CN113789334A - Application of HY5 gene in regulation and control of plant resistance to pest and disease damage - Google Patents

Abstract

The invention discloses an application of HY5 gene in regulation and control of plant resistance to pest and disease damage, and belongs to the technical field of biology. The HY5 gene coding sequence is shown in SEQ ID NO.1 or has at least 70% homology with the sequence shown in SEQ ID NO.1 and the encoded protein is functionally equivalent. The invention discloses the regulation and control effect of the HY5 gene in the resistance of plants to soil-borne diseases and pests, particularly root-knot nematodes for the first time, analyzes the response mechanism of plants for preventing the root-knot nematodes, provides a more perfect theoretical basis for comprehensively utilizing physiological, biochemical, environmental regulation and control and other methods to improve the resistance of the plants to the root-knot nematodes, and has very important practical values in the aspects of researching and developing environment-friendly efficient root-knot nematode prevention and control technologies, reducing pesticide use, guaranteeing food safety and the like.

Description

Application of HY5 gene in regulation and control of plant resistance to pest and disease damage

Technical Field

The invention relates to the technical field of biology, in particular to application of an HY5 gene in regulation and control of plant resistance to pest and disease damage stress, especially to root-knot nematodes.

Background

In recent years, the facility vegetable industry in China develops rapidly, however, successive cropping obstacles are frequently caused by the increase of the multiple cropping index of facilities, and the successive cropping obstacles become the bottleneck of the sustainable development of the vegetable industry. Soil-borne diseases and insect pests are important factors causing continuous cropping obstacles, wherein root-knot nematodes are difficult to control in production due to the characteristics of short life history, flexible breeding mode and the like, and cause great economic loss on the development of facility vegetables.

Root-knot nematodes harm the roots of plants, cause host cells to be diseased, form root knots, and cause the reduction of the water and nutrient absorption capacity of the plants, resulting in slow growth of overground parts, low yield and early death. At present, more than 90 kinds of Root-Knot Nematodes are reported worldwide, and according to statistics, the most serious of the Root-Knot Nematodes are southern Root-Knot Nematodes (melodogyne incognita), Meloidogyne javanica (melodogyne japonica), peanut Root-Knot Nematodes (melodogyne arenaria) and northern Root-Knot Nematodes (melodogyne hapla)4 kinds [ Moens M and the like, "melodogyne species-a direct group of novel and animal plants," Root-Knot Nematodes, 2009, 1, 1-17], wherein the southern Root-Knot Nematodes are the most parasitic Nematodes in China.

Tomato (Solanum lycopersicum L.) is one of the solanaceous vegetables which are consumed in the largest amount in the world, has a wide planting range and plays an important role in facility vegetables. With the continuous expansion of the protected cultivation area of tomatoes in China, soil-borne diseases caused by continuous cropping production become increasingly serious, and particularly, tomatoes are highly sensitive to root-knot nematodes. At present, in the production of facility tomatoes, measures such as agriculture, chemistry, physics, biology and the like are comprehensively applied to prevent and treat root-knot nematodes, but the harm of the root-knot nematodes cannot be fundamentally limited.

Based on the method, the resistance mechanism of the root-knot nematode is analyzed, and the resistance gene is discovered, so that the method has important scientific and practical significance for research and development of green efficient prevention and control technology and the like.

In response to infestation by parasitic pathogens, plants have evolved two levels of pathogen recognition mechanisms to trigger a corresponding immune response. First, pathogen-associated molecular pattern-triggered immune responses (PTI), which are related Molecular Pattern Substances (PAMPs) on the surface of pathogens, stimulate Pattern Recognition Receptors (PRRs) on plant cell membranes to induce defense responses in Plants [ Zipfel and Felix, "Plants and animals? "Curropin Plant Biol, 2005, 8, 353-. Ascarosides are the only nematode-Associated Molecular Pattern Substances (NAMPs) discovered so far, wherein ascr #18 is the most abundant ascaroside secreted by root-knot nematodes [ Jeong PY et al, "Chemical structure and biological activity of the Caenorhabditis elegans dauer-indicating hormone." Nature, 2005, 433, 541-545], which can successfully activate the immune response of tomatoes, however, ascr #18 is difficult to artificially synthesize, is high in cost, and is not effectively popularized in agricultural production.

Second, the immune response (ETI) triggered by effector means that the resistance protein R protein in plant cells recognizes the effector protein secreted by pathogens, specifically stimulating the defense response of plants. The R protein coding gene for synthesizing and resisting root-knot nematodes in tomato is Mi-1[ Vos P et al, "The tomato Mi-1gene conjugates resistance to root-knot nematodes and potato aphids," Nature Biotechnology, 1999, 16(13), 1365-.

Therefore, the method defines how the host plant senses and responds to the root-knot nematode infection, clarifies the signal transduction path of the host plant and has important theoretical value for understanding the immune mechanism of the plant for resisting the root-knot nematode.

