CN105440115A - Eggplant SmHY5 protein and coding gene thereof - Google Patents
Eggplant SmHY5 protein and coding gene thereof Download PDFInfo
- Publication number
- CN105440115A CN105440115A CN201511004882.XA CN201511004882A CN105440115A CN 105440115 A CN105440115 A CN 105440115A CN 201511004882 A CN201511004882 A CN 201511004882A CN 105440115 A CN105440115 A CN 105440115A
- Authority
- CN
- China
- Prior art keywords
- gene
- eggplant
- smhy5
- seqidno
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Analytical Chemistry (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- Nutrition Science (AREA)
- Immunology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an eggplant SmHY5 (Long Hypocotyl 5) gene and functional analysis thereof. The cDNA of the gene has a nucleotide sequence shown by SEQ ID NO.1. The amino acid sequence coded by the gene is shown by SEQ ID NO.2. The gene is expressed in the roots, stems, leaves, flowers, peel and pulp while the expression quantities in the tissues are not significantly different. The invention provides a theoretical basis for improving the plant quality through the gene engineering technology in future and is of a great application value.
Description
Technical field
The invention belongs to biological technical field, relate to the key enzyme in eggplant photo-signal channel and encoding gene thereof, be specifically related to a kind of eggplant SmHY5 (LongHypocotyl5) albumen and encoding gene thereof.
Background technology
HY5 is the transcription factor just regulating and controlling photomorphogenesis be found the earliest, the sequential analysis of protein display of its coding, HY5 belongs to basic leucine type slide fastener (b-ZIP) type transcription factor, it is positioned nucleus, directly can be combined the expression of these genes with the promotor of multiple smooth regulatory gene.Find the research of HY5 protein level, HY5 protein accumulation is subject to the regulation and control of light, and the HY5 albumen major part in the Arabidopsis thaliana Seedlings body grown under continuing dark condition is degraded, and almost can't detect the accumulation of HY5 albumen; And under irradiation condition, HY5 albumen can run-up; The degraded of this HY5 depends on 26S Ubiquitin-proteasome degradation pathway, and regulates and controls the E3 ubiquitin ligase photomorphogenesis negative regulatory factor COP1 just of HY5 degraded.Because COP1 is positioned at nucleus under dark condition, degrade most HY5 albumen in body, and under illumination condition, COP1 transfers to tenuigenin by nucleus, is removed and accumulate in a large number the degraded of HY5, such HY5 just can functionating.
From a lot of plant, clone obtains HY5 gene, as Arabidopis thaliana, grape, apple, corn etc. at present.Eggplant is important vegetable crop, but correlative study is relatively delayed.At present, do not have and anyly to report with the pertinent literature of eggplant HY5 gene and proteins encoded thereof.
Summary of the invention
For defect of the prior art, the object of the invention is to the blank filling up eggplant HY5 gene.The invention provides cDNA and the aminoacid sequence of a kind of eggplant HY5; Further, the invention provides the expression pattern of eggplant SmHY5 gene at different tissues organ.
The object of the invention is to be achieved through the following technical solutions:
First aspect, the invention provides a kind of eggplant HY5 albumen, comprises the aminoacid sequence shown in SEQIDNo.2.
Second aspect, the invention provides a kind of gene nucleic acid sequence of eggplant HY5 albumen of encoding, the cDNA sequence of described gene comprises:
(a) base sequence as shown in SEQIDNO.1 1st ~ 477; Or
B the base sequence shown in () Yu SEQIDNO.1 1st ~ 477 has the base sequence of the homology of at least 70%; Or
C () can carry out the base sequence of hybridizing with the base sequence shown in SEQIDNO.1 1st ~ 477.
Preferably, described cDNA sequence comprises the disappearance of 1 ~ 90 Nucleotide in the nucleotide sequence shown in SEQIDNO.1 1st ~ 477, insertion and/or replacement, and 5 ' and/or 3 ' end interpolation 60 with inner nucleotide.
