CN113736792B - Mutant of soybean GmTic110 gene and application thereof - Google Patents

Abstract

The invention relates to the technical field of genetic engineering, in particular to a soybean GmTic110 gene mutant and application thereof. The research of the invention shows that the mutation of the GmTic110 gene of the soybean coding chloroplast membrane protein leads to the reduction of chlorophyll synthesis of the mutant and abnormal development of chloroplasts, which affects photosynthesis of plants. The CRISPR/Cas9 system is utilized to knock out the GmTic110 gene of the wild type, so that the stable knocked-out transgenic strain shows leaf yellowing and is consistent with the phenotype of the mutant. The invention provides gene resources for soybean chloroplast engineering research, can directionally reform soybean chloroplast development through GmTIC110 protein, improves photosynthesis of soybean, provides germplasm resources for high-light-efficiency soybean variety cultivation, and has wide application prospect.

Description

Mutant of soybean GmTic110 gene and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a soybean GmTic110 gene mutant and application thereof.

Background

Chlorophyll is one of important pigments for chloroplast internal reference and photosynthesis, and research has shown that the development condition of plant chloroplast has positive correlation with chlorophyll content in leaf and leaf photosynthesis rate. Mutation of chlorophyll synthesis related genes can directly or indirectly influence biosynthesis or degradation pathways of the chlorophyll, so that plant chlorophyll is deleted, and plant leaves are subjected to yellowing, albinism, striped leaf spots, purplish brown spots and other chlorophyll deletion type mutant characterization. Chlorophyll-deficient mutants generally affect the photosynthesis rate of plants, slow the development of chloroplasts of plants, reduce crop yield, and in severe cases, cause death of plants.

The plant chloroplast synthesizes important amino acid substances through photosynthesis, which is a main source of plant cell energy and plays an important role in the processes of plant growth and development and cell metabolism, wherein, the internal membrane protein (TIC) plays an important role in the transportation of substances inside and outside the chloroplast. Currently, the identified chloroplast endomembrane proteins mainly comprise Tic20, tic21, tic110, tic236 and other proteins. The Tic110 protein is an important chloroplast endomembrane protein, which is one of the main components of Tic complexes, and has the property of cation-selective channels. Research results show that the TIC110 protein plays an important role by interacting with some macromolecular or micromolecular proteins in plants; it has been reported that TIC110 protein can interact with TIC40 protein to form complex transport proteins inside and outside chloroplasts; the interaction of TIC110 protein and TIC32 protein can play redox function and regulate Ca in chloroplast ²⁺ Ion steady state; the TIC110 protein and some matrix molecular chaperones Hsp93 and Hsp70 interact to form a chloroplast inner membrane transport channel bracket, so that various proteins can be smoothly guided into chloroplasts to complete biological functions.

Disclosure of Invention

In view of this, the invention provides a mutant of soybean GmTic110 gene and application thereof. The research of the invention shows that the mutation of the GmTic110 gene of the soybean coding chloroplast membrane protein leads to the reduction of chlorophyll synthesis of the mutant and abnormal development of chloroplasts, which affects photosynthesis of plants. The CRISPR/Cas9 system is utilized to knock out the GmTic110 gene of the wild type, so that the stable knocked-out transgenic strain shows leaf yellowing and is consistent with the phenotype of the mutant. The invention provides gene resources for soybean chloroplast engineering research, can directionally reform soybean chloroplast development through GmTIC110 protein, improves photosynthesis of soybean, provides germplasm resources for high-light-efficiency soybean variety cultivation, and has wide application prospect.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a mutant of soybean GmTic110 gene, wherein the 341 th G mutation is A.

In some embodiments of the invention, the sequence of the soybean GmTic110 gene is shown in SEQ ID No. 1.

In some embodiments of the invention, the sequence of the mutant has:

a nucleotide sequence shown as SEQ ID No. 8; or (b)

(II) a complementary nucleotide sequence of the nucleotide sequence shown as SEQ ID No. 8; or (b)

(III) a nucleotide sequence which encodes the same protein as the nucleotide sequence of (I) or (II) but which differs from the nucleotide sequence of (I) or (II) due to the degeneracy of the genetic code; or (b)

A nucleotide sequence obtained by substituting, deleting or adding one or two nucleotide sequences with the nucleotide sequence shown in (I), (II) or (III), and having the same or similar functions with the nucleotide sequence shown in (I), (II) or (III); or (b)

(V) a nucleotide sequence having at least 90% sequence identity to the nucleotide sequence of (I), (II), (III) or (IV).

In some embodiments of the invention, the substitution, deletion, or addition of one nucleotide.

The invention also provides proteins encoded by the mutants.

In some embodiments of the invention, the protein has:

(i) An amino acid sequence as shown in SEQ ID No. 9;

(ii) An amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the amino acid sequence of (i), and functionally identical to the amino acid sequence of (i); or (b)

(iii) An amino acid sequence having 90% or more identity to the amino acid sequence of (i) or (ii).

In some embodiments of the invention, the substitution, deletion, or addition of an amino acid.

In addition, the invention also provides biological materials, including the mutant or the protein; the biological material comprises one or more of a recombinant expression vector, a plasmid, an expression cassette, a recombinant bacterium or a host cell.

More importantly, the invention also provides application of the mutant, the protein and the biological material in any one or more of the following steps:

(A) Application in regulating chlorophyll; and/or

(B) Application in regulating chloroplast development; and/or

(C) Application in regulating photosynthesis; and/or

(D) Application in preparing transgenic plants; and/or

(E) Application in protein subcellular localization.

In some embodiments of the invention, the plant is a leguminous plant.

The research of the invention shows that the mutation of the GmTic110 gene of the soybean coding chloroplast membrane protein leads to the reduction of chlorophyll synthesis of the mutant and abnormal development of chloroplasts, which affects photosynthesis of plants. The CRISPR/Cas9 system is utilized to knock out the GmTic110 gene of the wild type, so that the stable knocked-out transgenic strain shows leaf yellowing and is consistent with the phenotype of the mutant. The invention provides gene resources for soybean chloroplast engineering research, can directionally reform soybean chloroplast development through GmTIC110 protein, improves photosynthesis of soybean, provides germplasm resources for high-light-efficiency soybean variety cultivation, and has wide application prospect.

The invention has the advantages of but not limited to:

(1) The GmTic110 gene is separated from soybean and is taken as an endogenous gene of the soybean, and has profound significance for genetic engineering of the soybean and research on the molecular regulation mechanism of the soybean.

(2) The research of the invention shows that the soybean coding chloroplast membrane gene mutation can change the normal transportation of soybean chloroplasts, can be used for directionally modifying chloroplast functions, provides gene resources for soybean chloroplast development research, and provides germplasm resources for soybean breeding.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

Fig. 1 shows the genomic and transcribed sequence of the soybean GmTic110 gene, wherein: the exon sequences are indicated in bold, the intron sequences are indicated in italics,represents a promoter, and->Represents a terminator;

FIG. 2 shows the She Sebiao type difference of wild type Williams82 and Gtic 110 mutants;

FIG. 3 shows the chlorophyll content differences in leaves of wild-type Williams82 and Gtic 110 mutants;

FIG. 4 shows the difference in chloroplast development observed by transmission electron microscopy of wild type Williams82 and GmTic110 mutant leaves;

FIG. 5 shows the photosynthesis index difference of wild type Williams82 and GmTic110 mutant plants; wherein, fig. 5 (a) shows the net photosynthetic rate difference of wild-type Williams82 and GmTic110 mutant plants; FIG. 5 (B) shows the stomatal conductance differences of wild-type Williams82 and GmTic110 mutant plants; FIG. 5 (C) shows the difference in transpiration rates of Williams82 and GmTic110 mutant plants; FIG. 5 (D) shows the difference in intercellular carbon dioxide concentration between Williams82 and GmTic110 mutant plants;

FIG. 6 shows the knockout of GmTic110 gene using the CRISPR/Cas9 system in the context of wild type Williams82, resulting in a stable phenotype knockout transgenic line;

FIG. 7 shows protein co-localization of GmTic110 protein in Arabidopsis protoplasts.

Detailed Description

The invention discloses application of soybean chloroplast membrane protein gene or protein thereof, and the skilled in the art can properly improve the technological parameters by referring to the content of the invention. It is expressly noted that all such similar substitutions and modifications will be apparent to those skilled in the art, and are deemed to be included in the present invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the relevant art that variations and modifications can be made in the methods and applications described herein, and in the practice and application of the techniques of this invention, without departing from the spirit or scope of the invention.

The invention provides a GmTic110 gene, which has any one of the following nucleotide sequences:

i) A nucleotide sequence shown as SEQ ID No. 1;

II), amino acid sequence with same or similar function by substituting, deleting or adding one or several nucleotides in the nucleotide sequence shown as SEQ ID No. 1;

III) a vector comprising the nucleotide sequence shown as SEQ ID No.1 or a fragment thereof.

In the invention, the amino acid sequence of the GmTic110 protein is provided as one of the following sequences:

i) An amino acid sequence shown as SEQ ID No. 2;

II), amino acid sequence with same or similar function and with one or more amino acids substituted, deleted or added in the amino acid sequence shown as SEQ ID No. 2;

in the invention, the nucleotide sequence of the encoding GmTic110 protein is shown as SEQ ID No. 3.