Plant hormones are low-dose and highly efficient small molecular substances, and they play an important role in coping with environmental stress of plants. Among them, Jasmonic Acid (JA) is recognized as having a very critical role in plants against biotic stress. JA is synthesized via a multi-step enzymatic reaction: alpha-linolenic acid in chloroplasts is catalyzed by various enzymes such as allene oxide cyclase encoded by AOC (allene oxide cyclase) gene to generate 12-oxo-plant dienoic acid (OPDA), and then the OPDA is transferred to peroxisome to continue the synthesis of the latter half, and finally JA is formed. JA is coupled with isoleucine (Ile) to form the complex JA-Ile, which is considered the most biologically active JA compound [ Wasternack and Song, "Jasmonats: biosynthes, metablisisms, and signaling byprotens activating and repressing transcription." Journal of Experimental Botany, 2017, 68(6), 1303-1321 ]. Although transduction pathways for JA signals have been extensively studied in the field of plant diseases and insect pests, the regulatory mechanisms of plant JA synthesis induced by root knot nematode infestation have yet to be further explored.

Light is not only an energy source for plant photosynthesis, but also an important signal source involved in plant stress response. In the optical signal regulation network of plants, HY5(long hypocotyl 5) is a core factor located at the downstream of a light receptor, is a transcription factor with a leucine zipper (bZIP) structure domain at the C terminal, can regulate and control the growth and development processes of hypocotyl elongation, circadian rhythm, mineral element transportation and the like of plants, and also participates in adverse environment responses of plants such as high light stress, heavy metal stress, high and low temperature stress and the like in a hormone-dependent manner. However, no research has been reported on the role of the HY5 gene in the field of plant diseases and insect pests.

Disclosure of Invention

The invention aims to discover resistance genes participating in plant disease and insect pest stress resistance, particularly root-knot nematodes in plants, and provides a theoretical basis for researching the molecular mechanism of plants for resisting the root-knot nematodes.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention provides application of an HY5 gene in regulation and control of plant disease and pest stress resistance, wherein the coding sequence of the HY5 gene is shown as SEQ ID No.1 or has at least 70% homology with the sequence shown as SEQ ID No.1, and the coded proteins are functionally equivalent.

Furthermore, the HY5 gene can improve the resistance of plants to diseases and insect pests by improving the content of plant resistance hormones.

The resistant hormone is jasmonic acid.

The research of the invention shows that the protein coded by HY5 gene can be directly combined with special elements on promoters of Jasmonic Acid (JA) synthesis related genes AOC (allene oxide cyclase) to regulate and control the synthesis of JA. Allene oxide cyclase coded by the AOC gene is a key enzyme synthesized by JA, and jasmonic acid plays an important role in resisting biotic stress of plants. Therefore, HY5 gene plays an important role in plant resistance to biotic stress.

Further, the application includes: by using a biotechnology method, HY5 gene in plants is up-regulated and expressed, and the resistance to diseases and insect pests is improved.

Further, the plant is tomato.

Further, the plant diseases and insect pests are root-knot nematodes.

The invention carries out sequence analysis (http:// solgenomics. net /) on the whole DNA length of tomato SlHY5 gene (Solyc08g061130) and designs specific guide RNA (single guide RNA, sgRNA). Constructing a recombinant expression vector containing sgRNA and Cas9 protein, then transforming the recombinant expression vector into tomato cotyledons in an agrobacterium infection mode, carrying out tissue culture, and screening to obtain a tomato hy5 deletion mutant plant for editing the SlHY5 gene at a fixed point; then, the hy5 deletion mutant plant is inoculated with root-knot nematodes, and the disease condition of the plant after being inoculated with the root-knot nematodes is observed. Researches show that after the tomato SlHY5 gene is mutated, the number of root knots is obviously increased; the level of resistant hormones in the hy5 deletion mutant was significantly reduced compared to wild type tomato (WT). Therefore, the tomato SlHY5 gene is beneficial to improving the resistance of tomatoes to root-knot nematodes.

The nucleotide sequence of the protein coding region of the SlHY5 gene is shown as SEQ ID NO.1, and the length is 477 bp; the protein coded by the gene consists of 158 amino acid residues, and the sequence of the protein is shown as SEQ ID NO. 2.

The protein coded by the SlHY5 gene regulates the transcription of JA synthesis related gene AOC, and further, the nucleotide sequence of the promoter of the AOC gene is shown as SEQ ID No. 3.

The invention has the following beneficial effects:

the invention discloses the regulation and control effect of the HY5 gene in the resistance of plants to plant diseases and insect pests, particularly root-knot nematodes, analyzes the response mechanism of plants for defending the root-knot nematodes, provides a more perfect theoretical basis for comprehensively utilizing methods such as physiological and biochemical methods, environmental regulation and control and the like to improve the resistance of the plants to the root-knot nematodes, and has very important practical values in the aspects of researching and developing environment-friendly efficient root-knot nematode prevention and control technologies, reducing pesticide use, guaranteeing food safety and the like.

Drawings

FIG. 1 shows tomato hy5 gene CRISPR/Cas9 knockout plant T₂Gene editing sites and encoded amino acid changes for generations (homozygous, not containing the exogenous Cas9 fragment).