The third aspect, the invention provides a kind of primer pair for the described gene that increases, the base sequence of described primer pair is as shown in SEQIDNO.3, SEQIDNO.4.
Fourth aspect, the primer pair that the quantitative fluorescent PCR that the invention provides a kind of gene of eggplant SmHY5 albumen of encoding is analyzed, the base sequence of described primer pair is as shown in SEQIDNO.5, SEQIDNO.6.
5th aspect, the invention provides a kind of purposes of gene at genetic engineering regulation plant upgrowth situation under light of eggplant SmHY5 albumen of encoding.
Preferably, described plant comprises Arabidopis thaliana.
In the present invention, term " SmHY5 gene coded sequence " refers to the nucleotide sequence of 1st ~ 477 shown in SEQIDNO.1 and degenerate sequence thereof.This degenerate sequence refers to, is arranged in the Nucleotide of 1st ~ 477 shown in SEQIDNO.1, have one or more codon replace by the degenerate codon of same amino acid of encoding after produce sequence.Due to the degeneracy of codon, the aminoacid sequence shown in SEQIDNO.2 so the degenerate sequence being low to moderate about 70% with the nucleotide sequence homology of 1st ~ 477 shown in SEQIDNO.1 also can be encoded out.This term also comprises the nucleotide sequence with the homology at least 70% of the nucleotide sequence shown in SEQIDNO.1.
This term also comprises encoding and has the variant form with sequence shown in the SEQIDNO.1 of the albumen of natural eggplant SmHY5 identical function.These variant forms comprise (but being not limited to): be generally the disappearance of 1 ~ 90 Nucleotide, insertion and/or replacement, and 5 ' and/or 3 ' end be added to 60 with inner nucleotide.
In the present invention, the expression pattern of the methods analyst eggplant SmHY5 gene product of available real-time fluorescence quantitative PCR, whether and quantity the existence of the mRNA transcript namely analyzing eggplant SmCOP1 gene in cell.
In addition, according to eggplant SmHY5 nucleotide sequence of the present invention and aminoacid sequence, can on the homology basis of nucleic acid homology or marking protein, screening eggplant SmHY5 associated homologous gene or homologous protein.
In order to obtain the dot matrix with eggplant SmHY5 genes involved, can screen eggplant cDNA library with DNA probe, these probes are under low high stringency conditions, use
32what P was correlated with to eggplant SmHY5 all or part ofly does radioactivity mark and obtains.The cDNA library being suitable for screening is the library from eggplant.The method built from the cDNA library of interested cell or tissue is that biology field is well-known.In addition, many such cDNA libraries also can buy, such as, purchased from Clontech, Stratagene, PaloAlto, Cal..This screening method can identify the nucleotide sequence of the gene family relevant to eggplant SmHY5.
Eggplant SmHY5 associated nucleotide full length sequence of the present invention or its fragment can obtain by the method for pcr amplification method, recombination method or synthetic usually.For pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the cDNA storehouse prepared by ordinary method well known by persons skilled in the art as template, amplification and relevant sequence.When sequence is longer, usually needs to carry out twice or repeatedly pcr amplification, and then the fragment that each time amplifies is stitched together by proper order.
After obtaining relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This is normally cloned into carrier, then proceeds to cell, is then separated from the host cell after propagation by ordinary method and obtains relevant sequence.
In addition, also by chemosynthesis, sudden change is introduced in protein sequence of the present invention.
Optical signal can regulate and control many secondary pathways metabolisms, the synthesis of such as anthocyanidin.Eggplant is the vegetable crop of extensively plantation, and the pericarp of purple eggplant contains abundant anthocyanidin.Result of study in recent years shows, it is best that the anti-oxidation health of purple eggplant acts in Vegetables crop.
Compared with prior art, the present invention has following beneficial effect:
1, expressed in arabidopsis mutant strain hy5 by SmHY5 gene, eggplant HY5 gene has the function similar to Arabidopis thaliana HY5 gene.
