on the PCR amplification product of the genome DNA of the 200-tailed salmonidae obtained in the step (1) on an ABI3730 sequencer, and identifying the genotype of the SNP locus which is obviously related to the body weight and is obtained in the first embodiment.
The sequencing result shows that the sequencing result of the PCR amplification product of the genome DNA of 200-tailed salmonids is the sequence shown in Seq ID No.1,
Seq ID No.1：
CTCCTTGTGTGCGTCCTGGTGTGTCTAAGATTTTTATACAGACGTGATGCTAGAAAATAAATATTTAATCACAAACCTCTGATTAGGACAAGACTAGCTGATTCAGGCTCACGTTATTATCCCAGAACTGCTGATCAGTGCAGCCAAACACCATGAAATAATTTTCAAAAACCTGGTCTTAGTGATATTTCTTCTCCAAACACACCGTTTTTCATCCATCCACAGCAATTTGCCAACAATTCGAGGTTATTTATTTATTTATTAAAGAACATTATCTGTTTATAGTTATGCTTAATGTTGYAGGCCAACCACAAAACTAATCAGTTTCTGTTCTCACTTACTATAAACAGTTGTTCCATCACCAGCCTCTTTCTTTTCTCTTTTAAAGTTAATAAGACAAAAAAAAACGTAGCTTGTACCGATACCAAGTAACCGCAAAACGCAAACTCCGTTGTGAAGACTTTACCAGGTTGAAAATGATGATGCTGGAGACTCCTTCCATAAATGTTAAATAAATGATTACAGAAATTATTAAATTACAGAAACCATCAGCGTATCAACAATTGCATTAACCTTTTTAAATAACAAACAGCAATGTTTT。
wherein, the 301 th base from the 5' end is a degenerate base Y, and Y represents G or T; that is, the site is the SNP site detected in the test.
The weight of individual Saury at 200 tails and the genotype of its SNP site in this experiment are shown in Table 1.
TABLE 1200 SNP site genotypes and weights of individuals
2.4 correlation analysis of SNP site genotype and growth Rate
Based on the results in Table 1, the correlation between the genotype of SNP site and growth rate was analyzed by linear simulation using the SAS9.0 software Mixed program, wherein the phenotype value was represented by the individual body weight in the analysis, and the model used was as follows:
Yijk＝μ+Gi+aj+eijk。
wherein, YijkIs the individual body weight value, mu population body weight mean value, GiIs a genotype effect vector, ajIs a micro-effective multi-gene vector, eijkIs a random residual effect vector.
The results of correlation analysis of the genotype of SNP sites with growth rate are shown in Table 2 below.
TABLE 2 genotype frequency at SNP site and correlation analysis with body weight
As is clear from the results shown in Table 2, the weight average values of the GT-heterozygous individuals were larger than those of TT-homozygous individuals and GG-homozygous individuals. The results of the correlation analysis shown in Table 2 indicate that the mean values of the body weights of individuals with the GT genotype and those with the TT or GG genotype differ by a very significant level (P < 0.01). Under the same growth conditions and time, the weight of the GT genotype individual is obviously higher than that of TT homozygous individuals and GG homozygous individuals, which shows that the 301 th base G or T from the 5' end of the nucleotide sequence shown in SEQ ID NO.1 is obviously related to the growth speed of the Bass acutus and is an SNP marker related to the growth speed character of the Bass acutus; moreover, the growth rate of the GT genotype individual marked by the SNP is obviously higher than that of the TT or GG genotype individual.
In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above do not necessarily refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.
While embodiments of the invention have been shown and described, it will be understood by those of ordinary skill in the art that: various changes, modifications, substitutions and alterations can be made to the embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents.
Sequence listing
<110> optically clear
<120> SNP marker related to growth speed trait of Bass salsa, detection primer and application
<130> 20210817
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 601
<212> DNA
<213> Pangasius bocourti Genome fragment
<400> 1
ctccttgtgt gcgtcctggt gtgtctaaga tttttataca gacgtgatgc tagaaaataa 60
atatttaatc acaaacctct gattaggaca agactagctg attcaggctc acgttattat 120
cccagaactg ctgatcagtg cagccaaaca ccatgaaata attttcaaaa acctggtctt 180
agtgatattt cttctccaaa cacaccgttt ttcatccatc cacagcaatt tgccaacaat 240
tcgaggttat ttatttattt attaaagaac attatctgtt tatagttatg cttaatgttg 300
yaggccaacc acaaaactaa tcagtttctg ttctcactta ctataaacag ttgttccatc 360
accagcctct ttcttttctc ttttaaagtt aataagacaa aaaaaaacgt agcttgtacc 420
gataccaagt aaccgcaaaa cgcaaactcc gttgtgaaga ctttaccagg ttgaaaatga 480
tgatgctgga gactccttcc ataaatgtta aataaatgat tacagaaatt attaaattac 540
agaaaccatc agcgtatcaa caattgcatt aaccttttta aataacaaac agcaatgttt 600
t 601
<210> 2
<211> 28
<212> DNA
<213> Artificial sequence
<400> 2
ctccttgtgt gcgtcctggt gtgtctaa 28
<210> 3
<211> 26
<212> DNA
<213> Artificial sequence
<400> 3
aaaacattgc tgtttgttat ttaaaa 26
Claims (10)
1. An SNP marker associated with the growth rate trait of Pacific fish, characterized by: the SNP marker is G or T at the 301 th base from the 5' end of the sequence shown in Seq ID No. 1.
2. The SNP marker according to claim 1, characterized in that: the SNP marker is an individual with a GT genotype and an individual with a TT or GG genotype, wherein the growth speed of the individual is higher than that of the individual with the TT or GG genotype.
3. A primer set for detecting the SNP marker of claim 1 or 2, comprising: the upstream primer of the primer pair is a sequence shown by Seq ID No.2, and the downstream primer is a sequence shown by Seq ID No. 3;
Seq ID No.2：5’-CTCCTTGTGTGCGTCCTGGTGTGTCTAA-3’
Seq ID No.3：5’-AAAACATTGCTGTTTGTTATTTAAAA-3’。
4. a kit for detecting the SNP marker of claim 1 or 2, comprising: the kit comprises the primer pair of claim 3.
5. The kit of claim 4, wherein: the kit also comprises reagents for PCR amplification.
6. A method for detecting the SNP marker of claim 1 or 2, comprising: the method comprises the steps of carrying out PCR amplification on the genomic DNA of the to-be-detected Bashan shashfish by using the primer pair as claimed in claim 3 or the kit as claimed in claim 4 or 5, and obtaining the base condition of the SNP marker through the sequencing result of the PCR amplification product.
7. A method for predicting the growth rate of a basha fish, which is characterized by comprising the following steps: comprises obtaining the base condition of the SNP marker of claim 1 or 2 of a test object, and predicting the growth speed of the Basha according to the base condition of the SNP marker.
8. The method of claim 7, wherein: specifically, the method for obtaining the base condition of the SNP marker of claim 1 or 2 of the test subject comprises performing PCR amplification on genomic DNA of the prediction subject by using the primer set of claim 3 or the kit of claim 4 or 5, and obtaining the base condition of the SNP marker of claim 1 or 2 of the test subject by sequencing the PCR amplification product.
9. The method of claim 7, wherein: and predicting the growth speed of the basha according to the base condition of the SNP marker, and particularly predicting individuals with the growth speed of the object to be detected higher than that of other genotypes when the SNP marker is a GT genotype.
10. The SNP marker according to claim 1 or 2, the primer pair according to claim 3, or the kit according to claim 4 or 5, for use in the prediction of the growth rate of Bassa, the early identification of the growth rate of Bassa, or the molecular-assisted selection breeding related to the growth rate trait of Bassa.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111312972.0A CN113801947A (en) | 2021-11-08 | 2021-11-08 | SNP (Single nucleotide polymorphism) marker related to growth speed character of basha fish, detection primer and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111312972.0A CN113801947A (en) | 2021-11-08 | 2021-11-08 | SNP (Single nucleotide polymorphism) marker related to growth speed character of basha fish, detection primer and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113801947A true CN113801947A (en) | 2021-12-17 |
Family
ID=78898610
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111312972.0A Withdrawn CN113801947A (en) | 2021-11-08 | 2021-11-08 | SNP (Single nucleotide polymorphism) marker related to growth speed character of basha fish, detection primer and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113801947A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110106281A (en) * | 2019-06-05 | 2019-08-09 | 四川省农业科学院生物技术核技术研究所 | Hexaploid I.trifida genome specific SNP marker primer and application |
-
2021
- 2021-11-08 CN CN202111312972.0A patent/CN113801947A/en not_active Withdrawn
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110106281A (en) * | 2019-06-05 | 2019-08-09 | 四川省农业科学院生物技术核技术研究所 | Hexaploid I.trifida genome specific SNP marker primer and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107217094B (en) | SNP marker related to growth rate of genetically improved farmed tilapia and application thereof | |
| KR101929391B1 (en) | Novel SNP marker for discriminating increasedthe number of nipples of pigs and use thereof | |
| CN106434949A (en) | Acipenser dabryanus microsatellite marker as well as screening method and application of acipenser dabryanus microsatellite molecular marker | |
| CN109182556B (en) | SNP molecular marker related to growth traits of pelteobagrus vachelli and application | |
| CN113881785B (en) | SNP locus primer combination for multi-character breeding of litopenaeus vannamei and application | |
| CN113913533A (en) | SNP molecular marker related to grass carp traits and application thereof | |
| CN106086195A (en) | One SNP marker relevant to the cabrilla speed of growth and application thereof | |
| CN107022608B (en) | SNP marker and application thereof | |
| CN107447000B (en) | SNP molecular marker related to multiple lambs of sheep and application thereof | |
| CN109371146A (en) | SNP marker, primer pair, detection kit and its application of the more thoracic vertebrae number characters of sheep | |
| CN109182557B (en) | SNP molecular marker for identifying low dissolved oxygen tolerance and fullness of pelteobagrus vachelli and application thereof | |
| Sabir et al. | Applying molecular tools for improving livestock performance: From DNA markers to next generation sequencing technologies | |
| CN111254204A (en) | SNP (Single nucleotide polymorphism) marker related to growth speed of basha fish and application thereof | |
| CN113801947A (en) | SNP (Single nucleotide polymorphism) marker related to growth speed character of basha fish, detection primer and application | |
| CN106048028A (en) | Grouper-growth-rate-related SNP (single-nucleotide polymorphism) marker and application thereof | |
| CN107475414B (en) | Method for screening parent oysters with high glycogen content | |
| CN108411007A (en) | SNP marker and its application | |
| CN107354234B (en) | Method for screening parent oysters with high glycogen content and related primer pair thereof | |
| CN113502336B (en) | Siniperca chuatsi hypoxia-resistant character-related SNP molecular marker and application thereof | |
| CN111378765B (en) | SNP (Single nucleotide polymorphism) marker of fast-growing grass carp individual and application of SNP marker | |
| CN114262741A (en) | SNP molecular marker related to disease resistance traits of silurus meridionalis and application thereof | |
| CN105603097B (en) | Microsatellite marker primer for identifying pinctada fucata microsatellite families as well as identification method and application | |
| CN112210607B (en) | Molecular marker related to buffalo white hair phenotype and application thereof | |
| KR102001528B1 (en) | Gene marker for discrimination of Korean Native pig and use thereof | |
| CN113215284A (en) | SNP (Single nucleotide polymorphism) marker related to growth speed of leiocassis longirostris and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20211217 |
|
| WW01 | Invention patent application withdrawn after publication |