Compared with wild tomato, the tomato hy5 deletion mutant is subjected to deletion mutation of 5 bases at the position of sgRNA, so that protein translation is terminated early; the gene sequence of wild tomato is represented by SlHY5, the amino acid sequence of wild tomato is represented by SlHY5, the deletion mutant plant is represented by hy5, and the deletion sequence is represented by- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -.

FIG. 2 is an observation of the root knot phenotype of hy5 deletion mutants 4 weeks after inoculation with root knot nematodes.

Wherein (A) is the dyeing result of acid fuchsin at the root of a plant, the lower graph is the enlarged graph of the upper graph, and a ruler Bar is 1 cm; (B) counting the number of root knots; WT represents wild type tomato, hy5 represents deletion mutant plants; statistical analysis of the data was performed by analysis of variance (ANOVA), and the significance of the data differences was analyzed using Tukey test, in which the same letter indicates that the mean value has no significant difference at P < 0.05.

FIG. 3 shows the change of JA content (A) and JA-Ile content (B) of the hy5 deletion mutant 24h after inoculation of Meloidogyne incognita; WT represents wild type tomato and hy5 represents deletion mutant plants. Statistical analysis of the data was performed by analysis of variance (ANOVA), and the significance of the data differences was analyzed using Tukey test, in which the same letter indicates that the mean value has no significant difference at P < 0.05. Mock represents non-inoculated nematodes; RKN stands for inoculated nematodes for 24 h.

FIG. 4 is the analysis of the binding capacity of the transcription factor SlHY5 to a promoter of a gene related to JA synthesis; wherein JA synthesizes the related gene as AOC.

Detailed Description

The invention is further illustrated with reference to the following figures and specific examples. It is to be understood that the following are merely exemplary embodiments of the present invention, and the scope of the present invention is not limited thereto.

Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the experimental materials, reagents and the like used therein are commercially available. The tomato variety used in the examples below is the tomato conventional variety Ailsa Craig.

Example 1 preparation and characterization of tomato hy5 deletion mutant plants

1.1 construction of CRISPR/Cas9 vector containing specific sgRNA

The full-length DNA sequence of SlHY5 found on SGN website (http:// solgenomics. net /) is shown in SEQ ID NO. 4.

The sgRNA sequence of the SlHY5 gene was designed by using CRISPR-P website (http:// cbi. hzau. edu. cn/cgi-bin/CRISPR), and primers were designed.

sgRNA-HY5-F：5’-GATTGGATGATCTCTCACTACTTGA-3’(SEQ ID NO.5)；

sgRNA-HY5-R：5’-AAACTCAAGTAGTGAGAGATCATCC-3’(SEQ ID NO.6)。

The synthesized sgRNA forward and reverse primers were annealed to double-stranded sgRNA containing sticky end linkers by a PCR instrument, and the double-stranded sgRNA was ligated to AtU6-sgRNA-AtUBQ-Cas9 intermediate vector that had been digested with Bbs I by T4 ligase overnight at 16 ℃. The ligation product was heat shocked to transform DH 5. alpha. E.coli competent cells, cultured overnight in LB solid medium containing ampicillin at 37 ℃ and a single colony was picked, and the upstream primer sgRNA-HY 5-F: 5'-GATTGGATGATCTCTCACTACTTGA-3' (SEQ ID NO.5) and a downstream vector primer: 5'-CTACTTATCGTCATCGTCTTTG-3' (SEQ ID NO.7), carrying out PCR verification, carrying out sequencing identification on positive single clones to obtain positive sgRNA-HY5 clone, and extracting plasmids.

Plasmid sgRNA-HY5 and vector pCAMBIA1301 were digested simultaneously with HindIII and EcoRI, respectively, and ligated with T4 ligase at 16 ℃ overnight. The ligation product is thermally shocked to transform DH5 alpha competent cells, the cells are cultured in LB solid medium containing kanamycin at 37 ℃ overnight, monoclonal colonies are picked, PCR verification is carried out, positive clones are identified, and sequencing is carried out. And (3) electrically shocking the positive plasmid with correct sequencing to transform the GV3101 agrobacterium-infected cells to obtain the agrobacterium strain containing the CRISPR/Cas9 vector of the specific sgRNA.

1.2 hy5 deletion mutant plant material preparation and identification

The agrobacterium strain prepared in example 1.1 is transformed into cotyledons of wild tomato Ailsa Craig by using an agrobacterium infection method, and candidate transgenic plants are preliminarily screened by using hygromycin.

Specific primers are designed near the sequence position of sgRNA of the SlHY5 gene to detect the change of target gene sequence, and the detection fragment length is 504 bp.

CRISPR-HY5-F：5’-TCATGTCCCGCTATTTCTTT-3’(SEQ ID NO.8)；

CRISPR-HY5-R：5’-CTTTTGTTTTCTTTGTCAGC-3’(SEQ ID NO.9)；

Sequencing the PCR product, comparing the sequencing result with the SlHY5 gene of wild tomato, detecting whether base mutation exists at the sgRNA position, and screening out T with changed SlHY5 gene₀The generation gene editing plant is named as hy 5.

Mixing the above T₀Planting the plant in a growing room, selfing to obtain T₁Seeds and detecting the gene editing condition, the method is the same as the above method.