2, the present invention is directed to the present situation of current eggplant Research foundation weakness, key gene SmHY5 gene in clone's photo-signal channel, for utilizing genetic engineering technique to improve plant quality from now on, obtaining and there is the medicine of high antioxidant or food provides theoretical foundation, there is very large using value.
Accompanying drawing explanation
By reading the detailed description done non-limiting example with reference to the following drawings, other features, objects and advantages of the present invention will become more obvious:
Fig. 1 is that eggplant HY5 albumen of the present invention compares (FASTA) result with the amino acid sequence homologous of tomato HY5 albumen, and wherein, identical amino acid marks with amino acid monocase between two sequences;
Fig. 2 is the expression of eggplant HY5 gene of the present invention at different tissues;
Fig. 3 is that the RT-PCR turning SmHY5 gene plant detects;
Fig. 4 is the phenotype recovery situation turning SmHY5 gene pairs arabidopsis mutant strain hy5.
Embodiment
Below in conjunction with specific embodiment, the present invention is described in detail.Following examples will contribute to those skilled in the art and understand the present invention further, but not limit the present invention in any form.It should be pointed out that to those skilled in the art, without departing from the inventive concept of the premise, some distortion and improvement can also be made.These all belong to protection scope of the present invention.
The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition, such as Sambrook equimolecular clone: laboratory manual (NewYork:ColdSpringHarborLaboratoryPress, 1989) condition described in, or according to the condition that manufacturer advises.
the clone of embodiment 1, eggplant SmHY5 gene
1. the acquisition of vegetable material
This tests vegetable material used is eggplant fine germplasm resources Lanshan County standing grain line eggplant.Experiment material is cultivated in the artificial plastic greenhouse of Pujiang town, Minhang District, Shanghai space-breeding land.Nursery under field conditions (factors), growth is also solid.Gather the blade of eggplant for extracting RNA.
The extraction of 2.RNA
TRIzol method is adopted to extract total serum IgE (TRIzol is purchased from Sangon Biotech (Shanghai) Co., Ltd.).By the integrity of denaturing formaldehyde gel electrophoresis qualification RNA, then in upper purity and the concentration measuring RNA of spectrophotometer (ThermoScientificNANODROP1000Spectrophotometer).
3. the full-length clone of gene
Based on the conserved sequence design pair of degenerate primers of HY5 gene in Genbank.Extraction RNA is carried out reverse transcription (PrimeScriptII1stStrandcDNASynthesisKit: precious biotechnology (Dalian) company limited), with the first chain cDNA for template, utilize primer
F1(SEQIDNO.3)：5′-ATGCARGARCAAGCGACRAGYTC-3′
R1(SEQIDNO.4)：5′-YTACTTCCKCCCTTCCTGTGCAC-3′
Carry out PCR, amplification is reclaimed after obtaining expection length and is connected on pMD-19T (precious biotechnology (Dalian) company limited) carrier, transformation of E. coli DH5 α, utilize α complementation and bacterium colony PCR screening positive clone, deliver to prompt base (Shanghai) trade Co., Ltd in the English Weihe River to check order, obtain cDNA sequence SEQIDNO.1.
the sequence information of embodiment 2, eggplant HY5 gene and homology analysis
The new eggplant HY5 full length gene CDS open reading frame sequence of the present invention is 477bp, and detailed sequence is shown in SEQIDNO.1.Derive the aminoacid sequence of eggplant HY5 according to CDS opening code-reading frame sequence, totally 158 amino-acid residues, molecular weight is 17453.4 dalton, and theoretical iso-electric point (pI) is 9.64, and detailed sequence is shown in sequence shown in SEQIDNO.2.