The invention provides a mutant of soybean GmTic110 gene, which is characterized in that the nucleotide sequence is that G at 341 rd position in a nucleic acid sequence shown in SEQ ID No.3 is mutated into A.

The invention provides application of the soybean GmTic110 gene or biological material containing the gene in chlorophyll regulation.

The invention provides application of the soybean GmTic110 gene or a biological material containing the gene in regulation and control of chloroplast development.

The invention provides an application of the soybean GmTic110 gene or a biological material containing the gene in regulating photosynthesis.

The invention provides application of the soybean GmTic110 gene or biological material containing the gene in preparing transgenic plants.

The invention provides application of the soybean GmTic110 gene or a biological material containing the gene in regulating and controlling gene expression modes.

The invention provides application of the soybean GmTic110 gene or a biological material containing the gene in protein subcellular localization.

The invention also provides a method for designing a targeting site on the GmTic110 gene by the CRISPR/Cas9 system, and constructing a gene knockout carrier, wherein the skeleton carrier is VK005-04-soU6-2-GmUbi3.

The recombinant host containing the expression vector is agrobacterium, and the gene knockout method disclosed by the invention adopts an agrobacterium-mediated method to transform the gene knockout vector containing the GmTic110 gene target site into a plant explant. Explants as recipient material are hypocotyl cells.

Preferably, the specific primer sequences of the gene knockout vector are shown in SEQ ID No.4 and SEQ ID No. 5.

The upstream primer shown in SEQ ID No. 4: GATTGCGGCGGCTGGATACGGCCT

The downstream primer shown in SEQ ID No. 5: AAACAGGCCGTATCCAGCCGCCGC

In the invention, the plant is a leguminous plant; the plant used for verifying the GmTic110 function in the invention is soybean of leguminous plant, in particular soybean Williams 82.

The nucleic acid molecule encoding the GmTIC110 protein comprises genomic DNA, cDNA, recombinant DNA or mRNA encoding the GmTIC110 protein and hnRNA; or a nucleic acid molecule which is complementary in reverse to the above DNA, cDNA, recombinant DNA or mRNA.

The nucleic acid molecules can be modified or optimized according to actual needs, so that the gene expression is more efficient; for example, (1) the amino acid sequence of the GmHY2 gene according to the invention may be changed to correspond to the preference of the recipient plant, while maintaining the amino acid sequence according to the preference of the recipient plant. (2) Or modifying the gene sequence adjacent to the initiation methionine to allow efficient initiation of translation; for example, modifications are made using sequences known to be effective in plants. (3) Ligating to promoters expressed by various plants to facilitate expression thereof in plants; the promoter may include constitutive, inducible, chronologically regulated, developmentally regulated, chemically regulated, tissue-preferred, and tissue-specific promoters; the choice of promoter will vary with the time and space of expression requirements and will also depend on the target species; (4) enhancer sequences such as intron sequences (e.g., derived from Adhl and bronzel) and viral leader sequences (e.g., derived from TMV, MCMV and AMV) are introduced.

In the present invention, the vector may be a plasmid, cosmid, phage or viral vector. The host may be a fungus, bacterium, algae or cell.

For plants not containing GmTIC110, the gene fragment of GmTIC110 may be introduced into plant cells by chemical methods, shotgun methods, microinjection, electroporation, or the like, or the gene fragment of GmTIC110 may be introduced into plant cells by homologous recombination, zinc finger nuclease, TALEN, CRISPR, or the like.

The invention has the advantages that:

(1) The GmTic110 gene is separated from soybean and is taken as an endogenous gene of the soybean, and has profound significance for genetic engineering of the soybean and research on the molecular regulation mechanism of the soybean.

(2) The research of the invention shows that the soybean coding chloroplast membrane gene mutation can change the normal transportation of soybean chloroplasts, can be used for directionally modifying chloroplast functions, provides gene resources for soybean chloroplast development research, and provides germplasm resources for soybean breeding.

The test materials adopted by the invention are all common commercial products and can be purchased in the market.

The invention is further illustrated by the following examples:

example 1 isolation and structural analysis of the GmTic110 Gene in Soybean

(1) Isolation of GmTic110 Gene

Total RNA is extracted from soybean variety Williams82, and Oligo (T) 17 is used as a primer to synthesize a cDNA first strand. The first strand of the cDNA is used as a template, and forward primers are respectively used

(5'-ATGAACCCTTCCACACTCACC-3' as shown in SEQ ID No. 6) and a reverse primer (5'-CTAGAATACAAACTTCTCTTCCT-3' as shown in SEQ ID No. 7). A GmTic110 gene cDNA fragment of 2988bp in length was obtained, and this fragment was ligated with pEasy-Blunt vector (full-size gold Co.) and designated Blunt-GmTic110.

The gene sequence of the obtained GmTic110 gene is shown as SEQ ID No.1, and the total CDS total length of the GmTic110 gene is 2988bp; the amino acid sequence of the protein coded by the gene is shown as SEQ ID No.2, and the total amino acid is 995 amino acids.

(2) GmTic110 Gene structural analysis

DNA in young leaves of soybean variety Williams82 is extracted, and the genomic DNA is used as a template to amplify and obtain a GmTic110 genome fragment, wherein the GmTic110 genome sequence is shown as SEQ ID No.3, and the total length is 7280bp and comprises 15 exons and 14 introns (shown as figure 1).

Example 2 isolation, screening and phenotypic characterization of the Soybean GmTic110 Gene mutant

From the library of Williams82 mutants mutagenized by EMS in this laboratory, a leaf yellowing mutant designated Gtic 110-1 (G mutation at position 341 in the nucleic acid sequence of the GmTic110 gene is A as shown in SEQ ID No. 8) was selected. Compared to wild-type Williams82, the Gmtic110-1 mutant exhibited a leaf yellowing phenotype from the seedling stage to the maturation stage (fig. 2). Meanwhile, the allelic mutant which we screened in the mutant library according to genotype was named Gmtic110-2, wherein the Gmtic110-2 mutant observed a leaf yellowing phenotype (FIG. 2).

(1) Chlorophyll synthesis regulated by GmTic110 gene

Since the mutant Gmti 110 exhibited a leaf yellowing phenotype throughout the growth period, the chlorophyll and carotenoid contents of Williams82, gmti 110-1 and Gmti 110-2 leaves were examined by spectrophotometry, and the results showed that the contents of chlorophyll a and chlorophyll b in both the mutant Gmti 110-1 and Gmti 110-2 were significantly lower than in the wild type (FIG. 3). This suggests that the GmTic110 gene mutation affects the synthetic pathway of chlorophyll a and chlorophyll b.

Table 1 figure 3 data

(2) GmTic110 gene regulating soybean chloroplast development

To analyze whether the yellowing of the mutant leaves would result in a change in chloroplast structure, the ultrastructure of wild type Williams82 and mutant Gmtic110-1, gmtic110-2 chloroplasts was observed by transmission electron microscopy. The mutant Gmtc 110 chloroplasts had an increased number of amyloids compared to wild-type Williams82 chloroplasts, and basal granulosa vesicles were packed thinner (FIG. 4). As the thylakoid membrane is provided with the photosynthetic pigment component, and photosynthesis mainly occurs on the thylakoids, chlorophyll a and chlorophyll b in the mutant are obviously reduced, so that basal granule thylakoids are accumulated and thinned, and the photosynthesis rate is reduced.

(3) Soybean photosynthesis regulated by GmTic110 gene

Since the chlorophyll content of Gmtic110 mutant is obviously reduced, in order to determine whether the photosynthesis of leaves is affected, the photosynthesis intensity indexes of Williams82, gmtic110-1 and Gmtic110-2 are respectively detected; the results indicate that the mutants GmTic110-1 and Gmtic110-2 have reduced net photosynthetic rate, reduced stomatal conductance, reduced transpiration rate and increased intracellular CO2 concentration compared to the wild type of Williams82 (FIG. 5). The results show that the reduced chlorophyll content of the mutant Gmtic110 significantly affects the photosynthesis ability of its leaves.

