CN113717989A - Herbicide-resistant insect-resistant transgenic soybean Jingdou 321 and specificity detection method thereof - Google Patents

Abstract

The invention provides a herbicide-resistant insect-resistant transgenic soybean Jingdou 321 and a specificity detection method thereof, which are obtained by inserting an expression frame consisting of glyphosate-resistant genes g2m-epsps, gr79m-epsps and insect-resistant genes cry1C into a No. 6 chromosome 9023775 and 902385 of a soybean genome by an agrobacterium-mediated method. The herbicide-tolerant insect-resistant transgenic soybean of the invention can be further improved by hybridization with an excellent soybean line to optimize other agronomic traits such as yield, quality and the like. A transformant specificity detection method is established by using primers derived from soybean genomes on both sides of the Jingdou 321 insertion site and primers derived from exogenous genes, and the binding region of the inserted T-DNA and plant genome DNA can be specifically identified, and the seeds and other tissues of the transgenic soybeans can be further identified.

Description

Herbicide-resistant insect-resistant transgenic soybean Jingdou 321 and specificity detection method thereof

Technical Field

The invention relates to the field of soybean transgenosis, in particular to herbicide-resistant insect-resistant transgenic soybean Jingdou 321 and a specificity detection method thereof.

Background

Soybeans are native to China and cultivated around the world. The plant is 30-90 cm high, the stem is thick, upright, dense, brown and long, hard, the leaves usually have 3 lobules, the leaves have vein, the leaves are yellow and soft, and the petiole is 2-20 cm long. The total pedicel usually has 5-8 scapes without stems and tightly squeezed flowers, the calyx is in the shape of needles, and the flowers are purple, light purple or white. Pod enlargement, slight bending, sagging, yellowish green, dense, brownish-yellow, hairy; 2-5 seeds, ellipse and near-spherical. At present, the non-transgenic soybean has poor drug resistance and poor resistance to lepidoptera pests.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides a transgenic method of herbicide-resistant insect-resistant transgenic soybean Jingdou 321, which has good drug resistance and good resistance to lepidoptera pests and is convenient to popularize.

In order to achieve the purpose of the invention, the invention adopts the technical scheme that:

a transgenic method of herbicide-tolerant insect-resistant transgenic soybean JingDou 321 is characterized in that a vector carrying glyphosate-resistant genes g2m-epsps, gr79m-epsps and insect-resistant genes cry1C is inserted into a No. 6 chromosome of soybean, and a foreign gene insertion site is located between the No. 6 chromosome of a soybean genome 9023775 and 9023856 to obtain transgenic soybean;

the soybean 321 soybean 5 'flanking sequence is located at 9032356..9023775 of the soybean reference genome No. 6 chromosome, and the soybean 3' flanking sequence is located at 9023856..9024356 of the soybean reference genome No. 19 chromosome.

As a modification, the vector used for transforming the g2m-epsps, gr79m-epsps and cry1C genes into soybean is pGR 18.

As an improvement, the expression frame position of the G2M-EPSPS gene is 6265-8837, and comprises 808bp 35S promoter, 1335bp G2M-EPSPS gene and 201bp PolyA terminator; the expression frame position of the Cry1C gene is 9070-12135, and the expression frame position consists of 835bp of a 35S promoter, 1893bp of a CrylC gene and 253bp of an NOS terminator; the expression frame position of GR79M-EPSPS gene is 12370-16167, including pUbi promoter 2036bp, GR79M-EPSPS gene 1338bp and PolyA terminator 196 bp.

As an improvement, the 5' flanking sequence of the soybean 321 of the Jingdou is located at 9032356..9023775 of the chromosome 6 of the soybean reference genome, and the specific sequence is as follows:

ATTGTGAAGAGTCTAAATTTATCGTTTTGGCGGCTGCATGTCCTGGTAACAATGACCTTTCTTTCTTAGGGCTTGAATTGAACTTTGGTTC TCTCAACGAGACAGCTTCTCATTTATTGCTGCGTCTAACCCTTATCATGGAAGAGTGCATGTTTTTGAGAACGCATGAAAGCAAATGAGAC ACGCAAAATATTCAATCCTTCAGCATGGCCCATTTTCCACTTGTAAGCTGGGAGTCCAATGACACTGATGTGTTAGGTAGAAATGGGCGTC ACTTTCCTAATACAGGTCGGATTTGAGCTTATTTCTTTTCCCATTTTAATGATGATTACATGGAGTTATAAAAACATAAGAATAATGCTAA TACATATTGCTGTGTATGTATACTCTCTTGTTTTTCGTTGATAAAGGTTGGTTTTA。

as an improvement, the 3' flanking sequence of the soybean of the Jingdou 321 is located at 9023856..9024356 of the chromosome 19 of the soybean reference genome, and the specific sequence is as follows:

AAGCACTTTATGTAGCACAATAATTTAAGTTGTTGTATAGCATTGTAAAGCATTTCCTTTATCACAATAGACTTCCCTAGATGTTCTAGCA AATTTCAACACTCAACTTCGTTCTTTATTTATCAATCAATTATCAAAAGTGCTTCTCTCTAATTTAAAATTAATTGATTATAAATCACAAG TTTTAACTAACCATTTTAAGTTCCCCTTTCTATATTTGTATTTTTAAATACTGAATGCAATATGTGTTTTGTTATTTTCAAATTTAATATA CTTGACGTGATGAGTTTATAATCAGCCAAATGAATGAAACTAATATATTGTTATTCACAATAATATTGTTAAATAGATGGGGGCATGGCTA TGAAAAATACCACGCCTCCTTTGTTAGCACTTTTATGGGTGATTCCAATTTATTTTTCAATGCAACAATGCTGATATATTGCTTTTATTAC GTAGGCATGAATATTCCATTGACAATAATTTGATTTAGACCTGGAA。