The CDS open reading frame sequence of eggplant HY5 and the aminoacid sequence blast program of proteins encoded thereof are carried out Nucleotide and protein homology search in Non-redundantGenBank+EMBL+DDBJ+PDB and Non-redundantGenBankCDStranslations+PDB+SwissProt+Superd ate+PIR database, found that it and tomato HY5 gene (NM_001247891.1) have 92.02% consistence on nucleotide level; On amino acid levels, they between the two similarity up to 93.04%, (Query: the aminoacid sequence of eggplant HY5 as shown in Figure 1; Sbjct: the aminoacid sequence of tomato HY5).As can be seen here, all there is higher homology in eggplant HY5 gene and tomato HY5 gene from nucleic acid or protein level.
embodiment 3, the expression of eggplant HY5 gene in different tissues
1. the acquisition of vegetable material
Gather Fructus Solani melongenae root, stem, leaf, flower, pericarp, pulp respectively in the fructescence, drop at once in liquid nitrogen after sample is wrapped with aluminium platinum paper respectively, then proceed to stored for future use in-80 DEG C of Ultralow Temperature Freezers.
The extraction of 2.RNA
TRIzol method is adopted to extract total serum IgE (TRIzol is purchased from Sangon Biotech (Shanghai) Co., Ltd.).With plain agar sugar gel electrophoresis (gum concentration 1.2%; 0.5 × TBE electrophoretic buffer; 150v, 15min) detect integrity.In electrophoretic band, maximum rRNA brightness should be the 1.5-2.0 of Article 2 rRNA brightness doubly, otherwise represents the degraded of rRNA sample.Purity good RNA, A
260/ A
280and A
260/ A
230be about about 2.0.Calculate rna content by spectrophotometric determination OD value.
The acquisition of 3.cDNA
With the total serum IgE of 500ng for template, according to precious biotech firm TaKaRaPrimeScript
tMit is for subsequent use that RTreagentKitPerfectRealTime test kit operation instructions carries out reverse transcription acquisition cDNA.
4. design Auele Specific Primer to carry out the expression amount of real-time fluorescence quantitative PCR analyzing gene in different tissues.According to the eggplant HY5 gene order obtained, primer-design software is utilized to be designed for the Auele Specific Primer that in Real-timePCR, SmHY5 gene quantification is analyzed,
HY5-F(SEQIDNO.5)：5′-GACAAGTTCCATTGCGGCTAGTTC-3′
HY5-R(SEQIDNO.6)：5′-TCCATCTCTACCAGAAGCTGACGT-3′
Reference gene is Actin (GU984779.1), and its primer is
ACTIN-F(SEQIDNO.7)：5′-GTCGGAATGGGACAGAAGGATG-3′
ACTIN-R(SEQIDNO.8)：5′-GTGCCTCAGTCAGGAGAACAGGGT-3′
5. make the typical curve of goal gene and reference gene.With EASYDilution (test kit provides), standard substance cDNA solution is carried out gradient dilution, then respectively with dilution after cDNA solution for template, carry out Real-timePCR amplification with the Auele Specific Primer of goal gene and reference gene, reaction terminates rear drafting solubility curve and typical curve.Analyze solubility curve, judge whether the solubility curve of goal gene and reference gene obtains simple spike, to judge to use this primer can obtain single pcr amplification product.By the appropriate dilutions multiple of typical curve determination template cDNA.
6. the Real time PCR of goal gene in testing sample.With the cDNA Article 1 chain of synthesis for template, carry out quantitative fluorescence analysis respectively by the primer amplified of goal gene and reference gene, Real-timePCR reaction is carried out on FTC-3000 real-time quantitative instrument, and reaction system is 20 μ L.Reaction adopts three-step approach, 95 DEG C of sex change 1min, then 40 circulations: 95 DEG C of 30s; 58 DEG C of 30s; 72 DEG C of 45s.Whether, after each amplification completes, all do solubility curve, be special generation to check amplified production.