Table 2 fig. 5 raw data

Williams82	Pn(umol/m2/s)	Tr(mmol/m2/s)	Cleaf(mmol/m2/s)	CO2int(ppm)
					1	17.1	3.53	184.81	224.7
2	15.54	2.92	189.87	239.5
					3	16.69	3.42	203.55	207.8
4	17.28	3.58	205.99	254.1
					5	17.25	3.99	229.77	256.6
6	14.87	3.29	197.86	245.6
					7	19.02	3.67	195.67	221.3
8	15.41	3.79	214.7	235.6
					9	16.06	3.43	203.52	238
10	17.82	3.94	189.69	226.1
					11	18.42	4.02	221.66	244.2
12	19.61	3.58	189.93	211.4
					13	17.22	3.81	195.78	237
14	17.99	4.2	224.49	249.1
					15	16.03	3.71	189.2	242.8
AV	17.08733333	3.658666667	202.4326667	235.5866667
					SD	1.356557969	0.324606722	14.24829437	14.60493393

Table 3 fig. 5 raw data

Table 4 fig. 5 raw data

Gmtic110-2	Pn(umol/m2/s)	Tr(mmol/m2/s)	Cleaf(mmol/m2/s)	CO2int(ppm)
					1	7.76	2.57	150.18	298.6
2	8.96	2.62	157.83	289.9
					3	10.74	2.37	124.19	290.9
4	7.78	2.94	154.31	274.3
					5	7.87	2.69	154.83	299.8
6	8.95	2.93	185.56	304.5
					7	8.42	2.71	161.73	298.7
8	7.41	2.28	133.61	293.7
					9	7.18	2.17	126.56	291.8
10	8.98	2.48	161.07	292.5
					11	7.79	2.17	142.53	295.9
12	7.97	2.26	145.79	310.5
					13	10.73	2	131.88	311.1
14	7.58	2.11	143.77	293.5
					15	7.76	2.08	146.28	291.9
AV	8.392	2.425333333	148.008	295.84
					SD	1.103204423	0.306358023	15.82743829	8.987991989

Table 5 fig. 5 raw data

Example 3 construction of Soybean GmTic110 Gene knockout vector

Target site PCR amplification target fragments are designed on a GmTic110 gene transmembrane domain, and upstream and downstream primers of the target site are dimerized and connected to a VK005-04-soU6-2-GmUbi3 knockout expression vector. The knockout vector is transformed into a colistrain Trans5α by a freeze thawing method, the resistance in colibacillus is kanamycin resistance, and the resistance in plant bodies is glufosinate (Bar) resistance.

EXAMPLE 4 Agrobacterium-mediated transformation of leguminous plants

In this example, an explant of Williams82 containing a knockout expression vector of GmTic110 target site was obtained by agrobacterium-mediated transformation of soybean cotyledonary node.

(A) Acquisition of soybean explants

Selecting Williams82 mature soybean seeds with smooth surfaces, no damage, no disease spots and no cracks, and sterilizing for 14h by a chlorine method. And (3) ventilating the sterilized seeds on an ultra-clean bench to volatilize chlorine completely, and germinating the seeds in a germination culture medium for 6 hours. The 1/2 hypocotyl of soybean was removed, the soybean was slit longitudinally along the hypocotyl, and the remaining hypocotyl was used as a receptor material for agrobacterium-mediated transformation.

(B) Conversion of soybean

The agrobacterium-mediated method adopts secondary agrobacterium infection, and dark culture is carried out for 5 days at 22 ℃ on a co-culture medium; culturing in SI-I culture medium under strong light for 7d; cutting off large buds of the explants, and culturing for 14d in SI-II culture medium under strong light; cutting off cotyledons and hypocotyls of the explants, and carrying out secondary culture once every 14d in SE culture medium; cutting off cluster buds about 3cm, and putting the cluster buds into a rooting culture medium for rooting; and (3) transferring plants with developed root growth into soil in the RM rooting culture medium for planting. 16 resistant plants were obtained by screening through Bar resistance detection. The pod is ripe after 5 months of culture in a climatic chamber, and the seed collection is completed after 6 months.

(C) Transgenic plants that can be inherited

The phenotype of leaf yellowing was observed with harvested T1 generation seeds grown in a climatic chamber, consistent with the Gmtic110 mutant phenotype (fig. 6).

Example 5 subcellular localization of the Soybean GmTIC110 protein

In order to verify the subcellular localization of the GmTic110 protein, the constructed PUC19-GFP-GmTic110 transient expression vector was used for transforming Arabidopsis leaf protoplast by a polyethylene glycol-mediated method, co-localization observation was performed by using a Nikon laser confocal microscope, and GFP fluorescence was localized on the chloroplast inner membrane (FIG. 7).

Comparative example

Control group: deletion of one base at the exon of Gmtic110 mutant resulted in the initiation of mutation at amino acid 113 and premature termination at amino acid 120, which mutation occurred in the second transmembrane domain resulting in a yellowing phenotype of the leaf;

experimental group: in the invention, one base substitution occurs in the 1 st exon of the gene in the Gtic 110-1 mutant to cause amino acid substitution, the mutation site occurs in the second transmembrane domain, one base substitution occurs in the 14 th exon of the gene in the Gtic 110-2 mutant to cause amino acid substitution, and the mutation site occurs in the interaction factor binding domain.

The leaf yellowing phenotype of the mutant material is more remarkable than that of the mutant material of the control group, and the leaf yellowing phenotype of the mutant material is obviously lower than that of the control group in terms of chlorophyll content and photosynthesis index. The targeting site of the Gtic 110-CR mutant obtained by CRISPR/Cas9 technology is in the first transmembrane domain, and mutants with base deletion and substitution are respectively obtained. The phenotype of the transgenic knockout mutant material is also significantly more pronounced than the control phenotype.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Sequence listing

<110> national academy of sciences northeast geography and agricultural ecological institute

<120> mutant of soybean GmTic110 gene and application thereof

<130> MP21010838

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 7280

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

acgacgttat ctacaatcta caaagaggct ctatcatctt cttcctcttt agttttttcg 60

ttaaacccta taataacaac cactccactc ttctctactc tccgcaacct tacgacgtcg 120

tctcaaccat gaacccttcc acactcaccc cttcccacac ccaccgtcct ctcctcctac 180

cctctccctt ccacaccaga cggcgtcgtt ttaaagtctc cctccctcgc tgttcctcct 240

cctccgccgc ctcctccccc cctcctccgc cacctccgcc gccgcagcga ccgcccaagg 300

acctcaaggg aatcgatgtc ctcgtcgaca agctctcgcc gccggccagg ctcgccacct 360

ccgccgtcat cgtcgccggc gccgcggcgg ctggatacgg cctcggctcc cgcttcggcg 420

gaagccgcta cgctgcgctc ggtggagctg tcgccctcgg cgcggccggc ggtgctgcgg 480

cgtacgctct gaacgcggct gctccgcaag tcgccgccgt gaatttgcac aactacgtcg 540

ccgcgttcga cgacccttcg aagctgaaga aggaagagat tgaggccatt gcgtccaagt 600

tagtttttag tttcaatttc taataataat aactgttcat ttttttttct ttgttaattt 660

gagtgtttgg ttttgaaatg gttaattttt caggtatggt gtgagcaagc aagatgaggc 720

attcaaaact gagatttgtc atatatattc cgagtgagtg acaaattatt attattgttg 780

ttgttgtact ggtaacgagt tattatttgt tacttgcatt tgtgtagtga taatgtgtta 840

tgatgatttg gctgtttaat tttataattg aaagattgat ttgtggcata acgtgttgtt 900

caggtttgta tcttctgtgc ttcctcctgg tggtgaggaa cttaaaggtg atgaggttga 960

taggattgtc agcttcaaaa attctttggg aattgatgac ccggatgctg ctgctatgca 1020

catggaggta ttttttgtgt ttgttgtgta tatatataca cctgattacc agagtagatc 1080

gagtgtgtat gtttattatg aggagtgaaa gcagttccgt gtcttactgg tttggtgctt 1140

gttgactccc tagattggga ggaaattttt caggcaaagg ttggaagttg gggatcgtga 1200

tgctgatgtt gagcaacgtc gggtaagttt gttgtgttgt gatgttatct taactgattg 1260

gttgcaaatt tgcaatagca tcatgggttt tagatgaata atggatactt ggagcttgac 1320

cattgttaga gtctccagtg caggcatttc aaaagttgat atatgtgtca aatcttgtat 1380

ttggagatgc atcgtctttc cttctacctt ggaagcgtgt attcaaggtc accgattccc 1440

aggtatttat ttcttattgg ttaactggta tgcctagctt gtgcaacgtg atattaatat 1500

gcaattagga tgagagattt ggagcatagg tttatgacta tttataggca tttgctcaaa 1560

aagggaagac ctaatttgct gcacaaaatg cattttgcca tgtttgtgat cagtgacatg 1620

ctggcagcat ttcttaataa ttcttatatg ttctcattgt catttcttat cttagtgttt 1680

ttgttatttt tcatttgact agttaactat aatctattta ccagattgaa gtagctgtac 1740

gtgacaatgc gcagcgattg tttgcttcca agctgaaatc agttggcaga ggtaattgtg 1800

tagtcagtaa ttcctcttgg tccttgtttg ctcttactgt aacaaagttg atcaactaac 1860

tcacatttac tcctcgagaa gttgtcataa cttcatacta ctatattact ggagaaatga 1920

ttggaaatga taatcttgtt ttgtaattgt gcatgcattt cttattaaat aaagccttta 1980

aattttgctt gtactcatct agtatgctgg attttgttct gtaattctct agaattacta 2040

tcatccaaac taacaaattc tttctatagc aatttttaga agttttaaat caggtttatt 2100

tcctaagtgt taaccaatga tttcttgcca gatattgatg cagaaaaact tgttgcacta 2160

agaaaagaac aacaattatg tcgcctttct gatgaggttc attttcatta tttcttcttt 2220

cataactttc aacttctctg ggttaaatcc ctgtctttgt cttgccatca aatagttcct 2280

tggtatagta taatcttttt attaattaaa ggaaattttc attgaagctt gctgagaact 2340

tgtttagaga tcacacaagg aaattggttg aggaaaatat ttcagaggca aatagaatac 2400

ttaaatctcg caccaaagca gtgtaagatt catggttttt ctaagtattc ttttttttaa 2460

gtattaaatt ttgaattctg ggcatgtttt tcttgccatt tgtttcatta gtgttactat 2520

tcatttctta atttttacaa aaatagaatt tgccatatct gatcatctgt aagtttcagt 2580

cctggagcta cgcaggcaat tgcagagctg gataaggtat tggcatttaa taatttactc 2640

atctcattta agaatcatcc agatgtggat cgctttgctc gtggtgttgg tccaatttct 2700

ttagtgggta agtgtctgtg actaggtgtg tgtgtgtgtg tgtgtgtgtg tgtgtgtgta 2760

taacatgttc ttttctcttt ttaatcttaa ttcttgaagt ttaccacaat tcatttttgg 2820

cataggtgga gagtatgatg gtgacagaaa aatagaggac ttgaaactcc tttacagggc 2880

atatgtttca gatgctttgt ctggtgggcg catggaagat gataaggtaa ataaccaaga 2940

caattggata tgaactgtga acttcttaag atgtgttttc tcaatattct aatatatttt 3000

gaagttgagt ttgggttagt gttttccaga tgtatgtagt gattgaatag tatattttct 3060

aaaaaaattg gagtattcag cagctattta tatcatattg gagtattcac ttcccatggg 3120

tataatagag attgaaacct agcagtttag ccttagttat tctttattgt ttcttatgtt 3180

ttatctttct ttttgatgta gtaccaattg ccaaatcatg attgaacagg ctgttcagtg 3240

catgctacca tatccatatt gctcttattc ttatttttaa tatttcagtt agggcagtat 3300

attattttca gtacaagggt atttgtttac tgtatcaagc ctaatgaatt ttcacttatt 3360

gaagcatttt ttagtgttat aaaacaatgt cctgtctcct tgcttaacac taacaactta 3420

aagcttttag gtcaggtgat ttgttgactg ttaagatgta ctagcatacg attccccttt 3480

gaatatagtt gcatatgttc tctaatcttc ctttaatgag tcaacattca gataagcaaa 3540

gacacaacag tgtctcgaaa accatgatat ccattactaa agagttctta ttgatataag 3600

atatgaaact tgatctgtca aaacacttat tttttaatat aaaataaaaa atatatttta 3660

aatatattta ttattcgttg cagcttgctg cactaaatca gttacgaaat atattcggac 3720

tgggtaaacg tgaagccgag gccatttcac ttgatgttac gtcgaaggta tatcgcaaac 3780

gacttgcaca ggctgctgca gatggtgagt tagaaatggc tgatagcaaa gcagccttcc 3840

ttcaaaatct atgtgatgaa cttcattttg atccacaaaa ggccagtgaa cttcatgaag 3900

gtaaaactcg tcatgtttac agttagttgg aagttgacta tatttgaggc ctttattatt 3960

gaacacttta tgtgctgtcg gtttttattt atgtgcaatt cttaaatctt aaggttgtaa 4020

aatgtaaact tgtaaaaccc tttctacatg atgtgacttt tttttatata tatatttagt 4080

tataacacaa tctaatgata gtttattatt tttaagaaat ttatcggcaa aagcttcaga 4140

gatgtgtagc tgatggggag ctcaatgagg aggatgttgc tgctttgttg aggatgcgtg 4200

taatgctctg cataccgcaa cagattgttg aagcagctca ttcagatatc tgtggcagtt 4260

tgtttgaaaa ggtagtcaac gttacttttt cctatctaat tgtttggtcc ttcataagtg 4320

tcaaattagt gaaattacat atttcttgct atgcagaagt gcggtccatc catgcactgt 4380

aacaaactga taatgataat atgaatacat ggatgaacac taaaattgct ttacatatga 4440

atatgggttc aagatgatta tggaactatg gttatcaaac tcattctact ttctatttga 4500

atattggtag catgagaagt tacagctgtc acattttaat gtgttgataa acctgataat 4560

gctttcattt actggtagtg tggagatgga gaccatgaat ctactgcatt tttttttatc 4620

ttacaggaaa gatacactgt tgtactctgt actctgcatg ctaggttttg tctagaattt 4680

ctaaaatgtg tatctattgg aattgttact ttcaactgct tgtaatttat ttgggctttg 4740

tcttttcaat ttgtagacct gtatctactt gctataaaat ctgtttattg gtttgattat 4800

cttatatcaa agttgtacaa gtctagattc tatagtgctt agttgatggc agcgatatgt 4860

gaagaaatgg gtctgtttta ttttgatata tcatgagtct tgtttcaatc tccatcaaag 4920

atgttcaaaa ttttgttgag ttattactaa ttcatgtttc tccttttata ggttgtcaag 4980

gaggcaattg catcaggggt tgatggatat gatgctgaaa tccagaaatc agtaagaaaa 5040

gcagcacatg gcctgcgact tactagggag gttgctatgt ctattgcaag caaggcggtg 5100

agtatcaagt tatcagaaac tcaatggtga tttataaaga tttgaatagg tttaaatttc 5160

actgaggttt tttggaatta taggtaagga agatttttat taattacata aaacgtgcac 5220

gggcagctgg aaatcgtacc gagtctgcga aagaactgaa gaagatgata gccttcaaca 5280

ccttagttgt aactaatttg gtggaggaca ttaaagggga gtcaactgat atttcctctg 5340

aagaacctgt gaaagaggac attacacaaa ctgacgatga agaatgggaa tcacttcaga 5400

cactcaagaa aataagacca aataaagaac ttacggaaaa gttgggaaaa cctggtcaga 5460

cagaaattac tctgaaagat gatcttcctg aaagggatag gactgatctt tacaagacat 5520

acttacttta ttgtctaact ggtgaagtga caagggttcc atttggtgct cagatcacta 5580

ctaagaagga tgattctgag tatcttcttc taaatcagct tggtgggatc ctgggattga 5640

gtagtcaaga aatagtggaa gtgcacaggg gtctagctga gcaggctttt aggcaacagg 5700

ctgaggtaat tttagccgat ggacagttga caaaggccag ggtggagcag cttaataacc 5760

tccagaaaca agtaggctta cctcaagaat atgctcagaa aataatcaag agtataacca 5820

ctacaaaaat ggcagctgcc attgaaactg ctgtaactca agggaggctc aatatgaagc 5880

agataaggga acttaaggaa gctgatgttg atttagacag tatggtatct gagaacttga 5940

gagagaccct cttcaaaaaa actgttgatg acattttctc atccggtact ggagagtttg 6000

acactgagga agtatatgaa aaaatcccgt cagatctcaa cattaacaaa gagaaggcac 6060

gaggtgttgt tcatgagctt gcaaagggta gactatccaa ctctctgatt caggctgtct 6120

ctctactaag acagagaaat cagcagggag tggtaagtaa tattcaaagc ttcatgttca 6180

cttagtacta gtttggattt atgctggatt atctaaaatt acactcaaat actagatcac 6240

gtgaagtaaa tgttcataaa ttttttgttt cactttaaga aattgattct gagttgaagc 6300

aattttaggt aactttttct gttgaataaa aaaggtttat gttaagtttt attattaact 6360

tgctttcatt aaaaaaaaac ctccaaacat aaatcttttc acttcaaaat caattatgca 6420

aaatctactt cattcataat caattttgca aatgtttgtc ccaacacact tagtgcgtgt 6480

ttgtacaagc attggcaaat tgattttaaa ttgaattgat tttagttaaa ttgatttgaa 6540

agtgatgtga tttatgttta agtacaacat tttagatcca tcgtaaaaat tactcaaagg 6600

tcctttaact tagagtcaat tttggactta gaatcaattc tgaattcttc tttaacagga 6660

aaccaaacac gaaaatttat caaaaagcca ttctccaatg tgaaacaaaa cttgcactta 6720

ttcaaacagc ttttttacgt ttgtttgtca tggataatca tgtgtgattg cttcttttct 6780

tttgtgcagg tttcttcact caatgacttg ctggcatgtg acaaagcagt accctcacag 6840

ccagtttcat gggaagtgcc agaggagctt tctgatctat acaccatata cttgaagagt 6900

aatccaactc ctgagaattt gtctcgtttg caatatctgt tgggtataaa tgattccaca 6960

gctgctgctc ttagggagat tggagataga ttactcaata ctactgcgga ggaagagaag 7020

tttgtattct agtcttgtga taaaatgttt ggcattttag gcacactaga gaggctgcaa 7080

gtccccttaa ttttgccatt ttttattttc cattttgttt aacggtagca gaaaaagaat 7140

atcacgatgt ataaactttg gaatagagat gagtgcagtg ctgaaatctt agataatatt 7200

ttgtttgaga cagttgaatt aatcaattgc tattttttat gaatgaaaat aagttttcat 7260

aatcgtggac aagttttatc 7280

<210> 2

<211> 995

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 2

Met Asn Pro Ser Thr Leu Thr Pro Ser His Thr His Arg Pro Leu Leu

1 5 10 15

Leu Pro Ser Pro Phe His Thr Arg Arg Arg Arg Phe Lys Val Ser Leu

20 25 30

Pro Arg Cys Ser Ser Ser Ser Ala Ala Ser Ser Pro Pro Pro Pro Pro

35 40 45

Pro Pro Pro Pro Gln Arg Pro Pro Lys Asp Leu Lys Gly Ile Asp Val

50 55 60

Leu Val Asp Lys Leu Ser Pro Pro Ala Arg Leu Ala Thr Ser Ala Val

65 70 75 80

Ile Val Ala Gly Ala Ala Ala Ala Gly Tyr Gly Leu Gly Ser Arg Phe

85 90 95

Gly Gly Ser Arg Tyr Ala Ala Leu Gly Gly Ala Val Ala Leu Gly Ala

100 105 110

Ala Gly Gly Ala Ala Ala Tyr Ala Leu Asn Ala Ala Ala Pro Gln Val

115 120 125

Ala Ala Val Asn Leu His Asn Tyr Val Ala Ala Phe Asp Asp Pro Ser

130 135 140

Lys Leu Lys Lys Glu Glu Ile Glu Ala Ile Ala Ser Lys Tyr Gly Val

145 150 155 160

Ser Lys Gln Asp Glu Ala Phe Lys Thr Glu Ile Cys His Ile Tyr Ser

165 170 175

Glu Phe Val Ser Ser Val Leu Pro Pro Gly Gly Glu Glu Leu Lys Gly

180 185 190

Asp Glu Val Asp Arg Ile Val Ser Phe Lys Asn Ser Leu Gly Ile Asp

195 200 205

Asp Pro Asp Ala Ala Ala Met His Met Glu Ile Gly Arg Lys Phe Phe

210 215 220

Arg Gln Arg Leu Glu Val Gly Asp Arg Asp Ala Asp Val Glu Gln Arg

225 230 235 240

Arg Ala Phe Gln Lys Leu Ile Tyr Val Ser Asn Leu Val Phe Gly Asp

245 250 255

Ala Ser Ser Phe Leu Leu Pro Trp Lys Arg Val Phe Lys Val Thr Asp

260 265 270

Ser Gln Ile Glu Val Ala Val Arg Asp Asn Ala Gln Arg Leu Phe Ala

275 280 285

Ser Lys Leu Lys Ser Val Gly Arg Asp Ile Asp Ala Glu Lys Leu Val

290 295 300

Ala Leu Arg Lys Glu Gln Gln Leu Cys Arg Leu Ser Asp Glu Leu Ala

305 310 315 320

Glu Asn Leu Phe Arg Asp His Thr Arg Lys Leu Val Glu Glu Asn Ile

325 330 335

Ser Glu Ala Asn Arg Ile Leu Lys Ser Arg Thr Lys Ala Val Pro Gly

340 345 350

Ala Thr Gln Ala Ile Ala Glu Leu Asp Lys Val Leu Ala Phe Asn Asn

355 360 365

Leu Leu Ile Ser Phe Lys Asn His Pro Asp Val Asp Arg Phe Ala Arg

370 375 380

Gly Val Gly Pro Ile Ser Leu Val Gly Gly Glu Tyr Asp Gly Asp Arg

385 390 395 400

Lys Ile Glu Asp Leu Lys Leu Leu Tyr Arg Ala Tyr Val Ser Asp Ala

405 410 415

Leu Ser Gly Gly Arg Met Glu Asp Asp Lys Leu Ala Ala Leu Asn Gln

420 425 430

Leu Arg Asn Ile Phe Gly Leu Gly Lys Arg Glu Ala Glu Ala Ile Ser

435 440 445

Leu Asp Val Thr Ser Lys Val Tyr Arg Lys Arg Leu Ala Gln Ala Ala

450 455 460

Ala Asp Gly Glu Leu Glu Met Ala Asp Ser Lys Ala Ala Phe Leu Gln

465 470 475 480

Asn Leu Cys Asp Glu Leu His Phe Asp Pro Gln Lys Ala Ser Glu Leu

485 490 495

His Glu Glu Ile Tyr Arg Gln Lys Leu Gln Arg Cys Val Ala Asp Gly

500 505 510

Glu Leu Asn Glu Glu Asp Val Ala Ala Leu Leu Arg Met Arg Val Met

515 520 525

Leu Cys Ile Pro Gln Gln Ile Val Glu Ala Ala His Ser Asp Ile Cys

530 535 540

Gly Ser Leu Phe Glu Lys Val Val Lys Glu Ala Ile Ala Ser Gly Val

545 550 555 560

Asp Gly Tyr Asp Ala Glu Ile Gln Lys Ser Val Arg Lys Ala Ala His

565 570 575

Gly Leu Arg Leu Thr Arg Glu Val Ala Met Ser Ile Ala Ser Lys Ala

580 585 590

Val Arg Lys Ile Phe Ile Asn Tyr Ile Lys Arg Ala Arg Ala Ala Gly

595 600 605

Asn Arg Thr Glu Ser Ala Lys Glu Leu Lys Lys Met Ile Ala Phe Asn

610 615 620

Thr Leu Val Val Thr Asn Leu Val Glu Asp Ile Lys Gly Glu Ser Thr

625 630 635 640

Asp Ile Ser Ser Glu Glu Pro Val Lys Glu Asp Ile Thr Gln Thr Asp

645 650 655

Asp Glu Glu Trp Glu Ser Leu Gln Thr Leu Lys Lys Ile Arg Pro Asn

660 665 670

Lys Glu Leu Thr Glu Lys Leu Gly Lys Pro Gly Gln Thr Glu Ile Thr

675 680 685

Leu Lys Asp Asp Leu Pro Glu Arg Asp Arg Thr Asp Leu Tyr Lys Thr

690 695 700

Tyr Leu Leu Tyr Cys Leu Thr Gly Glu Val Thr Arg Val Pro Phe Gly

705 710 715 720

Ala Gln Ile Thr Thr Lys Lys Asp Asp Ser Glu Tyr Leu Leu Leu Asn

725 730 735

Gln Leu Gly Gly Ile Leu Gly Leu Ser Ser Gln Glu Ile Val Glu Val

740 745 750

His Arg Gly Leu Ala Glu Gln Ala Phe Arg Gln Gln Ala Glu Val Ile

755 760 765

Leu Ala Asp Gly Gln Leu Thr Lys Ala Arg Val Glu Gln Leu Asn Asn

770 775 780

Leu Gln Lys Gln Val Gly Leu Pro Gln Glu Tyr Ala Gln Lys Ile Ile

785 790 795 800

Lys Ser Ile Thr Thr Thr Lys Met Ala Ala Ala Ile Glu Thr Ala Val

805 810 815

Thr Gln Gly Arg Leu Asn Met Lys Gln Ile Arg Glu Leu Lys Glu Ala

820 825 830

Asp Val Asp Leu Asp Ser Met Val Ser Glu Asn Leu Arg Glu Thr Leu

835 840 845

Phe Lys Lys Thr Val Asp Asp Ile Phe Ser Ser Gly Thr Gly Glu Phe

850 855 860

Asp Thr Glu Glu Val Tyr Glu Lys Ile Pro Ser Asp Leu Asn Ile Asn

865 870 875 880

Lys Glu Lys Ala Arg Gly Val Val His Glu Leu Ala Lys Gly Arg Leu

885 890 895

Ser Asn Ser Leu Ile Gln Ala Val Ser Leu Leu Arg Gln Arg Asn Gln

900 905 910

Gln Gly Val Val Ser Ser Leu Asn Asp Leu Leu Ala Cys Asp Lys Ala

915 920 925

Val Pro Ser Gln Pro Val Ser Trp Glu Val Pro Glu Glu Leu Ser Asp

930 935 940

Leu Tyr Thr Ile Tyr Leu Lys Ser Asn Pro Thr Pro Glu Asn Leu Ser

945 950 955 960

Arg Leu Gln Tyr Leu Leu Gly Ile Asn Asp Ser Thr Ala Ala Ala Leu

965 970 975

Arg Glu Ile Gly Asp Arg Leu Leu Asn Thr Thr Ala Glu Glu Glu Lys

980 985 990

Phe Val Phe

995

<210> 3

<211> 2988

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atgaaccctt ccacactcac cccttcccac acccaccgtc ctctcctcct accctctccc 60

ttccacacca gacggcgtcg ttttaaagtc tccctccctc gctgttcctc ctcctccgcc 120

gcctcctccc cccctcctcc gccacctccg ccgccgcagc gaccgcccaa ggacctcaag 180

ggaatcgatg tcctcgtcga caagctctcg ccgccggcca ggctcgccac ctccgccgtc 240

atcgtcgccg gcgccgcggc ggctggatac ggcctcggct cccgcttcgg cggaagccgc 300

tacgctgcgc tcggtggagc tgtcgccctc ggcgcggccg gcggtgctgc ggcgtacgct 360

ctgaacgcgg ctgctccgca agtcgccgcc gtgaatttgc acaactacgt cgccgcgttc 420

gacgaccctt cgaagctgaa gaaggaagag attgaggcca ttgcgtccaa gtatggtgtg 480

agcaagcaag atgaggcatt caaaactgag atttgtcata tatattccga gtttgtatct 540

tctgtgcttc ctcctggtgg tgaggaactt aaaggtgatg aggttgatag gattgtcagc 600

ttcaaaaatt ctttgggaat tgatgacccg gatgctgctg ctatgcacat ggagattggg 660

aggaaatttt tcaggcaaag gttggaagtt ggggatcgtg atgctgatgt tgagcaacgt 720

cgggcatttc aaaagttgat atatgtgtca aatcttgtat ttggagatgc atcgtctttc 780

cttctacctt ggaagcgtgt attcaaggtc accgattccc agattgaagt agctgtacgt 840

gacaatgcgc agcgattgtt tgcttccaag ctgaaatcag ttggcagaga tattgatgca 900

gaaaaacttg ttgcactaag aaaagaacaa caattatgtc gcctttctga tgagcttgct 960

gagaacttgt ttagagatca cacaaggaaa ttggttgagg aaaatatttc agaggcaaat 1020

agaatactta aatctcgcac caaagcagtt cctggagcta cgcaggcaat tgcagagctg 1080

gataaggtat tggcatttaa taatttactc atctcattta agaatcatcc agatgtggat 1140

cgctttgctc gtggtgttgg tccaatttct ttagtgggtg gagagtatga tggtgacaga 1200

aaaatagagg acttgaaact cctttacagg gcatatgttt cagatgcttt gtctggtggg 1260

cgcatggaag atgataagct tgctgcacta aatcagttac gaaatatatt cggactgggt 1320

aaacgtgaag ccgaggccat ttcacttgat gttacgtcga aggtatatcg caaacgactt 1380

gcacaggctg ctgcagatgg tgagttagaa atggctgata gcaaagcagc cttccttcaa 1440

aatctatgtg atgaacttca ttttgatcca caaaaggcca gtgaacttca tgaagaaatt 1500

tatcggcaaa agcttcagag atgtgtagct gatggggagc tcaatgagga ggatgttgct 1560

gctttgttga ggatgcgtgt aatgctctgc ataccgcaac agattgttga agcagctcat 1620

tcagatatct gtggcagttt gtttgaaaag gttgtcaagg aggcaattgc atcaggggtt 1680

gatggatatg atgctgaaat ccagaaatca gtaagaaaag cagcacatgg cctgcgactt 1740

actagggagg ttgctatgtc tattgcaagc aaggcggtaa ggaagatttt tattaattac 1800

ataaaacgtg cacgggcagc tggaaatcgt accgagtctg cgaaagaact gaagaagatg 1860

atagccttca acaccttagt tgtaactaat ttggtggagg acattaaagg ggagtcaact 1920

gatatttcct ctgaagaacc tgtgaaagag gacattacac aaactgacga tgaagaatgg 1980

gaatcacttc agacactcaa gaaaataaga ccaaataaag aacttacgga aaagttggga 2040

aaacctggtc agacagaaat tactctgaaa gatgatcttc ctgaaaggga taggactgat 2100

ctttacaaga catacttact ttattgtcta actggtgaag tgacaagggt tccatttggt 2160

gctcagatca ctactaagaa ggatgattct gagtatcttc ttctaaatca gcttggtggg 2220

atcctgggat tgagtagtca agaaatagtg gaagtgcaca ggggtctagc tgagcaggct 2280

tttaggcaac aggctgaggt aattttagcc gatggacagt tgacaaaggc cagggtggag 2340

cagcttaata acctccagaa acaagtaggc ttacctcaag aatatgctca gaaaataatc 2400

aagagtataa ccactacaaa aatggcagct gccattgaaa ctgctgtaac tcaagggagg 2460

ctcaatatga agcagataag ggaacttaag gaagctgatg ttgatttaga cagtatggta 2520

tctgagaact tgagagagac cctcttcaaa aaaactgttg atgacatttt ctcatccggt 2580

actggagagt ttgacactga ggaagtatat gaaaaaatcc cgtcagatct caacattaac 2640

aaagagaagg cacgaggtgt tgttcatgag cttgcaaagg gtagactatc caactctctg 2700

attcaggctg tctctctact aagacagaga aatcagcagg gagtggtttc ttcactcaat 2760

gacttgctgg catgtgacaa agcagtaccc tcacagccag tttcatggga agtgccagag 2820

gagctttctg atctatacac catatacttg aagagtaatc caactcctga gaatttgtct 2880

cgtttgcaat atctgttggg tataaatgat tccacagctg ctgctcttag ggagattgga 2940

gatagattac tcaatactac tgcggaggaa gagaagtttg tattctag 2988

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

gattgcggcg gctggatacg gcct 24

<210> 5

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

aaacaggccg tatccagccg ccgc 24

<210> 6

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

atgaaccctt ccacactcac c 21

<210> 7

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

ctagaataca aacttctctt cct 23

<210> 8

<211> 7280

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

acgacgttat ctacaatcta caaagaggct ctatcatctt cttcctcttt agttttttcg 60

ttaaacccta taataacaac cactccactc ttctctactc tccgcaacct tacgacgtcg 120

tctcaaccat gaacccttcc acactcaccc cttcccacac ccaccgtcct ctcctcctac 180

cctctccctt ccacaccaga cggcgtcgtt ttaaagtctc cctccctcgc tgttcctcct 240

cctccgccgc ctcctccccc cctcctccgc cacctccgcc gccgcagcga ccgcccaagg 300

acctcaaggg aatcgatgtc ctcgtcgaca agctctcgcc gccggccagg ctcgccacct 360

ccgccgtcat cgtcgccggc gccgcggcgg ctggatacgg cctcggctcc cgcttcggcg 420

gaagccgcta cgctgcgctc ggtggagctg tcgccctcgg cgcggccgac ggtgctgcgg 480

cgtacgctct gaacgcggct gctccgcaag tcgccgccgt gaatttgcac aactacgtcg 540

ccgcgttcga cgacccttcg aagctgaaga aggaagagat tgaggccatt gcgtccaagt 600

tagtttttag tttcaatttc taataataat aactgttcat ttttttttct ttgttaattt 660

gagtgtttgg ttttgaaatg gttaattttt caggtatggt gtgagcaagc aagatgaggc 720

attcaaaact gagatttgtc atatatattc cgagtgagtg acaaattatt attattgttg 780

ttgttgtact ggtaacgagt tattatttgt tacttgcatt tgtgtagtga taatgtgtta 840

tgatgatttg gctgtttaat tttataattg aaagattgat ttgtggcata acgtgttgtt 900

caggtttgta tcttctgtgc ttcctcctgg tggtgaggaa cttaaaggtg atgaggttga 960

taggattgtc agcttcaaaa attctttggg aattgatgac ccggatgctg ctgctatgca 1020

catggaggta ttttttgtgt ttgttgtgta tatatataca cctgattacc agagtagatc 1080

gagtgtgtat gtttattatg aggagtgaaa gcagttccgt gtcttactgg tttggtgctt 1140

gttgactccc tagattggga ggaaattttt caggcaaagg ttggaagttg gggatcgtga 1200

tgctgatgtt gagcaacgtc gggtaagttt gttgtgttgt gatgttatct taactgattg 1260

gttgcaaatt tgcaatagca tcatgggttt tagatgaata atggatactt ggagcttgac 1320

cattgttaga gtctccagtg caggcatttc aaaagttgat atatgtgtca aatcttgtat 1380

ttggagatgc atcgtctttc cttctacctt ggaagcgtgt attcaaggtc accgattccc 1440

aggtatttat ttcttattgg ttaactggta tgcctagctt gtgcaacgtg atattaatat 1500

gcaattagga tgagagattt ggagcatagg tttatgacta tttataggca tttgctcaaa 1560

aagggaagac ctaatttgct gcacaaaatg cattttgcca tgtttgtgat cagtgacatg 1620

ctggcagcat ttcttaataa ttcttatatg ttctcattgt catttcttat cttagtgttt 1680

ttgttatttt tcatttgact agttaactat aatctattta ccagattgaa gtagctgtac 1740

gtgacaatgc gcagcgattg tttgcttcca agctgaaatc agttggcaga ggtaattgtg 1800

tagtcagtaa ttcctcttgg tccttgtttg ctcttactgt aacaaagttg atcaactaac 1860

tcacatttac tcctcgagaa gttgtcataa cttcatacta ctatattact ggagaaatga 1920

ttggaaatga taatcttgtt ttgtaattgt gcatgcattt cttattaaat aaagccttta 1980

aattttgctt gtactcatct agtatgctgg attttgttct gtaattctct agaattacta 2040

tcatccaaac taacaaattc tttctatagc aatttttaga agttttaaat caggtttatt 2100

tcctaagtgt taaccaatga tttcttgcca gatattgatg cagaaaaact tgttgcacta 2160

agaaaagaac aacaattatg tcgcctttct gatgaggttc attttcatta tttcttcttt 2220

cataactttc aacttctctg ggttaaatcc ctgtctttgt cttgccatca aatagttcct 2280

tggtatagta taatcttttt attaattaaa ggaaattttc attgaagctt gctgagaact 2340

tgtttagaga tcacacaagg aaattggttg aggaaaatat ttcagaggca aatagaatac 2400

ttaaatctcg caccaaagca gtgtaagatt catggttttt ctaagtattc ttttttttaa 2460

gtattaaatt ttgaattctg ggcatgtttt tcttgccatt tgtttcatta gtgttactat 2520

tcatttctta atttttacaa aaatagaatt tgccatatct gatcatctgt aagtttcagt 2580

cctggagcta cgcaggcaat tgcagagctg gataaggtat tggcatttaa taatttactc 2640

atctcattta agaatcatcc agatgtggat cgctttgctc gtggtgttgg tccaatttct 2700

ttagtgggta agtgtctgtg actaggtgtg tgtgtgtgtg tgtgtgtgtg tgtgtgtgta 2760

taacatgttc ttttctcttt ttaatcttaa ttcttgaagt ttaccacaat tcatttttgg 2820

cataggtgga gagtatgatg gtgacagaaa aatagaggac ttgaaactcc tttacagggc 2880

atatgtttca gatgctttgt ctggtgggcg catggaagat gataaggtaa ataaccaaga 2940

caattggata tgaactgtga acttcttaag atgtgttttc tcaatattct aatatatttt 3000

gaagttgagt ttgggttagt gttttccaga tgtatgtagt gattgaatag tatattttct 3060

aaaaaaattg gagtattcag cagctattta tatcatattg gagtattcac ttcccatggg 3120

tataatagag attgaaacct agcagtttag ccttagttat tctttattgt ttcttatgtt 3180

ttatctttct ttttgatgta gtaccaattg ccaaatcatg attgaacagg ctgttcagtg 3240

catgctacca tatccatatt gctcttattc ttatttttaa tatttcagtt agggcagtat 3300

attattttca gtacaagggt atttgtttac tgtatcaagc ctaatgaatt ttcacttatt 3360

gaagcatttt ttagtgttat aaaacaatgt cctgtctcct tgcttaacac taacaactta 3420

aagcttttag gtcaggtgat ttgttgactg ttaagatgta ctagcatacg attccccttt 3480

gaatatagtt gcatatgttc tctaatcttc ctttaatgag tcaacattca gataagcaaa 3540

gacacaacag tgtctcgaaa accatgatat ccattactaa agagttctta ttgatataag 3600

atatgaaact tgatctgtca aaacacttat tttttaatat aaaataaaaa atatatttta 3660

aatatattta ttattcgttg cagcttgctg cactaaatca gttacgaaat atattcggac 3720

tgggtaaacg tgaagccgag gccatttcac ttgatgttac gtcgaaggta tatcgcaaac 3780

gacttgcaca ggctgctgca gatggtgagt tagaaatggc tgatagcaaa gcagccttcc 3840

ttcaaaatct atgtgatgaa cttcattttg atccacaaaa ggccagtgaa cttcatgaag 3900

gtaaaactcg tcatgtttac agttagttgg aagttgacta tatttgaggc ctttattatt 3960

gaacacttta tgtgctgtcg gtttttattt atgtgcaatt cttaaatctt aaggttgtaa 4020

aatgtaaact tgtaaaaccc tttctacatg atgtgacttt tttttatata tatatttagt 4080

tataacacaa tctaatgata gtttattatt tttaagaaat ttatcggcaa aagcttcaga 4140

gatgtgtagc tgatggggag ctcaatgagg aggatgttgc tgctttgttg aggatgcgtg 4200

taatgctctg cataccgcaa cagattgttg aagcagctca ttcagatatc tgtggcagtt 4260

tgtttgaaaa ggtagtcaac gttacttttt cctatctaat tgtttggtcc ttcataagtg 4320

tcaaattagt gaaattacat atttcttgct atgcagaagt gcggtccatc catgcactgt 4380

aacaaactga taatgataat atgaatacat ggatgaacac taaaattgct ttacatatga 4440

atatgggttc aagatgatta tggaactatg gttatcaaac tcattctact ttctatttga 4500

atattggtag catgagaagt tacagctgtc acattttaat gtgttgataa acctgataat 4560

gctttcattt actggtagtg tggagatgga gaccatgaat ctactgcatt tttttttatc 4620

ttacaggaaa gatacactgt tgtactctgt actctgcatg ctaggttttg tctagaattt 4680

ctaaaatgtg tatctattgg aattgttact ttcaactgct tgtaatttat ttgggctttg 4740

tcttttcaat ttgtagacct gtatctactt gctataaaat ctgtttattg gtttgattat 4800

cttatatcaa agttgtacaa gtctagattc tatagtgctt agttgatggc agcgatatgt 4860

gaagaaatgg gtctgtttta ttttgatata tcatgagtct tgtttcaatc tccatcaaag 4920

atgttcaaaa ttttgttgag ttattactaa ttcatgtttc tccttttata ggttgtcaag 4980

gaggcaattg catcaggggt tgatggatat gatgctgaaa tccagaaatc agtaagaaaa 5040

gcagcacatg gcctgcgact tactagggag gttgctatgt ctattgcaag caaggcggtg 5100

agtatcaagt tatcagaaac tcaatggtga tttataaaga tttgaatagg tttaaatttc 5160

actgaggttt tttggaatta taggtaagga agatttttat taattacata aaacgtgcac 5220

gggcagctgg aaatcgtacc gagtctgcga aagaactgaa gaagatgata gccttcaaca 5280

ccttagttgt aactaatttg gtggaggaca ttaaagggga gtcaactgat atttcctctg 5340

aagaacctgt gaaagaggac attacacaaa ctgacgatga agaatgggaa tcacttcaga 5400

cactcaagaa aataagacca aataaagaac ttacggaaaa gttgggaaaa cctggtcaga 5460

cagaaattac tctgaaagat gatcttcctg aaagggatag gactgatctt tacaagacat 5520

acttacttta ttgtctaact ggtgaagtga caagggttcc atttggtgct cagatcacta 5580

ctaagaagga tgattctgag tatcttcttc taaatcagct tggtgggatc ctgggattga 5640

gtagtcaaga aatagtggaa gtgcacaggg gtctagctga gcaggctttt aggcaacagg 5700

ctgaggtaat tttagccgat ggacagttga caaaggccag ggtggagcag cttaataacc 5760

tccagaaaca agtaggctta cctcaagaat atgctcagaa aataatcaag agtataacca 5820

ctacaaaaat ggcagctgcc attgaaactg ctgtaactca agggaggctc aatatgaagc 5880

agataaggga acttaaggaa gctgatgttg atttagacag tatggtatct gagaacttga 5940

gagagaccct cttcaaaaaa actgttgatg acattttctc atccggtact ggagagtttg 6000

acactgagga agtatatgaa aaaatcccgt cagatctcaa cattaacaaa gagaaggcac 6060

gaggtgttgt tcatgagctt gcaaagggta gactatccaa ctctctgatt caggctgtct 6120

ctctactaag acagagaaat cagcagggag tggtaagtaa tattcaaagc ttcatgttca 6180

cttagtacta gtttggattt atgctggatt atctaaaatt acactcaaat actagatcac 6240

gtgaagtaaa tgttcataaa ttttttgttt cactttaaga aattgattct gagttgaagc 6300

aattttaggt aactttttct gttgaataaa aaaggtttat gttaagtttt attattaact 6360

tgctttcatt aaaaaaaaac ctccaaacat aaatcttttc acttcaaaat caattatgca 6420

aaatctactt cattcataat caattttgca aatgtttgtc ccaacacact tagtgcgtgt 6480

ttgtacaagc attggcaaat tgattttaaa ttgaattgat tttagttaaa ttgatttgaa 6540

agtgatgtga tttatgttta agtacaacat tttagatcca tcgtaaaaat tactcaaagg 6600

tcctttaact tagagtcaat tttggactta gaatcaattc tgaattcttc tttaacagga 6660

aaccaaacac gaaaatttat caaaaagcca ttctccaatg tgaaacaaaa cttgcactta 6720

ttcaaacagc ttttttacgt ttgtttgtca tggataatca tgtgtgattg cttcttttct 6780

tttgtgcagg tttcttcact caatgacttg ctggcatgtg acaaagcagt accctcacag 6840

ccagtttcat gggaagtgcc agaggagctt tctgatctat acaccatata cttgaagagt 6900

aatccaactc ctgagaattt gtctcgtttg caatatctgt tgggtataaa tgattccaca 6960

gctgctgctc ttagggagat tggagataga ttactcaata ctactgcgga ggaagagaag 7020

tttgtattct agtcttgtga taaaatgttt ggcattttag gcacactaga gaggctgcaa 7080

gtccccttaa ttttgccatt ttttattttc cattttgttt aacggtagca gaaaaagaat 7140

atcacgatgt ataaactttg gaatagagat gagtgcagtg ctgaaatctt agataatatt 7200

ttgtttgaga cagttgaatt aatcaattgc tattttttat gaatgaaaat aagttttcat 7260

aatcgtggac aagttttatc 7280

<210> 9

<211> 995

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 9

Met Asn Pro Ser Thr Leu Thr Pro Ser His Thr His Arg Pro Leu Leu

1 5 10 15

Leu Pro Ser Pro Phe His Thr Arg Arg Arg Arg Phe Lys Val Ser Leu

20 25 30

Pro Arg Cys Ser Ser Ser Ser Ala Ala Ser Ser Pro Pro Pro Pro Pro

35 40 45

Pro Pro Pro Pro Gln Arg Pro Pro Lys Asp Leu Lys Gly Ile Asp Val

50 55 60

Leu Val Asp Lys Leu Ser Pro Pro Ala Arg Leu Ala Thr Ser Ala Val

65 70 75 80

Ile Val Ala Gly Ala Ala Ala Ala Gly Tyr Gly Leu Gly Ser Arg Phe

85 90 95

Gly Gly Ser Arg Tyr Ala Ala Leu Gly Gly Ala Val Ala Leu Gly Ala

100 105 110

Ala Asp Gly Ala Ala Ala Tyr Ala Leu Asn Ala Ala Ala Pro Gln Val

115 120 125

Ala Ala Val Asn Leu His Asn Tyr Val Ala Ala Phe Asp Asp Pro Ser

130 135 140

Lys Leu Lys Lys Glu Glu Ile Glu Ala Ile Ala Ser Lys Tyr Gly Val

145 150 155 160

Ser Lys Gln Asp Glu Ala Phe Lys Thr Glu Ile Cys His Ile Tyr Ser

165 170 175

Glu Phe Val Ser Ser Val Leu Pro Pro Gly Gly Glu Glu Leu Lys Gly

180 185 190

Asp Glu Val Asp Arg Ile Val Ser Phe Lys Asn Ser Leu Gly Ile Asp

195 200 205

Asp Pro Asp Ala Ala Ala Met His Met Glu Ile Gly Arg Lys Phe Phe

210 215 220

Arg Gln Arg Leu Glu Val Gly Asp Arg Asp Ala Asp Val Glu Gln Arg

225 230 235 240

Arg Ala Phe Gln Lys Leu Ile Tyr Val Ser Asn Leu Val Phe Gly Asp

245 250 255

Ala Ser Ser Phe Leu Leu Pro Trp Lys Arg Val Phe Lys Val Thr Asp

260 265 270

Ser Gln Ile Glu Val Ala Val Arg Asp Asn Ala Gln Arg Leu Phe Ala

275 280 285

Ser Lys Leu Lys Ser Val Gly Arg Asp Ile Asp Ala Glu Lys Leu Val

290 295 300

Ala Leu Arg Lys Glu Gln Gln Leu Cys Arg Leu Ser Asp Glu Leu Ala

305 310 315 320

Glu Asn Leu Phe Arg Asp His Thr Arg Lys Leu Val Glu Glu Asn Ile

325 330 335

Ser Glu Ala Asn Arg Ile Leu Lys Ser Arg Thr Lys Ala Val Pro Gly

340 345 350

Ala Thr Gln Ala Ile Ala Glu Leu Asp Lys Val Leu Ala Phe Asn Asn

355 360 365

Leu Leu Ile Ser Phe Lys Asn His Pro Asp Val Asp Arg Phe Ala Arg

370 375 380

Gly Val Gly Pro Ile Ser Leu Val Gly Gly Glu Tyr Asp Gly Asp Arg

385 390 395 400

Lys Ile Glu Asp Leu Lys Leu Leu Tyr Arg Ala Tyr Val Ser Asp Ala

405 410 415

Leu Ser Gly Gly Arg Met Glu Asp Asp Lys Leu Ala Ala Leu Asn Gln

420 425 430

Leu Arg Asn Ile Phe Gly Leu Gly Lys Arg Glu Ala Glu Ala Ile Ser

435 440 445

Leu Asp Val Thr Ser Lys Val Tyr Arg Lys Arg Leu Ala Gln Ala Ala

450 455 460

Ala Asp Gly Glu Leu Glu Met Ala Asp Ser Lys Ala Ala Phe Leu Gln

465 470 475 480

Asn Leu Cys Asp Glu Leu His Phe Asp Pro Gln Lys Ala Ser Glu Leu

485 490 495

His Glu Glu Ile Tyr Arg Gln Lys Leu Gln Arg Cys Val Ala Asp Gly

500 505 510

Glu Leu Asn Glu Glu Asp Val Ala Ala Leu Leu Arg Met Arg Val Met

515 520 525

Leu Cys Ile Pro Gln Gln Ile Val Glu Ala Ala His Ser Asp Ile Cys

530 535 540

Gly Ser Leu Phe Glu Lys Val Val Lys Glu Ala Ile Ala Ser Gly Val

545 550 555 560

Asp Gly Tyr Asp Ala Glu Ile Gln Lys Ser Val Arg Lys Ala Ala His

565 570 575

Gly Leu Arg Leu Thr Arg Glu Val Ala Met Ser Ile Ala Ser Lys Ala

580 585 590

Val Arg Lys Ile Phe Ile Asn Tyr Ile Lys Arg Ala Arg Ala Ala Gly

595 600 605

Asn Arg Thr Glu Ser Ala Lys Glu Leu Lys Lys Met Ile Ala Phe Asn

610 615 620

Thr Leu Val Val Thr Asn Leu Val Glu Asp Ile Lys Gly Glu Ser Thr

625 630 635 640

Asp Ile Ser Ser Glu Glu Pro Val Lys Glu Asp Ile Thr Gln Thr Asp

645 650 655

Asp Glu Glu Trp Glu Ser Leu Gln Thr Leu Lys Lys Ile Arg Pro Asn

660 665 670

Lys Glu Leu Thr Glu Lys Leu Gly Lys Pro Gly Gln Thr Glu Ile Thr

675 680 685

Leu Lys Asp Asp Leu Pro Glu Arg Asp Arg Thr Asp Leu Tyr Lys Thr

690 695 700

Tyr Leu Leu Tyr Cys Leu Thr Gly Glu Val Thr Arg Val Pro Phe Gly

705 710 715 720

Ala Gln Ile Thr Thr Lys Lys Asp Asp Ser Glu Tyr Leu Leu Leu Asn

725 730 735

Gln Leu Gly Gly Ile Leu Gly Leu Ser Ser Gln Glu Ile Val Glu Val

740 745 750

His Arg Gly Leu Ala Glu Gln Ala Phe Arg Gln Gln Ala Glu Val Ile

755 760 765

Leu Ala Asp Gly Gln Leu Thr Lys Ala Arg Val Glu Gln Leu Asn Asn

770 775 780

Leu Gln Lys Gln Val Gly Leu Pro Gln Glu Tyr Ala Gln Lys Ile Ile

785 790 795 800

Lys Ser Ile Thr Thr Thr Lys Met Ala Ala Ala Ile Glu Thr Ala Val

805 810 815

Thr Gln Gly Arg Leu Asn Met Lys Gln Ile Arg Glu Leu Lys Glu Ala

820 825 830

Asp Val Asp Leu Asp Ser Met Val Ser Glu Asn Leu Arg Glu Thr Leu

835 840 845

Phe Lys Lys Thr Val Asp Asp Ile Phe Ser Ser Gly Thr Gly Glu Phe

850 855 860

Asp Thr Glu Glu Val Tyr Glu Lys Ile Pro Ser Asp Leu Asn Ile Asn

865 870 875 880

Lys Glu Lys Ala Arg Gly Val Val His Glu Leu Ala Lys Gly Arg Leu

885 890 895

Ser Asn Ser Leu Ile Gln Ala Val Ser Leu Leu Arg Gln Arg Asn Gln

900 905 910

Gln Gly Val Val Ser Ser Leu Asn Asp Leu Leu Ala Cys Asp Lys Ala

915 920 925

Val Pro Ser Gln Pro Val Ser Trp Glu Val Pro Glu Glu Leu Ser Asp

930 935 940

Leu Tyr Thr Ile Tyr Leu Lys Ser Asn Pro Thr Pro Glu Asn Leu Ser

945 950 955 960

Arg Leu Gln Tyr Leu Leu Gly Ile Asn Asp Ser Thr Ala Ala Ala Leu

965 970 975

Arg Glu Ile Gly Asp Arg Leu Leu Asn Thr Thr Ala Glu Glu Glu Lys

980 985 990

Phe Val Phe

995

Claims (4)

1. SoybeanGmTic110A mutant of a gene, characterized in that the nucleotide sequence of the mutant:

(I) is shown as SEQ ID No. 8; or (b)

(II) a nucleotide sequence which encodes the same protein as the nucleotide sequence of (I) but which differs from the nucleotide sequence of (I) by the degeneracy of the genetic code.

2. The protein encoded by the mutant of claim 1, wherein the amino acid sequence of the protein is set forth in SEQ ID No. 9.

3. Biological material comprising the mutant according to claim 1 or the protein according to claim 2;

the biological material is one or more of recombinant expression vector, plasmid, expression cassette or recombinant bacteria.

4. Use of a mutant according to claim 1, a protein according to claim 2 or a biomaterial according to claim 3 in any one or more of the following:

(A) Application in regulating and controlling soybean chlorophyll; and/or

(B) Application in regulating and controlling soybean chloroplast development; and/or

(C) Application in regulating photosynthesis of soybean; and/or

(D) The application in the preparation of transgenic soybean; and/or

(E) Application in soybean protein subcellular localization.