Amplification of T by PCR₁In the plant generationThe CRISPR/Cas9 vector sequence of (a).

Cas9 vector pre-primer: 5'-AGCTTCATTCGGAGTTTTTG-3' (SEQ ID NO. 10);

cas9 vector rear primer: 5'-CTACTTATCGTCATCGTCTTTG-3' (SEQ ID NO. 11);

electrophoresis detection was performed after amplification, and no amplification of the Cas9 band was observed. Thereby obtaining a 5-base deleted T without an exogenous Cas9 fragment₁The generation plants and the sequence comparison are shown in FIG. 1.

The exogenous Cas 9-free fragment T₁Inbreeding is carried out on the generation plants to obtain T which does not contain exogenous Cas9 fragments, has sgRNA variation and can be stably inherited₂And (4) generation.

The following experiments of example 2 and example 3 for inoculation of nematodes with T₂And replacing materials.

Example 2 Effect of the tomato SlHY5 Gene on nematode resistance

And (2) carrying out root-knot nematode inoculation treatment on the obtained tomato SlHY5 gene mutant plant, which comprises the following specific steps:

wild type tomato (WT) and mutant plants (hy5) were divided into two groups, one control group and one experimental group.

When the tomatoes grow to four leaves and one heart, the experimental group is inoculated with the root-knot nematode, and the inoculated root-knot nematode is the meloidogyne incognita in the J2 stage.

The culture and inoculation of Meloidogyne incognita comprise the following steps:

(1) pulping diseased roots infected with root-knot nematodes, fully and uniformly mixing with sandy soil, placing in a water culture box with the thickness of 340mm multiplied by 270mm multiplied by 130mm, planting 6 common cultivated tomatoes in each pot, breeding the nematodes in a greenhouse of an agricultural test station of Zhejiang university, and maintaining the room temperature at 22-26 ℃.

(2) Digging the root system with serious disease, slowly washing the sandy soil of the root with clear water, soaking in 0.5% sodium hypochlorite aqueous solution, stirring, sterilizing for 3min, and washing with clear water for several times.

(3) Cutting root into 1cm root segments, and crushing in a mincing machine. The homogenate was passed through 80 mesh, 200 mesh, 325 mesh and 500 mesh sieves in this order, and finally the residue on the 500 mesh sieve was washed in a beaker to obtain an egg suspension.

(4) The collected egg suspension is poured into a square culture dish of 13cm multiplied by 13cm which is paved with 8 layers of absorbent paper evenly, and the culture dish is placed in a constant temperature incubator at 28 ℃ for incubation for 2 to 3 days.

(5) The culture dish was gently rinsed with a wash bottle to rinse the incubated root knot nematodes into the beaker, and the number of nematodes at stage J2 was recorded by observation under a 50-fold optical microscope (BX 61; Olympus Co., Tokyo, Japan).

(6) Inoculating the nematode suspension to the root soil of the plant to be treated, inoculating about 1000 nematodes of J2 stage to each plant, culturing in a phytotron, and watering normally.

Plants were cultivated in plastic cups containing high temperature sterilized river sand and watered with macroelement water soluble fertilizer (Hangzhou Kangcheng agriculture science and technology Co., Ltd.). The growth conditions were: temperature 25 deg.C/20 deg.C (day/night), photoperiod 12h/12h (day/night), luminous flux density 400 μmol^-2s^-1And the humidity is about 75%.

After 4 weeks of nematode treatment, root knot phenotype observations and root knot number statistics were performed.

The root knot phenotype observation adopts an acid fuchsin dyeing method, and the specific method comprises the following steps:

(1) cleaning root system, and bleaching the root system with 1.5-5% sodium hypochlorite solution for 5-10min to remove impurities in the root system which affect dyeing.

(2) Washing the root system with clear water and soaking for 30 min. Pouring off the soaking solution, sucking off water of root system, completely immersing root system with 3.5% acid fuchsin solution, heating to boil and maintaining for 3-5min, standing at room temperature, and cooling.

(3) After cooling, the root system is washed by clear water to remove the redundant pinkish red liquid on the surface.

(4) Adding acid glycerol, heating to boil, and transferring the root system to the acid glycerol at normal temperature.

(5) After 24h of storage in acidic glycerol, root knot phenotype photographing and root knot number counting are carried out.

The specific method for counting the root knots is as follows:

cleaning the tomato root system to be counted, sucking the surface water, weighing, and carefully recording the root knot number of each root. The nematode sensitivity of the plants was evaluated by counting the number of root knots per gram of fresh and heavy root.

The results of root node phenotype observation and root node count statistics are shown in FIG. 2.

Compared with WT, the hy5 mutant plant has obvious root knot phenotype (figure 2A) and significantly increased root knot phenotype (figure 2B), which indicates that the resistance of the plant to the meloidogyne incognita is weakened, and the SlHY5 gene can improve the resistance of the tomato to the meloidogyne incognita.

Example 3 Effect of the tomato SlHY5 Gene on nematode resistance hormones

1. Since JA plays an important role in plant response to biotic stress, JA and JA-Ile content assays were performed after inoculation of root knot nematodes to WT and hy5 mutant plants.