7. adopt 2
-△ △ Ctmethod makes relative quantitative assay.Result shows that SmHY5 gene has expression in the root of eggplant, stem, leaf, flower, pericarp, pulp, and the expression amount in each tissue is all without significant difference, illustrates that the expression of SmHY5 gene does not have Spatial Difference (Fig. 2).
embodiment 4, eggplant HY5 gene turn the functional verification of Arabidopis thaliana
Conversion carrier used is pCAMBIA1302 (Cambia), Arabidopis thaliana material is HY5 mutant strain hy5 (Luetal., 2015.Red-light-dependentinteractionofphyBwithSPA1promote sCOP1 – SPA1dissociationandphotomorphogenicdevelopmentinArabidop sis.MolecularPlant.8:467 – 478.).Agrobacterium containing SmHY5-1302 is cultured to OD0.8 ~ 2.0, and the centrifugal 5min of 6000rpm, abandons supernatant, and bacterial sediment MS liquid is resuspended, adjustment OD
600be 0.8 ~ 1.2, infect Arabidopis thaliana inflorescence 10 ~ 60sec, normally cultivate after light culture 12h, collect ripe seed.
The T collected
0for transgenic seed, be layered on containing on 50mg/L hygromycin resistance 1/2MS flat board, 4 DEG C of vernalization 3d, illumination box cultivates 6-10d, chooses the length that root is long, and grows the healthy and strong seedling of true leaf, transplants to native basin, cultivates.The T collected
1continue to be layered on containing on 50mg/L hygromycin resistance 1/2MS flat board for seed, choose resistance: not anti-ratio is that the strain of 3:1 collects T
2for seed.T
2in generation, survival rate on 50mg/L hygromycin resistance flat board was 100% think and screen pure and mild resistant plant.Real-timePCR is adopted to detect the expression amount (Fig. 3) of SmHY5 to the strain obtained.Arabidopis thaliana actin (NM_179953) primer used is as follows:
SEQIDNO.9：5′-GTCTGGATTGGAGGGTC-3′
SEQIDNO.10：5′-TGAGAAATGGTCGGAAA-3′
To screen the same mutant strain of positive transformants obtained, wild-type is cultivated under being together placed in light.Result shows, and the hypocotyl length of hy5 under light is significantly greater than wild-type WT, and transfer-gen plant SmHY5/hy5 has recovered this phenotype (Fig. 4).This illustrates that eggplant HY5 gene has the function similar to Arabidopis thaliana HY5 gene.
The sequence that the invention still further relates to is as follows:
SEQIDNO.1 ((SmHY5 gene cDNA sequence):
ATGCAAGAGCAAGCGACAAGTTCCATTGCGGCTAGTTCTATACCTTCAAGTAGTGAGAGATCTTCTAGTTCAGCTCTCCATCTTGAACACAAAGAAGGTATGGAGAGTGATGATGAGATCAGAAGAGTGCCGGAGATAGGCGGAGAAGCCACCGGAACCACGTCAGCTTCTGGTAGAGATGGAAGTTCCGCCACCCTTCAAGTTCAACCATTAACTGGGACTCAAAAGAAGCGAGGAAGAAGCCCAGCTGACAAAGAAAACAAGAGGTTAAAAAGGTTGCTGAGAAATAGAGTGTCTGCACAGCAAGCAAGGGAGAGGAAGAAAGCATACTTGATAGATCTGGAAGCAAGGGTGAAGGAACTGGAAACAAAGAATGCAGAACTTGAAGAGAGGTTGTCCACTTTGCAAAATGAGAACCAAATGCTTAGACATATACTGAAGAACACAACAGCAGGTGCACAGGAAGGGCGGAAGTAA
SEQIDNO.2 (SmHY5 gene amino acid sequence):
MQEQATSSIAASSIPSSSERSSSSALHLEHKEGMESDDEIRRVPEIGGEATGTTSASGRDGSSATLQVQPLTGTQKKRGRSPADKENKRLKRLLRNRVSAQQARERKKAYLIDLEARVKELETKNAELEERLSTLQNENQMLRHILKNTTAGAQEGRK
Above specific embodiments of the invention are described.It is to be appreciated that the present invention is not limited to above-mentioned particular implementation, those skilled in the art can make various distortion or amendment within the scope of the claims, and this does not affect flesh and blood of the present invention.