a specific detection method of herbicide-resistant insect-resistant transgenic soybean JingDou 321 comprises the following steps:

s1, primers JD321P-1 and JD321P-2 derived from soybean genomes on both sides of the Jingdou 321 insertion site and primers GR18LB-R and GR18RB-F derived from exogenous genes are utilized to respectively form a primer pair JD321P-1 and GR18LB-R capable of specifically detecting the 5 'insertion position and a primer pair GR18RB-F and JD321P-2 capable of specifically detecting the 3' insertion position in the Jingdou 321 soybean;

s2, setting a control group: no template control and receptor Jack control groups;

s3, carrying out PCR reaction on the three groups, and observing the amplification band condition of each group;

as an improvement, the PCR reaction conditions are as follows: denaturation at 94 ℃ for 4min, denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s, 35 cycles.

As an improvement, the sequence of the primer JD321P-1 is as follows: GACCTTTCTTTCTTAGGGCTTGA, the sequence of the primer JD321P-2 is: GCTAACAAAGGAGGCGTGGTAT, the primer GR18LB-R has the sequence: TGCCAAGACTTACCCTGATTACT, the primer GR18RB-F has the sequence: GGGTCAAGGTTCCGCACATT are provided.

A kit for detecting the presence of transgenic soybean kyo 321 plant material in a sample, the kit comprising the exogenous gene of claim 1, the primer pair of claim 6.

The invention has the beneficial effects that:

the invention can replace EPSPS enzyme combined by glyphosate in plant body to execute function under the condition of glyphosate, so that the plant is protected from being poisoned by the glyphosate, the tolerance to herbicide can be greatly improved, and the resistance of the plant to lepidoptera pests can be enhanced.

Drawings

FIG. 1 is a view of a vector used for transgenic soybean;

FIG. 2 shows transgenic soybean T₁-T₄A culture view;

FIG. 3 is a view of identification of transgenic soybean T4 generation material glyphosate resistance;

FIG. 4 is a view of the identification of the resistance of transgenic soybean T3 generation (A) and T4 generation (B) plants to target pests;

FIG. 5 is a schematic diagram of the structure of the insertion sequence of transgenic soybean and its relative position on chromosome 6 of soybean;

FIG. 6 is a schematic diagram of the relative positions of specific detection primers in the genome of transgenic soybean;

FIG. 7 is a schematic diagram of the insertion site-specific PCR detection of the 5 'end (A) and the 3' end (B) of transgenic soybean.

Detailed Description

The following further describes embodiments of the present invention with reference to the accompanying drawings. In which like parts are designated by like reference numerals.

In order to make the content of the present invention more clearly understood, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention.

As shown in figures 1-7, a transgenic method of herbicide-resistant insect-resistant transgenic soybean Jingdou 321, a transgenic transformation vector of the soybean is pGR18, the transgenic transformation vector has genes g2m-epsps, gr79m-epsps and cry1C as shown in figure 1, and the used vector does not have a screening marker gene and a reporter gene except a target gene. The kanamycin resistance gene kanR, which remains as a selectable marker gene for bacteria, is not present in T-DNA and therefore cannot be inserted into the plant genome, but merely serves as a selectable marker for growth of e.coli and agrobacterium during vector construction. The various elements in the vector are derived from plasmids of E.coli and Agrobacterium, respectively. The vector is not pathogenic, nor is there the possibility of evolving into pathogenicity.

The agrobacterium-mediated soybean cotyledonary node transformation method is adopted, the agrobacterium strain is Ag10, soybean cotyledonary node is sterilized and then callus is induced, then the soybean cotyledonary node is co-cultured with agrobacterium to infect callus, the transformed callus is screened, and then plant regeneration is carried out on selection culture.

Obtaining of sterile explants: selecting normal-germination pollution-free seedlings to prepare explants. Cutting the soybean along the hypocotyl with a scalpel in an ultraclean workbench, keeping the hypocotyl with the length of 3-4mm, placing the cut into a sterile culture dish, adding a proper amount of co-culture solution into the dish to facilitate peeling off the seed coat, vertically cutting the hypocotyl along the cotyledon hypocotyl, removing clean true leaf tissue, and making 5-7 cuts axially at the joint of the cotyledon and the cotyledon hypocotyl, wherein the cuts are about 3-4mm long. Each explant consists of a cotyledon with a hypocotyl, and two explants can be formed from one seed.

Preparation of agrobacterium: and taking the agrobacterium strain preserved at low temperature out of an ultra-low temperature refrigerator, freezing and thawing the agrobacterium strain on ice, dipping a small amount of strain by using an inoculating loop or an aseptic gun head, and inoculating the strain on an LB (lysogeny broth) plate, wherein an LB solid culture medium contains 50mg/L of corresponding antibiotics. Placing the culture medium under the constant temperature condition of 28 ℃ for inverted culture for 1-2 d to obtain a monoclonal antibody. After 2d, single clones were picked and inoculated in 5ml YEP medium (containing the corresponding antibiotic) at 220rpm, 28 ℃ overnight activation culture (about 12 h). When the bacterial liquid is activated to saturation state for the first time, 1ml of bacterial liquid is extracted from the bacterial liquid and inoculated into a triangular shaking flask containing 100ml of YEP (containing corresponding antibiotics), and the bacterial liquid is activated for the second time under the conditions of 28 ℃ and 220 rpm. When the agrobacterium is fully activated to OD600 about 1.0, the bacterial liquid is centrifuged for 10min at 4000rpm and 4 ℃, the supernatant is discarded, the precipitate is collected, the thalli precipitated at the bottom of the tube are suspended by the same volume of coculture liquid, and the OD600 is about 0.5-0.8 at the moment for standby.