Inoculating root knot nematode for 24h, taking tomato leaf samples, extracting and determining the content of JA and JA-Ile, wherein the specific method comprises the following steps:

(1) grinding 100mg of the liquid nitrogen frozen sample into powder in a sample grinding instrument;

(2) 1mL of chromatographic grade ethyl acetate was added, to which had been added D6-JA (OlChemIm Ltd., Czech) and D6-JA-Ile (QUALITY CONTROL CHEMICALS INC., USA) as internal standards at final concentrations of 10ng/mL and 40ng/mL, respectively. Extracting for 12 hours in a dark place by shaking at the temperature of 4 ℃ and the rpm of 180;

(3) centrifuging at 12000rpm at 4 deg.C for 10min, collecting supernatant, resuspending the precipitate with 1mL chromatographic grade ethyl acetate, keeping out of the sun, and performing shake extraction at 180rpm at 4 deg.C for 1 h;

(4) combine the two supernatants in a 5mL centrifuge tube, N₂Drying; 0.5mL of 70% chromatographic grade methanol (v/v) was added, vortexed thoroughly, and the residue in the centrifuge tube was resuspended, centrifuged at 12000rpm for 10min at 4 ℃;

(5) the supernatant was transferred to a brown glass vial and assayed by HPLC-MS/MS (Agilent Technologies, California, America). The results of JA and JA-Ile content measurement are shown in FIG. 3.

After the root knot nematode is inoculated for 24h, the contents of JA and JA-Ile induced by the root knot nematode in the hy5 deletion mutant are obviously lower than those of wild tomato, which indicates that the SlHY5 gene promotes JA synthesis.

2. The SlHY5 protein is proved to be capable of being specifically combined with a cis-acting element of which the core sequence is ACGT on a gene promoter and has a transcription regulation function. Sequence analysis is carried out on a promoter of a JA synthesis related gene AOC, and the result shows that a special element which can be identified by SlHY5 exists on the gene promoter, and the combination capability of the SlHY5 protein and the special element is detected through an EMSA experiment, wherein the specific method comprises the following steps:

(1) the full-length sequence of the SlHY5 gene was amplified by PCR.

SlHY5 pre-amplification primer:

5’-CGGGATCCATGCAAGAGCAAGCGACGAG-3’(SEQ ID NO.12)；

SlHY5 post amplification primer:

5’-CCCAAGCTTCTACTTCCTCCCTTCCTGTGC-3’(SEQ ID NO.13)；

(2) and carrying out double digestion on the pET-32a vector by using BamH I and Sac I, and connecting the vector with an amplification product by using a homologous recombination technology. The recombinant vector was transformed into E.coli competent BL21(DE3), the recombinant His-HY5 fusion protein was induced using 0.1mM isopropyl- β -D-thiogalactopyranoside and the protein was purified according to the NovagenpET purification system;

(3) primers were designed to synthesize a G-box (CACGTG) containing the AOC promoter and the ACGT sequence in the G-box was mutated to TTTT (CTTTG), the sequences are shown in Table 1. The 3 'End Biotin Labeling of the front primer was carried out by using Biotin 3' End DNA labelling Kit (89818, Pierce, USA), and then annealing was carried out to synthesize a double-stranded probe;

TABLE 1 primers used in gel electrophoresis migration experiments

Primer name	(5’-3’)
		AOC forward primer	GCAGGAGAAACACGTGTTGCCACTTT
AOC reverse primer	AAAGTGGCAACACGTGTTTCTC CTGC
		AOC-mut forward primer	GCAGGAGAAACTTTTGTTGCCACTTT
AOC-mut reverse primer	AAAGTGGCAACAAAAGTTTCTCC TGC

(4) According to the Light Shift Chemimecent EMSA kit (20148, Thermo Fisher Scientific, USA) kit method, 0.5. mu.g of HY5 fusion protein and 2. mu.L of labeled probe were added to 20. mu.L of the reaction system, incubated at 28 ℃ for 30min, and the product was electrophoretically separated on 6% polyacrylamide gel, and photographed by color after trans-membrane, UV cross-linking, blocking and incubation. The results are shown in FIG. 4.

The result of EMSA experiment shows that the SlHY5 protein can be combined with cis-acting element containing ACGT core sequence on AOC promoter, and the SlHY5 protein cannot be combined with probe after ACGT sequence in the element is mutated into TTTT.

Sequence listing

<110> Zhejiang university

Shandong (Linyi) modern agriculture research institute of Zhejiang university

Application of <120> HY5 gene in regulation and control of plant resistance to pest and disease damage

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 477

<212> DNA

<213> tomato (Solanum lycopersicum L.)

<400> 1

atgcaagagc aagcgacgag ttctattgcc gctagttcac taccttcaag tagtgagaga 60

tcatctagtt cagctttaca tcatgaactc aaagaaggta tggagagtga tgatgagatc 120

agaagagtgc cggagatggg cggagaagcg acggggacaa cgtcagcttc tggaagagat 180

ggagtatcgg ccgccggtca agctcaacca tcagctggga ctcaaaggaa gagaggaaga 240

agcccagctg acaaagaaaa caaaaggtta aaaagattgt tgagaaatag agtatcagca 300

caacaagcaa gggagaggaa gaaagcatat ttgatagatc tggaagcaag ggtgaaggaa 360

ttggaaacaa agaatgcaga acttgaagag aggttgtcta ctttgcaaaa tgagaaccaa 420

atgcttagac atatactgaa gaacacaaca gcaggtgcac aggaagggag gaagtag 477

<210> 2

<211> 158

<212> PRT

<213> tomato (Solanum lycopersicum L.)

<400> 2

Met Gln Glu Gln Ala Thr Ser Ser Ile Ala Ala Ser Ser Leu Pro Ser

1 5 10 15

Ser Ser Glu Arg Ser Ser Ser Ser Ala Leu His His Glu Leu Lys Glu

20 25 30

Gly Met Glu Ser Asp Asp Glu Ile Arg Arg Val Pro Glu Met Gly Gly

35 40 45

Glu Ala Thr Gly Thr Thr Ser Ala Ser Gly Arg Asp Gly Val Ser Ala

50 55 60

Ala Gly Gln Ala Gln Pro Ser Ala Gly Thr Gln Arg Lys Arg Gly Arg

65 70 75 80

Ser Pro Ala Asp Lys Glu Asn Lys Arg Leu Lys Arg Leu Leu Arg Asn

85 90 95

Arg Val Ser Ala Gln Gln Ala Arg Glu Arg Lys Lys Ala Tyr Leu Ile

100 105 110

Asp Leu Glu Ala Arg Val Lys Glu Leu Glu Thr Lys Asn Ala Glu Leu

115 120 125

Glu Glu Arg Leu Ser Thr Leu Gln Asn Glu Asn Gln Met Leu Arg His

130 135 140

Ile Leu Lys Asn Thr Thr Ala Gly Ala Gln Glu Gly Arg Lys

145 150 155

<210> 3

<211> 3000

<212> DNA

<213> tomato (Solanum lycopersicum L.)

<400> 3

tgctgcaata atcattatta tgaaatatat ggctgagtat cctcttaggt atggttgaaa 60

ttaggtctta tgctgaagga ggattgccta agtcttgtaa ggagtccacc tcatctcatt 120

aaccactgat gtggactttt gtcattcttt aacaggtatg aacttcacta aattctcttg 180

cttagactcg attgtaatga aaaaatagtg atcactataa tttagacaca aacacatatt 240

gctaactgat ttgtcttgca tttgggcata tatcttggac cagagcaaat taaatggaaa 300

aactgcaaat gatttgctaa attgggagga aaatgagata ttcttgtaag gtataataca 360

tttattggac cctaaatttg gcatcaaatt ttaattttga cctctaattt ttatagtgca 420

caagcacaaa tagacatttt aactatctta catttaaata aataaacaca cgatttgtaa 480

agtcaaagag cgtgaaaggc aaacgctcca acgtatctgt caactagtta aatattttac 540

acgtcaattt tagaactaga aaaaattaaa attaatttta atttatggtt ttagagctcg 600

gagctcattc tttgacagag cttagaggtt tgttgatggc tggcttcttg gtttaggtat 660

ttgtggttgt tgggtctgtc ttcatgggat tttgggggtc atttggctgc tgttttgtgt 720

cttgttcgag ctgctggttg cagcagtttg gtgatgattc tcgccggaga cgacaaatct 780

gatgggtttg gggtcaagta tttggtgggt tcagcgagtt tgaagttcgt tcgcttcatg 840

ggttgtgctt cggtgtggag gaagaagaag aacggttggg caaaatgaat gggttttttg 900

ggttgtcgga gattggacgg aatccggggt ggtagaattg tcatttcagc atttttttct 960

gttgtgagct taaaaaatta ctcctcacgc gcgtagaata cgtgattttc acgcgttttg 1020

acagataaaa atcacgtgct tatttattaa atagtaggat aattaaagtg cgtatttatg 1080

tactatgaaa gttgaagatc aaaattaaaa tttgaagtta aattttgaag tctaatatat 1140

atattatgcc ttcttggaat attgcaagtg aagtattgaa gttttgaaga tgacacccca 1200

ctacatgcaa catttagaga tccctctaac taaagtttca cttcctcttt ttctaattag 1260

ttgttctttt tttttattta ataattttta attacttgtc tattttgata aatcaagaaa 1320

ggataatttc ttttacataa tataattttt taaactttta agttttttta atttatccac 1380

ttcataatta ctaagggtaa aatgataaat tcactatctc aatcattatt ttcgtaataa 1440

atgatgtcaa tttaaaagta gacaaataat tagagacaaa aaaatattta gcaactaaac 1500

aaattacttc aattaaaaaa aaactaacta aaacttggtt agaaattaga attgaaaaaa 1560

gtcgattatt gttatctagt taatatcaaa ccaagtaact tctacgcgag ccaataacct 1620

acatattttt gaattaatct cagaaacaca cttatatttt atcaaggtta tattattccc 1680

ctaaacttat ttattaataa ttttctatct atttttgcgt ggcactattt tttgagctca 1740

acattggttg actttctttt ttaagttagt gtcacgtaga tcgaaacggc atagacaatt 1800

acttataaaa taaattcagg aataataaga tcttaatata gtataagtgt gtttctgaaa 1860

tttcaaacat aagttgagga gataattctg tattttccca aatataaata ataagacctt 1920

ttctacacct tagtttttta aatatttgta attaaccaat tagtttaaag tgctcatgaa 1980

taaaatttaa cataatattt taaacacatt tcttataatt atgagattca aaaggcaaag 2040

taaaaaaatt aaaagatttt attttccttc cctcaaagtt aatcttatct catttttagt 2100

acaaaaagta aataatcttt gtcgaacttt taattgaaga aatattaagt tgcagcacag 2160

acttccaaaa gattaattca tgtaatcttt tgatcttcta agattatttt atcaataaaa 2220

aaaactatta aaaatatcga gcaatttcat ttaaataatt gttatttttt tctctttgct 2280

tcacaagctt atatgtataa tttattttat tgacttctta tattattatt ttgattcatt 2340

tatttcatgg tcataaaatt gaaatgtaac aattaataat aagacaaaaa aaaaactcaa 2400

aatcatattt tatcaatatt tttctttaaa aaaaataata tactcattaa tttaaattac 2460

gttttcagaa actaatttag taaaaataaa aagaacacat taaagagaat tggacggaga 2520

tgtgtgaatt agtattcgaa gggttgaagt cacaacattc aatgtaggct gagccgcaga 2580

gaccaccaat caatagctgc ggcctgcgca ggagaaacac gtgttgccac tttttctcac 2640

attggctatt acattcttgg acaactccaa actatctttg actattcaac ttgtgaaaac 2700

acacaaacta ccatcatcac atctaacacc gtcctctttt aatgaaacct tatttgttaa 2760

aatgacctag agcgatagaa aattttaaaa gctaattttt gaagttgcgt taaattcaga 2820

tataatattt taatatttta tcaaagtcaa gttattggct tcgttggagt tagacacaca 2880

tattttcatt tataagtatt cattgatttg aaaaatgagt tagcttttga gattgagtta 2940

ggttcaaata tcatatttta acacttatac aatataatta aaaataatta tacattaaaa 3000

<210> 4

<211> 3474

<212> DNA

<213> tomato (Solanum lycopersicum L.)

<400> 4

tcatgtcccg ctatttcttt tctgaataaa atacgaaact gtacttttcc cttaatttag 60

tgtttttttc aagtgtagag aaaaatgcaa gagcaagcga cgagttctat tgccgctagt 120

tcactacctt caagtagtga gagatcatct agttcagctt tacatcatga actcaaagaa 180

ggtaatcttt tttaaaaaaa atttaaatcc agctttttaa catttaattt tgacgaattt 240

atggagtaat tttttgaaga atgtgttgtt ttgggttagg tatggttgag attttgaaat 300

agtttttaaa aaacattttg tgtttttttg tgaaggtatg gagagtgatg atgagatcag 360

aagagtgccg gagatgggcg gagaagcgac ggggacaacg tcagcttctg gaagagatgg 420

agtatcggcc gccggtcaag ctcaaccatc agctgggact caaaggaaga gaggaagaag 480

cccagctgac aaagaaaaca aaaggttaaa aaggtaaaaa ccttaaacat catgccacgt 540

aggtgtatct acttgtcaca tgttatgggc ttccacactt tctttttttg gatagcagtg 600

gcattttagt taatattgta tttttttttg gtggggttga aaaagattgt tgagaaatag 660

agtatcagca caacaagcaa gggagaggaa gaaagcatat ttgatagatc tggaagcaag 720

ggtgaaggaa ttggaaacaa agaatgcaga acttgaagag aggttgtcta ctttgcaaaa 780

tgagaaccaa atgcttagac atgtaaacat tcttctctct acttctattt ttgcaataga 840

attgttcatc tatatatcct atatgcttga acgtgtgcca tgtccggtct aattactatt 900

cagatacttc ttccacttac ctctatttct actgaatcca ttcacagcca aactctcacc 960

tccccccgca tttctacatt cgtgcatctt tctcttcaca tatctgaatc tcttcccgca 1020

tcttattctc tttcgaaacc acactcagct tgtttcaact gtcctgattt tattctatat 1080

ctcctagtat atgtgtccac acatccatca caatatcttc atttccacaa ctttcatctt 1140

ttgaacgtga gagtgctcaa ctacatgtac ttgcaaaggc gtattcagga tttcggcaaa 1200

atggatgcac aattacgaat aaaatgcatc ttaaatataa atttgatcaa tttgacttta 1260

aagtttctaa tataaaacca ttaaactttt aaaattgtag gtgcaaaata tataatacta 1320

ctagtttaaa ttttaatgca cacatttgat ttaattatac atataaaata ttttttagga 1380

atttttaatg taatacactt caaaattttt gaaaaaatta aggaaaaaaa aagaagaaaa 1440

attagttaaa acgctaaaag tatataacca ataactactt gtagaggtgc tacttaaaaa 1500

gacaagatag atatctaaga ttttaatttc tatcctcaca gaggtgcacc caatcatcgt 1560

catcatatta ttatacgata ctttaactgt gggttcacac atctatattt aaatattttt 1620

cttaaaatat aacactatta tatttgatct agagatggta gcatgggttc atgtgaaccc 1680

atgacacccc ctctagatat gcccctgtat actcaacccc atacgacata gttggtctaa 1740

ccgtcactat gtagaatttc tctttatgtt ttggtggaac cttcttatca ctagcaactc 1800

agatgcaagt ctctatgtca tacacgttgc accaatacag tgagtgacat cctcgtcaat 1860

caccccattt tcttggataa cggaccaata tacttgaata gagtatagca ccaaaagttg 1920

tggtctattg ttcaatgaag aagttgagag ccatgagatc tcaagttcaa attcaataga 1980

gtaaaagagc tactaggtga ttgtttctgt atgttctagc cttggtgaat atagttacct 2040

ggtatttgat gctggttgga ggtgatgata ggtatctcgg gtaattagtt aaggtgcggg 2100

aaagcagcct taaaaataaa ttagatgaat ggggggatta tccagaaaca atttataagc 2160

tcagtcattt ctttggttta gctcactctt atatcgggct tttgttatgt cccatcaatt 2220

atttattaaa cattgaagac gaggagacaa actatgaatt atcaacaata tgctgtgact 2280

tcagcctcct gaagttacat tagtattatg taatttatgt gcagtagaaa tgtactagcg 2340

tatgaacata gatcaaagca tggaagcttt ctcaccttct atattcccca atatgcatta 2400

tactgcccat catatgtgta cagagcattt aagctgaaca tataatgtat gaatgaagtg 2460

ttcttgtatc ttccatagta tatctggtag cgagagatgt aaagaattgc gtaatcatcc 2520

atgatatatg atgtcagctt tctactctta gttattacct tgtagtaaat ctaagaacta 2580

cgctcatgtt aattgggaag tgtagagatt acttgggtaa aactctcaag gcttgtctgc 2640

atgaacatgt aataccagta accggttcct ataaatttcg accttgagca tgtgttgtat 2700

ctatacacat ctttcagcct gtatttaagt cacaggcgtg gctatttcat attaaccctt 2760

tcttatacac ttcccctctt gccggttaag attggtactt atctagtaga ataactataa 2820

gatgagtctt gctgaaaatc aataaagaca acttagaaat aacaactcta tgtgactatc 2880

agtcaaatct tggatttatc atgattaaac atctaattgt tggaatgcca ttgacctgat 2940

tgacaaaaca tcaactttca tgatttcata ttgcatatcc aatccgccta taagaatctc 3000

caaagaccac acaaaaagga attcaaatgc ttcaatcttt ccatgctgta aatttgcttt 3060

cttcagagat ggccaaaaag aaaacggtgt atatttgggg tttgacttct tttgttataa 3120

tctgcagata ctgaagaaca caacagcagg tgcacaggaa gggaggaagt agacatatga 3180

tcgatcttat gtcgatatgt cagcattctt gtttagatcc tatgtaggca ctgaagagaa 3240

attctcttct ggatttgaga atgcatgcta gtttcgggtg gattgttctg atttgatgca 3300

ttgcatactt gctactctta accgttgtcg gttatatatt atcagcagag agtgaaggat 3360

tgtggctaag ctattcttaa agtcaccagc ctttggtaag ttgcatggac taatcttgga 3420

tgatatatgc tacaattacc tataaccttt gctagcgttc cctagtgagt tgaa 3474

<210> 5

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gattggatga tctctcacta cttga 25

<210> 6

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aaactcaagt agtgagagat catcc 25

<210> 7

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ctacttatcg tcatcgtctt tg 22

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tcatgtcccg ctatttcttt 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cttttgtttt ctttgtcagc 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

agcttcattc ggagtttttg 20

<210> 11

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ctacttatcg tcatcgtctt tg 22

<210> 12

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cgggatccat gcaagagcaa gcgacgag 28

<210> 13

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cccaagcttc tacttcctcc cttcctgtgc 30

Claims (8)

1. The application of the HY5 gene in regulation and control of plant disease and pest stress resistance is characterized in that the HY5 gene coding sequence is shown as SEQ ID No.1 or has at least 70% homology with the sequence shown as SEQ ID No.1 and the coded proteins are functionally equivalent.
2. 2. The use of claim 1, wherein the plant is tomato.
3. 3. The use of claim 2, wherein the HY5 gene encodes a protein having the amino acid sequence shown in SEQ ID No. 2.
4. 4. The use of claim 1 wherein the pest is a root knot nematode.
5. 5. The use of claim 1 wherein the HY5 gene is used to increase plant resistance to pests by increasing the content of plant resistance hormones.
6. 6. The use of claim 5, wherein the resistance hormone is jasmonic acid.
7. 7. The use of claim 6, wherein the HY5 gene encodes a protein capable of binding to the promoter of the gene AOC involved in jasmonic acid synthesis and regulating jasmonic acid synthesis.
8. 8. The use according to claim 7, wherein the nucleotide sequence of the promoter of the AOC gene is as shown in SEQ ID No. 3.

Images