Claims (7)
1. an eggplant SmHY5 albumen, is characterized in that, the aminoacid sequence of described albumen is as shown in SEQIDNO.2.
2. encode the nucleotide sequence of the gene of eggplant SmHY5 albumen described in claim 1, it is characterized in that, the cDNA sequence of described gene comprises:
(a) base sequence as shown in SEQIDNO.1 1st ~ 477; Or
B the base sequence shown in () Yu SEQIDNO.1 1st ~ 477 has the base sequence of the homology of at least 70%; Or
C () can carry out the base sequence of hybridizing with the base sequence shown in SEQIDNO.1 1st ~ 477.
3. the nucleotide sequence of the gene of described eggplant SmHY5 albumen according to claim 2, it is characterized in that, described cDNA sequence comprises the disappearance of 1 ~ 90 Nucleotide in the nucleotide sequence shown in SEQIDNO.1 1st ~ 477, insertion and/or replacement, and 5 ' and/or 3 ' end interpolation 60 with inner nucleotide.
4., for a primer pair for the gene of eggplant SmHY5 albumen described in claim 2 that increases, it is characterized in that, the base sequence of described primer pair is as shown in SEQIDNO.3, SEQIDNO.4.
5., for the primer pair that the quantitative fluorescent PCR of the gene of eggplant SmHY5 albumen of encoding described in claim 2 is analyzed, it is characterized in that, the base sequence of described primer pair is as shown in SEQIDNO.5, SEQIDNO.6.
6. the gene of an eggplant SmHY5 albumen of encoding as claimed in claim 2 is in the purposes of genetic engineering regulation plant upgrowth situation under light.
7. encode according to claim 6 the purposes of gene of eggplant SmHY5 albumen, it is characterized in that, described plant comprises Arabidopis thaliana.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201511004882.XA CN105440115B (en) | 2015-12-28 | 2015-12-28 | Eggplant SmHY5 albumen and its encoding gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201511004882.XA CN105440115B (en) | 2015-12-28 | 2015-12-28 | Eggplant SmHY5 albumen and its encoding gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105440115A true CN105440115A (en) | 2016-03-30 |
| CN105440115B CN105440115B (en) | 2019-02-22 |
Family
ID=55550805
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201511004882.XA Expired - Fee Related CN105440115B (en) | 2015-12-28 | 2015-12-28 | Eggplant SmHY5 albumen and its encoding gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105440115B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109810181A (en) * | 2019-01-04 | 2019-05-28 | 南京农业大学 | Pears transcription factor PyHY5 and its recombinant expression carrier and application |
| CN111778276A (en) * | 2020-07-24 | 2020-10-16 | 上海交通大学 | Eggplant SmBIC2 gene and application of protein |
| CN111944772A (en) * | 2020-07-31 | 2020-11-17 | 上海交通大学 | Eggplant cryptochrome blue light inhibitor SmBIC1 protein and coding gene |
| CN113789334A (en) * | 2021-09-28 | 2021-12-14 | 浙江大学 | Application of HY5 gene in regulation and control of plant resistance to pest and disease damage |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103215275A (en) * | 2013-05-20 | 2013-07-24 | 上海交通大学 | Gene sequence for synthesizing relative transcription factor SmMYB by eggplant anthocyanidin |
| CN104059926A (en) * | 2014-06-24 | 2014-09-24 | 上海交通大学 | Related genes for synthesis of eggplant anthocyanin and coding protein of related genes |
-
2015
- 2015-12-28 CN CN201511004882.XA patent/CN105440115B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103215275A (en) * | 2013-05-20 | 2013-07-24 | 上海交通大学 | Gene sequence for synthesizing relative transcription factor SmMYB by eggplant anthocyanidin |
| CN104059926A (en) * | 2014-06-24 | 2014-09-24 | 上海交通大学 | Related genes for synthesis of eggplant anthocyanin and coding protein of related genes |