Co-culturing explants and agrobacterium: when the explants are prepared, every 40-60 explants are placed in a 100ml triangular flask, about 50ml of resuspended agrobacterium liquid is added in each flask, and the liquid needs to be over the explants. Co-infecting in dark or low light for 30-35min, and shaking the flask once every 5min to make the Agrobacterium and the explant fully contact. After infection, carefully pouring out the redundant agrobacterium liquid, spreading a layer of sterile filter paper on a co-culture medium, spreading the impregnated explant on the filter paper with the axial side facing downwards, and co-culturing for 3d at 24 ℃ under the dark or weak light condition.

Resistance selection and regeneration: after co-culturing for 3d, obtaining a regeneration plant from the explant through stages of resistance cluster bud induction, elongation bud induction, rooting and the like; respectively adding proper resistance screening agents in the cluster bud induction and elongation stages, adding agrobacterium bacteriostat and IBA with proper concentration in the rooting stage according to the actual requirements in the experiment to induce rooting, subculturing the explant once every two weeks in the cluster bud induction and elongation bud induction stages, and preparing a new cut on the back of the explant during subculturing so that the explant can better absorb nutrients. The extended bud is extended to 4-6cm, can induce rooting, and after rooting, the sealing film on the culture dish is uncovered to open and harden the seedling for 1-3 days; then transplanting to a pot plant or a field for growth to obtain a transgenic plant.

And carrying out field glyphosate resistance identification on T3-T4 transgenic soybeans and non-transgenic soybeans. A 41% glyphosate solution was used and the hand-held pressure sprayer was Hudson corporation, usa. At the first to third leaf-recovering period, 6L/ha of glyphosate isopropylamine (Roundup) solution was sprayed thereon, and phytotoxicity was investigated after 2 weeks. The result shows that under the spraying dosage, the non-transgenic soybean has no resistance, and all plants die after 2 weeks; the T3 generation homozygous transgenic soybean line has no inhibition on growth, leaves are not faded, shrunken and has no glyphosate phytotoxicity reaction such as new leaf yellowing. This indicates that transgenic soybeans exhibit high resistance to glyphosate (fig. 2). Similarly, transgenic soybean lines homozygous for the T4 generation also showed no inhibition of growth, no chlorosis and shrinkage of leaves, and no glyphosate phytotoxicity reaction such as new leaf yellowing (FIG. 3). The glyphosate resistance in the transgenic soybean can be stably inherited in different generations.

The exogenous gene is inserted into chromosome 6 in the transgenic soybean. Design of specific primers As shown in the following table, PCR detection and sequencing analysis were performed on the insertion sites, which revealed that the insertion sites of foreign genes were between chromosome 6 of soybean genome, 9023775 and 9023856 (FIG. 5), and the T-DNA sequence in transgenic soybean 321 was identical to the sequence of the corresponding genetic elements of the plasmid vector GR 18. Specificity identification PCR primers and product information table:

the sequence of the soybean 321 soybean 5' flanking sequence obtained by sequencing is located at 9032356..9023775 of the soybean reference genome No. 6 chromosome, as shown in SEQ ID NO: 7, 3' end flanking sequence is located on position 9023856..9024356 of chromosome 19 of soybean reference genome, as shown in SEQ ID NO: 8.

The inserted T-DNA fragments in the transgenic soybean all comprise expression cassettes of three gene elements: the G2M-EPSPS gene expression cassette (position 6265-8837) comprises 808bp of 35S promoter, 1335bp of G2M-EPSPS gene and 201bp of polyA terminator; cry1C gene expression frame (position 9070-; GR79M-EPSPS gene expression cassette (position 12370-16167) comprising pUbi promoter 2036bp, GR79M-EPSPS gene 1338bp and PolyA terminator 196 bp.

Primers (JD321P-1 and JD321P-2) derived from soybean genomes on both sides of the transgenic soybean insertion site and primers (GR18LB-R and GR18RB-F) derived from exogenous genes respectively form a primer pair 1(JD321P-1 and GR18LB-R) capable of specifically detecting the 5 'insertion position and a primer pair 2(GR18RB-F and JD321P-2) capable of specifically detecting the 3' insertion position in the soybean 321, the positions of each primer and the sizes of amplified fragments are shown in the figure, and the sequences of the amplified products are as described above. And (3) PCR reaction conditions: denaturation at 94 ℃ for 4min, denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s, 35 cycles. As expected, no PCR product was produced for the no template control (lane 1) and the receptor (lane 2). Jingdou 321 (lanes 3-5) amplified a 655bp band using primer pair 1 located 5 'of the insertion site and a 813bp band using primer pair 2 located 3' of the insertion site (FIG. 7).

Wherein, A: the amplification result of primer pair 1(JD321P-1 and GR18 LB-R); b: amplification results for primer pair 2(GR18RB-F and JD 321P-2). M: DNA marker; 1: sterile water control; 2: jack receptor controls; 3-5: different positive individuals of transgenic soybean.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the present invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention should be included in the scope of the present invention.

Sequence listing

<110> institute of crop science of Chinese academy of agricultural sciences

<120> herbicide-resistant insect-resistant transgenic soybean Jingdou 321 transgene and specificity detection method

<130> 2020.12.10

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1335

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 1

atggcttgcc tcccagatga ttcggggcct cacgttgggc atagcacgcc gcctcgcctc 60

gaccaggagc cttgcactct cagcagccag aagaccgtga cggtcacacc gcccaacttc 120

ccactgacgg gcaaggtggc tccacctggg tcgaagtcta tcacaaatag ggctctcctg 180

ctcgctgctc tcgctaaggg cacttcaagg ctgtccgggg ctctcaagtc tgacgatacc 240

cggcacatgt cagtcgccct gcgccagatg ggcgttacca tcgacgagcc cgacgatacc 300

acgttcgtgg tcacaagcca gggctcgctg cagctcccag ctcagcctct gttcctcggc 360

aacgctggga ctgcgatgag gttcctgacc gctgctgtcg ctactgttca gggcaccgtt 420

gtgctcgacg gggatgagta catgcagaag aggcccatcg gcccactgct cgctacgctc 480

ggccagaatg ggattcaggt cgactcccca acgggctgcc caccagttac agtgcacggc 540

atggggaagg tgcaggcgaa gcgcttcgag atcgacggcg ggctgtccag ccagtacgtc 600

agcgctctgc tcatgctcgc tgcttgcggc gaggctccta tcgaggtggc tctgacaggg 660

aaggacattg gcgctagggg ctacgtcgac ctgaccctcg attgcatgag ggctttcggc 720

gctcaggtgg atgctgtcga cgatacaact tggagggtgg ctccaactgg ctacaccgct 780

catgactacc tcatcgagcc tgatgcttcc gctgctactt acctgtgggc tgctgaggtt 840

ctcaccggcg ggaggatcga cattggcgtg gctgctcagg acttcaccca gccagatgct 900

aaggcccagg cggtcatcgc gcagttcccc aacatgcagg ctactgtcgt tggctcccag 960

atgcaggacg ctattccaac gctggccgtg ctcgccgcgt tcaacaatac gcctgtccgc 1020

ttcacagagc tggcgaacct ccgcgttaag gagtgcgaca gggtgcaggc cctgcatgat 1080

ggcctcaatg agatcaggcc aggcctggct acgattgagg gggacgatct gctcgtggct 1140

tcggacccag ctctggctgg cacggcgtgc acagctctca tcgacaccca cgcggatcat 1200

cggattgcta tgtgcttcgc gctggctggc ctcaaagtca gcgggatccg cattcaggac 1260

ccggattgcg ttgccaagac ttaccctgat tactggaagg ctctggcgtc cctgggcgtt 1320

cacctcaatg attag 1335

<210> 2

<211> 444

<212> PRT

<213> Artificial Synthesis (Artificial Sequence)

<400> 2

Met Ala Cys Leu Pro Asp Asp Ser Gly Pro His Val Gly His Ser Thr

1 5 10 15

Pro Pro Arg Leu Asp Gln Glu Pro Cys Thr Leu Ser Ser Gln Lys Thr

20 25 30

Val Thr Val Thr Pro Pro Asn Phe Pro Leu Thr Gly Lys Val Ala Pro

35 40 45

Pro Gly Ser Lys Ser Ile Thr Asn Arg Ala Leu Leu Leu Ala Ala Leu

50 55 60

Ala Lys Gly Thr Ser Arg Leu Ser Gly Ala Leu Lys Ser Asp Asp Thr

65 70 75 80

Arg His Met Ser Val Ala Leu Arg Gln Met Gly Val Thr Ile Asp Glu

85 90 95

Pro Asp Asp Thr Thr Phe Val Val Thr Ser Gln Gly Ser Leu Gln Leu

100 105 110

Pro Ala Gln Pro Leu Phe Leu Gly Asn Ala Gly Thr Ala Met Arg Phe

115 120 125

Leu Thr Ala Ala Val Ala Thr Val Gln Gly Thr Val Val Leu Asp Gly

130 135 140

Asp Glu Tyr Met Gln Lys Arg Pro Ile Gly Pro Leu Leu Ala Thr Leu

145 150 155 160

Gly Gln Asn Gly Ile Gln Val Asp Ser Pro Thr Gly Cys Pro Pro Val

165 170 175

Thr Val His Gly Met Gly Lys Val Gln Ala Lys Arg Phe Glu Ile Asp

180 185 190

Gly Gly Leu Ser Ser Gln Tyr Val Ser Ala Leu Leu Met Leu Ala Ala

195 200 205

Cys Gly Glu Ala Pro Ile Glu Val Ala Leu Thr Gly Lys Asp Ile Gly

210 215 220

Ala Arg Gly Tyr Val Asp Leu Thr Leu Asp Cys Met Arg Ala Phe Gly

225 230 235 240

Ala Gln Val Asp Ala Val Asp Asp Thr Thr Trp Arg Val Ala Pro Thr

245 250 255

Gly Tyr Thr Ala His Asp Tyr Leu Ile Glu Pro Asp Ala Ser Ala Ala

260 265 270

Thr Tyr Leu Trp Ala Ala Glu Val Leu Thr Gly Gly Arg Ile Asp Ile

275 280 285

Gly Val Ala Ala Gln Asp Phe Thr Gln Pro Asp Ala Lys Ala Gln Ala

290 295 300

Val Ile Ala Gln Phe Pro Asn Met Gln Ala Thr Val Val Gly Ser Gln

305 310 315 320

Met Gln Asp Ala Ile Pro Thr Leu Ala Val Leu Ala Ala Phe Asn Asn

325 330 335

Thr Pro Val Arg Phe Thr Glu Leu Ala Asn Leu Arg Val Lys Glu Cys

340 345 350

Asp Arg Val Gln Ala Leu His Asp Gly Leu Asn Glu Ile Arg Pro Gly

355 360 365

Leu Ala Thr Ile Glu Gly Asp Asp Leu Leu Val Ala Ser Asp Pro Ala

370 375 380

Leu Ala Gly Thr Ala Cys Thr Ala Leu Ile Asp Thr His Ala Asp His

385 390 395 400

Arg Ile Ala Met Cys Phe Ala Leu Ala Gly Leu Lys Val Ser Gly Ile

405 410 415

Arg Ile Gln Asp Pro Asp Cys Val Ala Lys Thr Tyr Pro Asp Tyr Trp

420 425 430

Lys Ala Leu Ala Ser Leu Gly Val His Leu Asn Asp

435 440

<210> 3

<211> 1338

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 3

atgtcgcatt ccacttcgcg gtcgccctgg agcaaggcta cggagtacca cgaggccctg 60

gtcaccccaa caagcaacaa gatcaatggc gagatcttcg tcccagggtc aaagtcctac 120

acaaaccgcg cgctcatcat tgccgcgctg gctgagggca catccactct caaggggatt 180

ctgaagagcg acgattcgta ctggtgcatc gacgctctca ggaggctggg catcaagatt 240

gaggttgcgg aggagaccgt gacgatccac ggctgcggcg ggaagtggcc agtgcagtcc 300

gctgagctct tcattggcgc tgctgggacc atcgccaggt tcctcccagg cgctctggct 360

gtcgctcagc agggcgagtg gatcgtggac ggggtccctc agctgaggga gaggccgctc 420

aagcccctgg tggatgctct cacccagctg ggcgggcgga tcgagtacct cacggagcac 480

ccaggcctcc ctctgagggt gaagggcgct gggctgtctg gccagcatgt gagggtcccg 540

gggaatgtct ccagccagtt cctctcaggc ctcctgatcg cgtctcccta cgcctcagag 600

gcggtgtcca ttgaggtcat caacggcctc gtccagccgt cgtacatcgc gattaccatc 660

cagctgatga gggagttcgg cgctaaggtt gagcacaatg aggactactc tctcttcaag 720

gtgtacccca caggctacca ggggcgggac actattctgg aggccgatgc gagcacggcc 780

tgctacttcc tctcgctggc tgctctcaca ggcgggacta tccaggttaa gaacgtgggc 840

taccattcct accagccgga cgcgcgcttc attgatgtgc tggagcagat gggctgcgag 900

gtcatcaaga atgagtcctt cctcgaggtc accggcccaa cgaggctgaa gggcgggttc 960

gaggttgaca tgaagcctat gagcgatcag gccctcacaa tcggcgctct ggctccattc 1020

gctgacgctc ctattcgggt cactaacgtt gctcacatca gggcccatga gtccgaccgc 1080

attgcggtga tctgctcgtc tctccagcag atgggcgttc aggtggagga gagggaggac 1140

gggttcacca tctacccagg ccagccagtg gggaccacgc tgaacccgca cgacgatcat 1200

cggaatgcca tggtcttcgg cctcctgggg gtcaaggttc cgcacattcg catcgtcgat 1260

cccggctgcg tttcgaagac ctgccccgct tacttcgagg agctccagaa gttcggcatc 1320

cacgttgagt acaattag 1338

<210> 4

<211> 445

<212> PRT

<213> Artificial Synthesis (Artificial Sequence)

<400> 4

Met Ser His Ser Thr Ser Arg Ser Pro Trp Ser Lys Ala Thr Glu Tyr

1 5 10 15

His Glu Ala Leu Val Thr Pro Thr Ser Asn Lys Ile Asn Gly Glu Ile

20 25 30

Phe Val Pro Gly Ser Lys Ser Tyr Thr Asn Arg Ala Leu Ile Ile Ala

35 40 45

Ala Leu Ala Glu Gly Thr Ser Thr Leu Lys Gly Ile Leu Lys Ser Asp

50 55 60

Asp Ser Tyr Trp Cys Ile Asp Ala Leu Arg Arg Leu Gly Ile Lys Ile

65 70 75 80

Glu Val Ala Glu Glu Thr Val Thr Ile His Gly Cys Gly Gly Lys Trp

85 90 95

Pro Val Gln Ser Ala Glu Leu Phe Ile Gly Ala Ala Gly Thr Ile Ala

100 105 110

Arg Phe Leu Pro Gly Ala Leu Ala Val Ala Gln Gln Gly Glu Trp Ile

115 120 125

Val Asp Gly Val Pro Gln Leu Arg Glu Arg Pro Leu Lys Pro Leu Val

130 135 140

Asp Ala Leu Thr Gln Leu Gly Gly Arg Ile Glu Tyr Leu Thr Glu His

145 150 155 160

Pro Gly Leu Pro Leu Arg Val Lys Gly Ala Gly Leu Ser Gly Gln His

165 170 175

Val Arg Val Pro Gly Asn Val Ser Ser Gln Phe Leu Ser Gly Leu Leu

180 185 190

Ile Ala Ser Pro Tyr Ala Ser Glu Ala Val Ser Ile Glu Val Ile Asn

195 200 205

Gly Leu Val Gln Pro Ser Tyr Ile Ala Ile Thr Ile Gln Leu Met Arg

210 215 220

Glu Phe Gly Ala Lys Val Glu His Asn Glu Asp Tyr Ser Leu Phe Lys

225 230 235 240

Val Tyr Pro Thr Gly Tyr Gln Gly Arg Asp Thr Ile Leu Glu Ala Asp

245 250 255

Ala Ser Thr Ala Cys Tyr Phe Leu Ser Leu Ala Ala Leu Thr Gly Gly

260 265 270

Thr Ile Gln Val Lys Asn Val Gly Tyr His Ser Tyr Gln Pro Asp Ala

275 280 285

Arg Phe Ile Asp Val Leu Glu Gln Met Gly Cys Glu Val Ile Lys Asn

290 295 300

Glu Ser Phe Leu Glu Val Thr Gly Pro Thr Arg Leu Lys Gly Gly Phe

305 310 315 320

Glu Val Asp Met Lys Pro Met Ser Asp Gln Ala Leu Thr Ile Gly Ala

325 330 335

Leu Ala Pro Phe Ala Asp Ala Pro Ile Arg Val Thr Asn Val Ala His

340 345 350

Ile Arg Ala His Glu Ser Asp Arg Ile Ala Val Ile Cys Ser Ser Leu

355 360 365

Gln Gln Met Gly Val Gln Val Glu Glu Arg Glu Asp Gly Phe Thr Ile

370 375 380

Tyr Pro Gly Gln Pro Val Gly Thr Thr Leu Asn Pro His Asp Asp His

385 390 395 400

Arg Asn Ala Met Val Phe Gly Leu Leu Gly Val Lys Val Pro His Ile

405 410 415

Arg Ile Val Asp Pro Gly Cys Val Ser Lys Thr Cys Pro Ala Tyr Phe

420 425 430

Glu Glu Leu Gln Lys Phe Gly Ile His Val Glu Tyr Asn

435 440 445

<210> 5

<211> 1893

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 5

atggaggaga acaatcagaa ccagtgtatc ccttacaatt gtctttctaa tcctgaagaa 60

gttcttttgg atggagaaag gatctcaact ggtaactcat caattgacat ctctctctca 120

cttgttcagt tcttggtttc taactttgtg ccaggaggag gattccttgt tggacttatc 180

gacttcgttt ggggaatcgt tggaccttct caatgggatg catttctcgt tcagatcgaa 240

cagctcatca acgaaagaat cgctgagttc gctaggaatg ctgctattgc taaccttgaa 300

ggacttggaa acaacttcaa catctacgtg gaggcattca aggaatggga agaagatcct 360

aacaacccag caaccaggac cagagtgatc gataggttcc gtatccttga tggacttctt 420

gaaagggaca ttcctagctt taggatctct ggatttgaag ttccacttct ctctgtttac 480

gctcaagctg ctaatctcca tcttgctatc cttagagatt ctgtgatctt cggagaaaga 540

tggggattga caaccatcaa cgtgaacgag aactacaaca gactcatcag gcacatcgat 600

gagtacgctg atcactgtgc taacacttac aaccgtggac tcaacaacct tcctaagtct 660

acctatcaag attggatcac atacaaccga cttaggagag accttacatt gactgttctt 720

gatatcgctg ctttctttcc aaactatgac aataggagat atccaattca gccagttggt 780

caacttacaa gggaagttta cactgaccca ctcatcaact tcaacccaca gcttcagtct 840

gttgctcagc ttcctacctt caacgttatg gagagcagcg caatcagaaa tcctcacctc 900

ttcgacatct tgaacaacct tacaatcttt accgattggt ttagtgttgg acgtaacttc 960

tactggggag gacatcgagt gatctctagc ctcatcggag gtggtaacat cacatctcct 1020

atctacggaa gagaggctaa ccaggagcct ccaagatcat tcactttcaa cggacctgtg 1080

ttcaggactc tttcaaatcc tactcttcga cttcttcagc aaccttggcc agctccacca 1140

ttcaaccttc gtggtgttga aggagttgag ttctctacac ctacaaacag cttcacctat 1200

cgtggaagag gtactgttga ttctcttact gaacttccac ctgaggacaa cagtgtgcca 1260

cctcgtgaag gatacagtca tcgtctttgt catgcaacct tcgttcaaag atctggaaca 1320

cctttcctta caactggtgt tgtgttctct tggactcatc gtagtgcaac tcttaccaac 1380

acaattgatc cagagaggat caaccagatc cctcttgtga aaggattcag agtttgggga 1440

ggaacctctg tgattacagg accaggattc acaggaggtg atatccttcg aagaaacacc 1500

tttggtgact tcgtttctct tcaagtgaac atcaactcac caatcaccca aagataccgt 1560

cttagatttc gttacgcttc tagtagggat gcacgagtta tcgttcttac aggagctgca 1620

tctacaggag tgggaggtca agttagtgtg aacatgcctc ttcagaaaac tatggagatc 1680

ggagagaacc tcacatctag aacattcaga tacaccgact tcagtaatcc tttctcattc 1740

agagctaatc cagacatcat cggtatcagt gaacaacctc tcttcggtgc aggttctatc 1800

agtagcggtg aactttacat cgacaagatc gagatcatcc ttgcagatgc aacatttgaa 1860

gcagaatctg accttgaaag agcacaaaag tag 1893

<210> 6

<211> 630

<212> PRT

<213> Artificial Synthesis (Artificial Sequence)

<400> 6

Met Glu Glu Asn Asn Gln Asn Gln Cys Ile Pro Tyr Asn Cys Leu Ser

1 5 10 15

Asn Pro Glu Glu Val Leu Leu Asp Gly Glu Arg Ile Ser Thr Gly Asn

20 25 30

Ser Ser Ile Asp Ile Ser Leu Ser Leu Val Gln Phe Leu Val Ser Asn

35 40 45

Phe Val Pro Gly Gly Gly Phe Leu Val Gly Leu Ile Asp Phe Val Trp

50 55 60

Gly Ile Val Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile Glu

65 70 75 80

Gln Leu Ile Asn Glu Arg Ile Ala Glu Phe Ala Arg Asn Ala Ala Ile

85 90 95

Ala Asn Leu Glu Gly Leu Gly Asn Asn Phe Asn Ile Tyr Val Glu Ala

100 105 110

Phe Lys Glu Trp Glu Glu Asp Pro Asn Asn Pro Ala Thr Arg Thr Arg

115 120 125

Val Ile Asp Arg Phe Arg Ile Leu Asp Gly Leu Leu Glu Arg Asp Ile

130 135 140

Pro Ser Phe Arg Ile Ser Gly Phe Glu Val Pro Leu Leu Ser Val Tyr

145 150 155 160

Ala Gln Ala Ala Asn Leu His Leu Ala Ile Leu Arg Asp Ser Val Ile

165 170 175

Phe Gly Glu Arg Trp Gly Leu Thr Thr Ile Asn Val Asn Glu Asn Tyr

180 185 190

Asn Arg Leu Ile Arg His Ile Asp Glu Tyr Ala Asp His Cys Ala Asn

195 200 205

Thr Tyr Asn Arg Gly Leu Asn Asn Leu Pro Lys Ser Thr Tyr Gln Asp

210 215 220

Trp Ile Thr Tyr Asn Arg Leu Arg Arg Asp Leu Thr Leu Thr Val Leu

225 230 235 240

Asp Ile Ala Ala Phe Phe Pro Asn Tyr Asp Asn Arg Arg Tyr Pro Ile

245 250 255

Gln Pro Val Gly Gln Leu Thr Arg Glu Val Tyr Thr Asp Pro Leu Ile

260 265 270

Asn Phe Asn Pro Gln Leu Gln Ser Val Ala Gln Leu Pro Thr Phe Asn

275 280 285

Val Met Glu Ser Ser Ala Ile Arg Asn Pro His Leu Phe Asp Ile Leu

290 295 300

Asn Asn Leu Thr Ile Phe Thr Asp Trp Phe Ser Val Gly Arg Asn Phe

305 310 315 320

Tyr Trp Gly Gly His Arg Val Ile Ser Ser Leu Ile Gly Gly Gly Asn

325 330 335

Ile Thr Ser Pro Ile Tyr Gly Arg Glu Ala Asn Gln Glu Pro Pro Arg

340 345 350

Ser Phe Thr Phe Asn Gly Pro Val Phe Arg Thr Leu Ser Asn Pro Thr

355 360 365

Leu Arg Leu Leu Gln Gln Pro Trp Pro Ala Pro Pro Phe Asn Leu Arg

370 375 380

Gly Val Glu Gly Val Glu Phe Ser Thr Pro Thr Asn Ser Phe Thr Tyr

385 390 395 400

Arg Gly Arg Gly Thr Val Asp Ser Leu Thr Glu Leu Pro Pro Glu Xaa

405 410 415

Asn Ser Val Pro Pro Arg Glu Gly Tyr Ser His Arg Leu Cys His Ala

420 425 430

Thr Phe Val Gln Arg Ser Gly Thr Pro Phe Leu Thr Thr Gly Val Val

435 440 445

Phe Ser Trp Thr His Arg Ser Ala Thr Leu Thr Asn Thr Ile Asp Pro

450 455 460

Glu Arg Ile Asn Gln Ile Pro Leu Val Lys Gly Phe Arg Val Trp Gly

465 470 475 480

Gly Thr Ser Val Ile Thr Gly Pro Gly Phe Thr Gly Gly Asp Ile Leu

485 490 495

Arg Arg Asn Thr Phe Gly Asp Phe Val Ser Leu Gln Val Asn Ile Asn

500 505 510

Ser Pro Ile Thr Gln Arg Tyr Arg Leu Arg Phe Arg Tyr Ala Ser Ser

515 520 525

Arg Asp Ala Arg Val Ile Val Leu Thr Gly Ala Ala Ser Thr Gly Val

530 535 540

Gly Gly Gln Val Ser Val Asn Met Pro Leu Gln Lys Thr Met Glu Ile

545 550 555 560

Gly Glu Asn Leu Thr Ser Arg Thr Phe Arg Tyr Thr Asp Phe Ser Asn

565 570 575

Pro Phe Ser Phe Arg Ala Asn Pro Asp Ile Ile Gly Ile Ser Glu Gln

580 585 590

Pro Leu Phe Gly Ala Gly Ser Ile Ser Ser Gly Glu Leu Tyr Ile Asp

595 600 605

Lys Ile Glu Ile Ile Leu Ala Asp Ala Thr Phe Glu Ala Glu Ser Asp

610 615 620

Leu Glu Arg Ala Gln Lys

625 630

<210> 7

<211> 420

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 7

attgtgaaga gtctaaattt atcgttttgg cggctgcatg tcctggtaac aatgaccttt 60

ctttcttagg gcttgaattg aactttggtt ctctcaacga gacagcttct catttattgc 120

tgcgtctaac ccttatcatg gaagagtgca tgtttttgag aacgcatgaa agcaaatgag 180

acacgcaaaa tattcaatcc ttcagcatgg cccattttcc acttgtaagc tgggagtcca 240

atgacactga tgtgttaggt agaaatgggc gtcactttcc taatacaggt cggatttgag 300

cttatttctt ttcccatttt aatgatgatt acatggagtt ataaaaacat aagaataatg 360

ctaatacata ttgctgtgta tgtatactct cttgtttttc gttgataaag gttggtttta 420

<210> 8

<211> 501

<212> DNA

<213> Artificial Synthesis (Artificial Sequence)

<400> 8

aagcacttta tgtagcacaa taatttaagt tgttgtatag cattgtaaag catttccttt 60

atcacaatag acttccctag atgttctagc aaatttcaac actcaacttc gttctttatt 120

tatcaatcaa ttatcaaaag tgcttctctc taatttaaaa ttaattgatt ataaatcaca 180

agttttaact aaccatttta agttcccctt tctatatttg tatttttaaa tactgaatgc 240

aatatgtgtt ttgttatttt caaatttaat atacttgacg tgatgagttt ataatcagcc 300

aaatgaatga aactaatata ttgttattca caataatatt gttaaataga tgggggcatg 360

gctatgaaaa ataccacgcc tcctttgtta gcacttttat gggtgattcc aatttatttt 420

tcaatgcaac aatgctgata tattgctttt attacgtagg catgaatatt ccattgacaa 480

taatttgatt tagacctgga a 501

Claims (9)

1. A transgenic method of herbicide-resistant insect-resistant transgenic soybean JingDou 321 is characterized in that a vector carrying glyphosate-resistant genes g2m-epsps, gr79m-epsps and insect-resistant genes cry1C is inserted into a No. 6 chromosome of soybean, and the insertion site of an exogenous gene is a transgenic soybean obtained between a No. 6 chromosome of a soybean genome No. 6 9023775-;

the soybean 321 soybean 5 'flanking sequence is located at 9032356..9023775 of the soybean reference genome No. 6 chromosome, and the soybean 3' flanking sequence is located at 9023856..9024356 of the soybean reference genome No. 19 chromosome.

2. The method for transgenosis of herbicide-tolerant insect-resistant transgenic soybean Jingdou 321 as claimed in claim 1, wherein the vector for transforming soybean with g2m-epsps, gr79m-epsps and cry1C genes is pGR 18.

3. The transgenic method of herbicide-resistant insect-resistant transgenic soybean Kyoho 321 as claimed in claim 1, wherein the expression frame position of the G2M-EPSPS gene is 6265-8837, comprising 808bp of 35S promoter, 1335bp of G2M-EPSPS gene and 201bp of PolyA terminator; the expression frame position of the Cry1C gene is 9070-12135, and the expression frame position consists of 835bp of a 35S promoter, 1893bp of a CrylC gene and 253bp of an NOS terminator; the expression frame position of GR79M-EPSPS gene is 12370-16167, including pUbi promoter 2036bp, GR79M-EPSPS gene 1338bp and PolyA terminator 196 bp.

4. The transgenic method of herbicide-tolerant insect-resistant transgenic soybean JingDou 321 according to claim 1, wherein the herbicide-tolerant insect-resistant transgenic soybean JingDou 321 is characterized in that: the 5' flanking sequence of the soybean 321 from Jingdou is located at 9032356..9023775 of the chromosome 6 of the soybean reference genome, and the specific sequence is as follows: ATTGTGAAGAGTCTAAATTTATCGTTTTGGCGGCTGCATGTCCTGGTAACAATGACCTTTCTTTCTTAGGGCTTGAATTGAACTTTGGTTCTCTCAACGAGACAGCTTCTCATTTATTGCTGCGTCTAACCCTTATCATGGAAGAGTGCATGTTTTTGAGAACGCATGAAAGCAAATGAGACACGCAAAATATTCAATCCTTCAGCATGGCCCATTTTCCACTTGTAAGCTGGGAGTCCAATGACACTGATGTGTTAGGTAGAAATGGGCGTCACTTTCCTAATACAGGTCGGATTTGAGCTTATTTCTTTTCCCATTTTAATGATGATTACATGGAGTTATAAAAACATAAGAATAATGCTAATACATATTGCTGTGTATGTATACTCTCTTGTTTTTCGTTGATAAAGGTTGGTTTTA are provided.

5. The transgenic method of herbicide-tolerant insect-resistant transgenic soybean JingDou 321 according to claim 1, wherein the herbicide-tolerant insect-resistant transgenic soybean JingDou 321 is characterized in that: the 3' flanking sequence of the soybean 321 from Jingdou is located at 9023856..9024356 of the chromosome 19 of the soybean reference genome, and the specific sequence is as follows: AAGCACTTTATGTAGCACAATAATTTAAGTTGTTGTATAGCATTGTAAAGCATTTCCTTTATCACAATAGACTTCCCTAGATGTTCTAGCAAATTTCAACACTCAACTTCGTTCTTTATTTATCAATCAATTATCAAAAGTGCTTCTCTCTAATTTAAAATTAATTGATTATAAATCACAAGTTTTAACTAACCATTTTAAGTTCCCCTTTCTATATTTGTATTTTTAAATACTGAATGCAATATGTGTTTTGTTATTTTCAAATTTAATATACTTGACGTGATGAGTTTATAATCAGCCAAATGAATGAAACTAATATATTGTTATTCACAATAATATTGTTAAATAGATGGGGGCATGGCTATGAAAAATACCACGCCTCCTTTGTTAGCACTTTTATGGGTGATTCCAATTT ATTTTTCAATGCAACAATGCTGATATATTGCTTTTATTACGTAGGCATGAATATTCCATTGACAATAATTTGATTTAGACCTGGAA are provided.

6. A specific detection method of herbicide-resistant insect-resistant transgenic soybean JingDou 321 is characterized in that: the method comprises the following steps:

s1, primers JD321P-1 and JD321P-2 derived from soybean genomes on both sides of the Jingdou 321 insertion site and primers GR18LB-R and GR18RB-F derived from exogenous genes are utilized to respectively form a primer pair JD321P-1 and GR18LB-R capable of specifically detecting the 5 'insertion position and a primer pair GR18RB-F and JD321P-2 capable of specifically detecting the 3' insertion position in the Jingdou 321 soybean;

s2, setting a control group: no template control and receptor Jack control groups;

s3 PCR reaction is carried out on three groups, and the condition of each group of amplified bands is observed.

7. The specific detection method of the herbicide-tolerant insect-resistant transgenic soybean Jingdou 321 of claim 6, wherein: the PCR reaction conditions are as follows: denaturation at 94 ℃ for 4min, denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s, 35 cycles.

8. The specific detection method of the herbicide-tolerant insect-resistant transgenic soybean Jingdou 321 of claim 6, wherein: the sequence of the primer JD321P-1 is as follows: GACCTTTCTTTCTTAGGGCTTGA, the sequence of the primer JD321P-2 is: GCTAACAAAGGAGGCGTGGTAT, the primer GR18LB-R has the sequence: TGCCAAGACTTACCCTGATTACT, the primer GR18RB-F has the sequence: GGGTCAAGGTTCCGCACATT are provided.

9. A kit for detecting the presence of transgenic soybean Jingdou 321 plant material in a sample, characterized in that: the kit comprises the exogenous gene described in claim 1 and the primer pair described in claim 6.

Images