Non-Patent Citations (2)
| Title |
|---|
| AOKI K等: "Accession ID: NM_001247891，Solanum lycopersicum THY5 protein(HY5), mRNA", 《GENBANK DATABASE》 * |
| YONGSHENG LIU等: "Manipulation of light signal transduction as a means of modifying fruit nutritional quality in tomato", 《PNAS》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109810181A (en) * | 2019-01-04 | 2019-05-28 | 南京农业大学 | Pears transcription factor PyHY5 and its recombinant expression carrier and application |
| CN111778276A (en) * | 2020-07-24 | 2020-10-16 | 上海交通大学 | Eggplant SmBIC2 gene and application of protein |
| CN111944772A (en) * | 2020-07-31 | 2020-11-17 | 上海交通大学 | Eggplant cryptochrome blue light inhibitor SmBIC1 protein and coding gene |
| CN113789334A (en) * | 2021-09-28 | 2021-12-14 | 浙江大学 | Application of HY5 gene in regulation and control of plant resistance to pest and disease damage |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105440115B (en) | 2019-02-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110845590B (en) | Wild grape VyPPR gene and application of encoding protein thereof in drought stress | |
| CN107698673B (en) | Red palm AaMYB3 transcription factor and its encoding gene and application | |
| CN105440115A (en) | Eggplant SmHY5 protein and coding gene thereof | |
| CN105441396A (en) | Eggplant constitutively photomorphogenic SmCOP1 protein and coding gene thereof | |
| CN107164391A (en) | A kind of strawberry floral genes FvbHLH78 and its application | |
| CN103695438A (en) | Arabidopsis MYB family transcription factor AtMYB17 gene as well as coding sequence and application thereof | |
| CN105440114A (en) | Eggplant cryptochrome gene SmCRY1 and application thereof | |
| CN105440116A (en) | Eggplant cryptochrome gene SmCRY2 and application thereof | |
| CN112322637A (en) | Internal reference gene TIP41 of glehnia littoralis and screening method and application thereof | |
| CN108603198A (en) | Manipulate the composition and method of development of plants | |
| CN104745560A (en) | Eggplant chalcone synthase SmCHS1 protein and coding gene thereof | |
| CN105087508A (en) | Eggplant flavanone 3-hydroxylase SmF3H as well as gene and application thereof | |
| CN106749580B (en) | Plant salt tolerance GAP-associated protein GAP TaPUB15-D and its encoding gene and application | |
| KR20120121350A (en) | ATPG7 Protein Providing Yield Increase and Delaying Senescence and Stress Tolerance of Plants, the Gene Encoding the Protein and Those Use | |
| CN102277360B (en) | Prunus pseudocerasus L. DELLA proteins as well as coding genes and application thereof | |
| CN108504663B (en) | Peach auxin primary response factor Ppa011935m gene and application thereof | |
| CN104745561A (en) | Eggplant chalcone isomerase SmCHI protein and coding gene thereof | |
| CN107385104B (en) | Primer pair for screening reference genes in development process of wax apple fruits and application of primer pair | |
| CN109880830A (en) | Peach polypeptide hormone synthesizes gene PpRGF1 and its application | |
| CN103074307B (en) | Tulipa gesneriana TfbHLH1 protein, encoding gene thereof and probe | |
| CN105037514A (en) | Bermuda grass 'Tifway' dehydrin-L, encoding gene and probe thereof | |
| Cheng et al. | Molecular cloning and expression analysis of a putative E class MADS-box gene, GbSEP, from Ginkgo biloba. | |
| CN104017781B (en) | Agipanthus Plant hormones regulators,gibberellins synthesis dioxygenase APGA20ox albumen and encoding gene and probe | |
| CN108948162B (en) | Peanut adversity stress gene AhDOG1L and application thereof | |
| CN104774853A (en) | Rice root regulation function and application of E3 ubiquitin ligase gene OsPIW |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190222 Termination date: 20211228 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |