CN113717864A - Cellulase high-yield strain and application thereof - Google Patents

Abstract

The invention provides a Trichoderma reesei mutant strain with high cellulase yield, and the preservation number of the Trichoderma reesei mutant strain is CCTCC NO: M2017841. The optimum action temperature of the cellulase mutant expressed by the mutant strain is 60 ℃, the optimum action pH is 6.0, and the cellulase mutant can keep more than 80% of enzyme activity level within the pH range of 5.5-7.0. Compared with the wild cellulase NCE4, the heat resistance of the cellulase mutant is obviously improved.

Description

Cellulase high-yield strain and application thereof

The invention is a divisional application, the application number of the parent case is 2018100917748, the invention name is 'a cellulase mutant and a high-yield strain thereof'; the application date is 2018-01-30.

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a cellulase high-yield strain and application thereof.

Background

Cellulases are a generic term for a group of enzymes that hydrolyze cellulose to glucose, which are not single enzymes, and mainly comprise three components: endoglucanases (EG), Cellobiohydrolases (CBH) and beta-glucosidases (β -glucosidases). In the process of degrading cellulose by cellulase, three enzymes play a role in concerted catalysis. The application fields of the cellulase are very wide, and relate to spinning, brewing, food, papermaking, feed and the like, and the requirements of different application fields on various components of the cellulase are different. Under appropriate conditions, they act synergistically to hydrolyze natural cellulose to glucose.

At the end of the last 80 th century, cellulases began to enter the textile industry as a bio-enzyme preparation and were rapidly developed. Cellulases have many advantages for use in the textile industry: firstly, as a biocatalyst, it is non-toxic and harmless; secondly, the conditions required by treatment are mild, and the dosage of enzyme is less; finally, the wastewater after the reaction is treated is pollution-free, and energy can be saved.

The cellulase can act on natural or regenerated cellulose fibers, including cotton, hemp, bamboo fibers, paper mulberry fibers, viscose fibers, cuprammonium fibers, Lyocell fibers and the like, and can remove fuzz on the surface of the fabric after the cellulose is subjected to decrement treatment, so that the fabric is bright, clean and soft, and is polished and the pilling phenomenon is reduced. Depending on the purpose of the treatment, the treatment may be carried out by biopolishing, softening and reducing, improving gloss, stone-milling and water-washing.

Cellulases are a mixture of enzymes, and characterization of the enzyme composition is essential to understanding and controlling the effect of enzyme finishing. According to the current research results, the EG II enzyme has excellent performance in weight reduction treatment, biological polishing treatment, water washing and stone grinding treatment, and is a very important cellulase component. Meanwhile, factors such as temperature, pH value, surfactant, inorganic salt, mechanical stirring and ultrasonic wave synergy all influence the effect of cellulase treatment. Therefore, for different cellulase varieties and different fibers, reasonable process conditions are selected to ensure that the enzyme treatment effect is optimal.

In many related studies, existing enzyme proteins are modified in order to obtain better enzymes, in addition to being screened from nature. At present, two major modification strategies exist, one is random mutation or random arrangement of enzyme genes, and under a specific action condition, enzyme proteins which are more in line with the action condition are screened. Another modification strategy is to find out amino acids which are critical to the enzymatic activity or property by researching the structure and action mechanism of the enzyme, and to perform mutation and test on the specific amino acids, so as to obtain a modified enzyme protein with stronger functionality.

The invention obtains the cellulase mutant with improved temperature resistance by site-directed mutagenesis so as to meet the application requirement of cellulase in the textile industry.

Disclosure of Invention

The invention aims to provide a cellulase mutant and a high-yield strain thereof. According to the invention, the mutant protein is obtained by carrying out protein engineering transformation on the cellulase NCE4 derived from Humicola insolens (Humicola insolens), the application effect of the mutant protein in textile unhairing and washing is obviously improved, the thermal stability of the mutant protein is also obviously improved, and the mutant protein can be widely applied to the field of textile industry.

The invention provides a cellulase mutant, which has an amino acid sequence of SEQ ID NO:1, the cellulase has deletion of amino acid 219-235.

The amino acid sequence of the cellulase mutant is SEQ ID NO:3, the nucleic acid sequence of one coding gene is SEQ ID NO: 4.

in another aspect, the invention provides a recombinant plasmid carrying the cellulase mutant gene.

The invention also relates to a Trichoderma reesei (Trichoderma reesei) engineering strain which carries the recombinant plasmid.

The invention also provides another trichoderma reesei engineering strain, which is obtained by taking the trichoderma reesei engineering strain as an initial strain and performing overexpression on a transcription positive regulatory factor Hap 2; the gene sequence of the transcription positive regulatory factor Hap2 is SEQ ID NO: 5.

the invention further provides a trichoderma reesei engineering strain which is obtained by screening through an ultraviolet mutagenesis method by taking the trichoderma reesei engineering strain excessively expressing the transcription positive regulatory factor Hap2 as an initial strain.

One of the mutant strains is Trichoderma reesei H2V-3(Trichoderma reesei H2V-3) strain which is preserved in China center for type culture Collection of Wuhan university in Wuhan, China in 12 months and 25 days in 2017, and the preservation number is CCTCC NO: M2017841.

The mutant strain is applied to the fermentation production of cellulase.

The cellulase mutant provided by the invention has the optimum action temperature of 60 ℃, the optimum action pH of 6.0, and can keep more than 80% of enzyme activity level within the pH range of 5.5-7.0. Compared with the wild cellulase NCE4, the heat resistance of the cellulase mutant is obviously improved, and after the cellulase mutant is stored at 37 ℃ for 3 months, the protein structure is stable and is not degraded, thereby being beneficial to long-term storage and maintaining the continuity of the efficacy in practical application. The cellulase mutant has clean hair removal and small strength loss on fabrics; the jean is washed with water, has small blossoming and stable batch difference with small flower spots, and can be widely applied to the field of textile processing. In addition, within the pH range of 5.0-8.0, the cellulase mutants with the same protein content have the application effects of hair removal and flower formation which are 1.5 times that of wild cellulase NCE4, so that the addition of enzyme can be greatly reduced, the cost is saved, and the economic benefit is increased.

In addition, the mutant strain trichoderma reesei H2V-3 of the cellulase mutant with high yield is obtained by ultraviolet mutagenesis screening. Compared with the original strain Trichoderma reesei KDNE-DH, the enzyme activity of the fermentation supernatant of the mutant strain is improved by 35.3%, the protein content is improved by 36.4%, the colony morphology of the mutant strain is obviously changed, hypha branches and the protein secretion top ends of hyphae are obviously increased, the large-scale secretion of extracellular protein is facilitated, the mutant strain can be widely applied to the production of cellulase, and the production cost is reduced.

Drawings

FIG. 1: comparing SDS-PAGE electrophoretograms of the cellulase mutant KDNE-D and the wild type cellulase NCE4 after being placed at 37 ℃ for 3 months;

FIG. 2: comparing the colony and fermentation mycelium morphology of the mutant strain Trichoderma reesei H2V-3 with the original strain Trichoderma reesei KDNE-DH.

Detailed Description

The present invention uses conventional techniques and methods used IN the fields of genetic engineering and MOLECULAR BIOLOGY, such as the methods described IN MOLECULAR CLONING, A LABORATORY MANUAL,3nd Ed. (Sambrook,2001) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, it is not intended that the invention be limited to any particular methodology, protocols, and reagents described, as these may vary.

The present invention will be described in detail with reference to specific embodiments.

EXAMPLE 1 cloning of cellulase Gene

In order to improve the heat resistance of the wild-type cellulase NCE4 (with the amino acid sequence of SEQ ID NO:1 and the coding nucleotide sequence of SEQ ID NO:2) and improve the structural rigidity of the protein, the applicant carries out a large number of point mutations, insertions and deletion transformation screening on the amino acid sites of the cellulase. Some of the modifications reduce the heat resistance of the mutant, some of the modifications do not change the heat resistance of the mutant obviously, and some of the modifications improve the heat resistance of the mutant but have poor enzymatic properties, so that the method is not suitable for industrial production. Finally, applicants screened a cellulase variant with significantly improved thermostability without significant changes in enzymatic properties. The mutant has a deletion of amino acids 219-235 compared with the wild-type cellulase NCE 4.

The applicant named the mutant KDNE-D, the amino acid sequence of which is SEQ ID NO. 3, and the coding nucleotide sequence of which is SEQ ID NO. 4.

Using wild cellulase NCE4 gene as a template, designing primers NCE4-F (containing KpnI restriction site) and R1, and carrying out PCR amplification to obtain an upstream fragment;

NCE4-F：CGGGGTACCATGCGTTCCTCCCCCCTC(KpnI)

R1:TGGACTGGCGGGCTCGAGCTGGTGCTGCTGGAGG

obtaining a downstream fragment by PCR amplification by using a primer F1 and a NCE4-R (containing MluI enzyme cutting site);

F1:CCTCCAGCAGCACCAGCTCGAGCCCGCCAGTCCA

NCE4-R:CGACGCGTCTACAGGCACTGATGATACCAG(MluI)

and respectively taking the upstream fragment and the downstream fragment obtained by amplification as templates and NCE4-F and NCE4-R as primers, and carrying out fusion PCR amplification to obtain a nucleic acid fragment, namely the gene sequence of the cellulase mutant KDNE-D.

The nucleic acid sequence of the wild-type cellulase NCE4 was completed by Shanghai Bioengineering Co., Ltd, and the nucleotide sequence was SEQ ID NO 2.

EXAMPLE 2 expression of cellulase mutants

2.1 construction of recombinant vectors

The synthesized cellulase mutant gene fragment and the pSC1G vector were digested with restriction enzymes KpnI and MluI (Fermentas), respectively, the digested products were purified using a gel purification kit, and the two digested products were ligated with T4 DNA ligase (Fermentas) and transformed into E.coli Transn 5 alpha (Transgen), selected with ampicillin, and the clone was verified by sequencing (Invitrogen). And (4) obtaining a recombinant vector pSC1G-KDNE-D containing the cellulase mutant gene after the sequencing is correct.

The recombinant vector pSC1G-NCE4 containing the wild-type cellulase NCE4 gene was constructed in the same manner as described above.

2.2 construction and screening of recombinant strains

(1) Protoplast preparation

Inoculating Trichoderma reesei hyphae on a PDA (potato 200-300 g, glucose 20 g, agar 15-20 g, tap water 1000 ml, natural pH) plate, and culturing at 30 deg.C for 6 days; after the spore production is rich, cutting a colony of about 1cm multiplied by 1cm into a liquid culture medium containing 120mL YEG + U (0.5% yeast powder, 1% glucose, 0.1% uridine), and carrying out shake culture at 30 ℃ and 220rpm for 14-16 h;

filtering with multiple layers of gauze to collect mycelia, and cleaning with sterile water once; placing the mycelium in a triangular flask containing 20mL of 10mg/mL lyase solution (Sigma L1412) and reacting at 30 ℃ and 90rpm for 1-2 h; observing and detecting the transformation progress of the protoplast by using a microscope;

pre-cooled 20mL of 1.2M sorbitol (1.2M sorbitol, 50mM Tris-Cl, 50mM CaCl)₂) Adding into the triangular flask, shaking gently, filtering with sterile Miracloth, collecting filtrate, centrifuging at 3000rpm and 4 deg.C for 10 min; discarding the supernatant, adding precooled 5 mL1.2M sorbitol solution to suspend the thalli, and centrifuging at 3000rpm and 4 ℃ for 10 min; discarding the supernatant, adding appropriate amount of precooled 1.2M sorbitol, suspending and packaging (200. mu.L/tube, protoplast concentration of 10)⁸one/mL).

(2) PEG-mediated protoplast transformation and strain validation

The following procedures were all performed on ice by adding 10. mu.g of recombinant vector to 200. mu.L of the above protoplast solution, then adding 50. mu.L of 25% PEG and gently mixing, then standing on ice for 20min, then adding 1mL of 25% PEG, gently mixing, standing at room temperature for 5min, then adding 2mL of 25% PEG solution and 4mL of 1.2M sorbitol solution, gently mixing the tubes, gently adding the mixture to about 50mL and melting, then cooling to 45-55 ℃ of transformation supernatant medium (0.1% MgSO 2, MgSO 5, and PBS), and then adding the mixture to about 50mL of the transformation supernatant medium₄，1％KH₂PO₄，0.6％(NH₄)₂SO₄1% glucose, 18.3% sorbitol, 0.35% agarose, 0.1% trace elements (trace elements: in 250mL dlH)₂Adding 1g of FeSO into O₄·7H₂O，8.8g ZnSO₄·₇H₂O，0.4g CuSO₄·5H₂O，0.15g MnSO₄·4H₂O，0.1g Na₂B₄O₇·10H₂O，50mg(NH₄)₆Mo₇O₂₄·4H₂O, 0.2mL concentrated HCl, completely dissolved with dlH₂O to a constant volume of 1L)), gently mixed and poured into a conversion lower medium plate (2% glucose, 0.5% (NH4)₂SO₄,1.5％KH₂PO₄,0.06％MgSO₄,0.06％CaCl₂Agar of 1.5 percent and trace elements of 0.1 percent) and cultured for 5 to 7 days at the temperature of 30 ℃ until transformants grow out.

Selecting transformants to a lower layer culture medium plate, and culturing for 2d at 30 ℃; placing an appropriate amount of mycelium into a 2mL centrifuge tube, adding 100mg of sterile quartz sand and 400. mu.L of extraction buffer (100mM Tris-HCl,100mM EDTA,250mM NaCl, 1% SDS); shaking vigorously for 2min with bead beating instrument; after being bathed in water at 65 ℃ for 20min, 200 mu L of 10M NH is added₄AC, ice-bath for 10 min; centrifuging at 13000rpm for 10 min; taking the supernatant, adding 2 times of anhydrous ethanol, and standing at-20 deg.C for 30 min; centrifuging at 13000rpm for 10min, and discarding the supernatant; washing with 70% ethanol for 2 times; air drying, dissolving in water, and storing at-20 deg.C.

The genomic DNA of the transformant extracted as described above was used as a template, and the objective gene was amplified by PCR using primers NCE4D-F1 and NCE4D-R1 for verification.

NCE4D-F1：ATGCGTTCCTCCCCCCTC

NCE4D-R1：CTACAGGCACTGATGATACCAG；

PCR amplification conditions were 94 ℃ for 4 min; 94 ℃ for 40 s; at 58 ℃ for 40s, at 72 ℃ for 1min, for 30 cycles; 7min at 72 ℃ and 16 ℃; and recovering the PCR amplification product by using a gel recovery kit, and performing sequencing analysis to construct the Trichoderma reesei engineering bacteria containing the cellulase mutant KDNE-D gene, wherein the Trichoderma reesei engineering bacteria is named Trichoderma reesei KDNE-D.

The Trichoderma reesei engineering strain for recombinant expression of the wild-type cellulase NCE4 was constructed by the same method as above and named Trichoderma reesei NCE4(Trichoderma reesei NCE 4).

Example 3 fermentation validation and enzyme Activity detection

Trichoderma reesei KDNE-D (Trichoderma reesei KDNE-D) and Trichoderma reesei NCE4(Trichoderma reesei NCE4) obtained by the above construction were inoculated into MM fermentation medium (1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH) respectively₄)₂SO₄，0.09％MgSO₄，2％KH₂PO₄，0.04％CaCl₂0.018% of Tween-80, 0.018% of trace elements and 0.018% of polypropylene glycol-2000) at 30 ℃ for 48 hours, then at 25 ℃ for 72 hours, respectively taking supernatant samples, and determining the enzyme activity.

(1) Enzyme activity measuring method

Under the conditions of 50 ℃ and pH value of 6.0, the enzyme amount required for degrading and releasing 1 mu mol of reducing sugar from 5mg/ml of carboxymethyl cellulose sodium solution per minute is one enzyme activity unit U, and the reducing sugar is equal to glucose.

Adding 0.5mL CMC substrate into each of the three test tubes, and preheating with the enzyme solution to be tested in 50 deg.C water bath for 5 min. 0.5mL of the solution to be detected was added to each of the first and second test tubes, and the mixture was reacted in a water bath at 50 ℃ for 15min while counting the time. After the reaction, 1.5mL of DNS reagent is added into each of the three test tubes, and 0.5mL of enzyme solution to be detected is added into the third test tube. The three tubes were taken out and shaken up, and then reacted for 5min in a boiling water bath. It was rapidly cooled to room temperature and adjusted to 5.0mL with water. And (3) measuring the absorbance of the first and second test tube solutions at 540nm wavelength by using the third test tube solution as a control, preferably, the absorbance is 0.25-0.35. The absolute value of the difference between the absorbance of the enzyme liquid reaction solution to be detected and the absorbance of the enzyme liquid reaction solution for horizontal control is not more than 0.015.

Enzyme activity X ═ (glucose equivalent/180/15/0.5). times.n

Wherein X is enzyme activity unit, IU/g (mL);

180-conversion of glucose from micrograms to micromoles;

15-reaction time of the solution to be tested and the substrate;

0.5-the amount of enzyme solution to be measured added;

n is dilution multiple;

(2) results of enzyme Activity measurement

The enzyme activity of the fermentation supernatant is detected by adopting the method, and the result shows that: the enzyme activity of cellulase can hardly be detected in the host strain trichoderma reesei fermentation supernatant, and the enzyme activity of the trichoderma reesei NCE4 fermentation supernatant is 90U/mL, and the molecular weight is 43 KD; the enzyme activity of the supernatant of the Trichoderma reesei KDNE-D fermentation is 130U/mL, and the molecular weight is 32 KD. The enzyme activity detection result further proves that the host bacteria selected by the invention do not produce cellulase, so that the trichoderma reesei NCE4 and the trichoderma reesei KDNE-D constructed by the invention can respectively express the wild cellulase NCE4 and the mutant KDNE-D in a high-efficiency recombination manner.

3.1 pH analysis of optimal reaction

Diluting the fermentation supernatant with buffer solutions with pH values of 3.0, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5 and 8.0, respectively, measuring enzyme activity at 50 deg.C, calculating relative enzyme activity with maximum enzyme activity of 100%, and making pH-relative enzyme activity curve. The results show that the optimum action pH of the cellulase mutant KDNE-D and the wild type cellulase NCE4 are both 6.0, and the enzyme activity level of more than 80% can be maintained in the pH range of 5.5-7.0.

3.2 optimum reaction temperature analysis

The enzyme activity of the cellulase is measured under the conditions of 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃, 65 ℃, 70 ℃, 75 ℃ and pH 6.0 respectively, the highest enzyme activity is taken as 100 percent, the relative enzyme activity is calculated, and a temperature-relative enzyme activity curve is made. The results show that: compared with the wild cellulase NCE4, the optimum reaction temperature of the cellulase mutant KDNE-D is not changed, and the optimum reaction temperature is 60 ℃.

3.3 analysis of Heat resistance

Storing the fermentation supernatant at 37 deg.C for 3 months, respectively performing SDS-PAGE electrophoresis detection and analysis, and storing the fermentation supernatant at-80 deg.C for 3 months as control group. The results are shown in figure 1, compared with the control group, the wild type cellulase NCE- +4 has unstable structure and protein degradation from 43KD to 23KD after being stored for 3 months at 37 ℃; and after the cellulase mutant KDNE-D is stored for 3 months at 37 ℃, the structure is stable, and the protein is not degraded. Therefore, the cellulase mutant KDNE-D provided by the invention has better heat resistance, is more beneficial to long-term storage of the enzyme and keeps the continuity of the efficacy in practical application.

Example 4 genetic engineering of Trichoderma reesei KDNE-D

The applicant takes the engineering bacterium trichoderma reesei KDNE-D of the recombinant expression cellulase mutant KDNE-D constructed in the embodiment 2 as an original strain, improves the transcription level of the cellulase KDNE-D gene by over-expressing a transcription positive regulation factor Hap2, and further screens to obtain the trichoderma reesei engineering strain with the remarkably improved enzyme production level.

4.1 mutagenesis of hosts

Inoculating Trichoderma reesei KDNE-D serving as starting strain on a PDA plate, culturing at constant temperature of 30 ℃ for 7 days, washing spores with 5ml of sterile water after the spores are mature, and preparing a spore suspension with the concentration of 10⁶One per ml.

Uniformly coating 100ul of the spore suspension on a PDA plate containing 5-fluoroorotic acid (wherein the concentration of 5-fluoroorotic acid is 1g/L), culturing at 30 ℃ for 4-5 days at constant temperature, selecting the same colony, respectively inoculating the colony on a conversion lower plate without uridine and a conversion lower plate containing uridine (wherein the concentration of uridine is 1g/L), culturing at 30 ℃ for 2 days at constant temperature, selecting a colony which does not grow on the conversion lower plate but grows on the conversion lower plate containing uridine, inoculating the colony on a PDA plate containing uridine (wherein the concentration of uridine is 1g/L), culturing at 30 ℃ for 6-7 days to a stationary phase, after the spores are mature, cutting 1cm × 1cm pieces into MM fermentation medium, culturing at 30 deg.C for 48 hr, then, the cells were cultured at 25 ℃ for 72 hours, and after completion of the culture, the cells were centrifuged to take out the supernatants for enzyme activity detection (detection method, reference example 3). According to the detection result, the strain with the highest cellulase activity is screened out and named as Trichoderma reesei KDNE-DU (Trichoderma reesei KDNE-DU) which is used as a host for the subsequent gene transformation.

4.2 construction and screening of genetically engineered strains

The nucleic acid sequence of the transcription positive regulatory factor Hap2 is synthesized by Shanghai biological engineering Co., Ltd, and the nucleotide sequence is SEQ ID NO: 5.

The synthesized Hap2 gene fragment and pdc4 vector are respectively digested by restriction enzymes KpnI and XbaI, the digested products are purified, T4 DNA ligase is used for connecting and transforming Escherichia coli Trans5 alpha, ampicillin is used for selection, and the clone is subjected to sequencing verification. After the sequencing is correct, the over-expression vector pdc4-Hap2 containing the Hap2 gene is obtained.

Trichoderma reesei KDNE-DU was used as a host, the overexpression vector pdc4-Hap2 was transformed, and transformant genomic DNA was screened and extracted (the protoplast transformation method and the transformant genomic DNA extraction method refer to example 2). The genomic DNA of the transformant extracted as described above was used as a template, and the objective gene was amplified by PCR using the primers pdc4-F and pdc4-R for verification.

pdc4-F：CCTCAGAGTGTCGTCACCAG

pdc4-R：GGATAGTCAAGTGGAGCAGATTG；

PCR amplification conditions were 94 ℃ for 4 min; 94 ℃ for 40 s; at 58 ℃ for 40s, at 72 ℃ for 1min, for 30 cycles; 7min at 72 ℃ and 16 ℃; and recovering the PCR amplification product by using a gel recovery kit, performing sequencing analysis, constructing a genetic engineering strain containing a transcription positive regulatory factor Hap2, and naming the genetic engineering strain as Trichoderma reesei KDNE-DH (Trichoderma reesei KDNE-DH).

Respectively inoculating the trichoderma reesei KDNE-DH and trichoderma reesei KDNE-D obtained by the construction into an MM fermentation culture medium, culturing for 48 hours at 30 ℃, then culturing for 72 hours at 25 ℃, respectively taking supernatant samples, and determining the enzyme activity of cellulase, wherein the enzyme activity of the trichoderma reesei KDNE-D fermentation supernatant is 130U/ml, the molecular weight is 32KD, the enzyme activity of the trichoderma reesei KDNE-DH fermentation supernatant is 170U/ml, the molecular weight is 32KD, and the enzyme activity of the cellulase is remarkably improved.

Example 5 UV mutagenesis and screening

The applicant further screens the mutant strain with improved enzyme production level by using Trichoderma reesei KDNE-DH as an original strain through an ultraviolet mutagenesis method.

Inoculating Trichoderma reesei KDNE-DH serving as starting bacteria on a PDA plate, 28-Culturing at 30 deg.C for 1 week to stationary phase. After the spores are mature, 5-10ml of sterile water is added on the flat plate for washing the spores, the spore suspension is absorbed and counted, and the concentration of the spore suspension is adjusted to 10 according to the content of the spores^5-6Per ml, then subjected to a subsequent UV mutagenesis treatment.

Adding the spore suspension into an empty plate, performing magnetic stirring (20-550rpm), and performing mutagenesis treatment by using an ultraviolet alignment plate under the mutagenesis conditions that: irradiating with 10-20W ultraviolet lamp at irradiation distance of 10-20cm for 3-5 min; then coating the mutagenized spore suspension on a PDA (personal digital assistant) plate under the condition of dark light or red light; finally, the plate was incubated at 30 ℃ until colonies were formed, which took about 7 to 10 days.

4.196 deep well plate screening:

2-3ml of MM fermentation medium was added to wells of a 96-deep well plate, and the colonies grown after the mutagenesis were inoculated to each well, respectively, and cultured on a shaker at 30 ℃ and 200rpm for 2 days, at 25 ℃ and 200rpm for 3 days. After the culture, the supernatant was centrifuged to detect the enzyme activity (detection method, reference example 3) and SDS-PAGE was performed. According to the detection result, three mutant strains of the mutant bacteria with the cellulase activity and the extracellular protein content obviously higher than those of the original bacteria are screened out and named as H2V-1, H2V-2 and H2V-3 respectively.

4.2 Shake flask screening:

the three mutant strains (H2V-1, H2V-2, H2V-3) were inoculated into 50ml of MM fermentation medium, respectively, and cultured on a shaker at 30 ℃ and 200rpm for 2 days, 25 ℃ and 200rpm for 3 days. After completion of the culture, the supernatants were centrifuged, and the enzyme activity (detection method, reference example 3) and the protein content (Coomassie Brilliant blue detection) were measured, and the results are shown in Table 1.

TABLE 1 determination of enzyme Activity and protein content

The results in Table 1 show that the fermentation enzyme activity and extracellular protein content of H2V-3 in the three mutant bacteria screened by the invention are highest, and are improved by 35.3% and 36.4% compared with the original bacteria, and the remarkable technical effect is achieved.

The applicant named this mutant strain Trichoderma reesei H2V-3(Trichoderma reesei H2V-3).

Example 6 purification and colony morphology Observation of the mutant bacterium Trichoderma reesei H2V-3

The mutant strain Trichoderma reesei H2V-3 is inoculated on a PDA plate and cultured at the constant temperature of 28-30 ℃ for 1 week to a stationary phase. After the spores are mature, 5-10ml of sterile water is added on the flat plate for washing and brushing the spores; then sucking a proper amount of spore suspension again and coating the spore suspension on a PDA (personal digital assistant) plate, and finally placing the plate at the constant temperature of 30 ℃ for culture until a single colony grows out; a single colony, namely purified mutant strain Trichoderma reesei H2V-3, was picked and inoculated on a PDA plate. Meanwhile, the starting bacteria were used as a control group, and cultured and purified in the same manner as described above, and a single colony was selected and inoculated on a PDA plate, and cultured on the PDA plate for 1 week.

As can be seen from comparison of the colony and the hypha morphology shown in FIG. 2, compared with the original trichoderma reesei KDNE-DH, the colony morphology of the mutant trichoderma reesei H2V-3 obtained by screening is obviously changed, and hypha branches and protein secretion tops of the hypha of the mutant strain are obviously increased, so that the mutant strain is beneficial to large-scale secretion of extracellular proteins.

Example 7 fermentation Scale-Up culture

Inoculating original strain Trichoderma reesei KDNE-DH and mutant strain Trichoderma reesei H2V-3 to a shake flask seed culture medium (10-30 g/L of glucose, 200g/L of potato) respectively, carrying out shake culture at 30 ℃,200 rpm for 48H, transferring the fermentation broth to a 7.5L fermentation tank (the culture medium comprises 30-50g/L of glucose, 2.0-10g/L of lactose, 20-50g/L of corn steep liquor, 10-30g/L of ammonium sulfate, 5-10g/L of magnesium sulfate and 15-30g/L of potassium dihydrogen phosphate), controlling the temperature at 25 +/-1 ℃, controlling the pH value at 5.0 +/-0.2, and after culturing in the fermentation tank for 10H to 15H, beginning to supplement lactose for inducing thallus enzyme production, wherein the fermentation time is about 160H to 170H, thus obtaining a fermentation bacterial liquid.

The fermentation broth was centrifuged, and the supernatant was collected and subjected to enzyme activity detection (detection method in reference example 3) and protein content detection (Coomassie Brilliant blue detection).

The result shows that the enzyme activity of the fermentation supernatant of the original strain trichoderma reesei KDNE-DH is 709U/mL, the protein content is 7.91g/L, the enzyme activity of the fermentation supernatant of the mutant strain trichoderma reesei H2V-3 is 1100U/mL, the protein content is 10.65g/L, and the enzyme activity is improved by 55% and 35% compared with the original strain.

The mutant strain Trichoderma reesei H2V-3(Trichoderma reesei H2V-3) was deposited in China center for type culture Collection, CCTCC NO: M2017841, at 12/25.2017, Wuhan university, Wuhan, China.

Example 7 use of cellulase mutants in textile

7.1 dehairing process for knitted fabric and woven fabric

The application temperature is 35-60 ℃; the treatment time is 30-150 minutes; the pH range is 4.0-8.5;

the applicable bath ratio ranges from 1:5 to 1:30, and the used equipment types are an overflow dyeing machine, a jig dyeing machine, a washing machine and the like.

The cellulase mutant provided by the invention has the advantages that the hair is removed cleanly, the strength loss of the fabric is small, the same hair removing effect is achieved, the addition amount of the cellulase mutant KDNE-D is 8g/L, and the addition amount of the wild type cellulase NCE4 is up to 12g/L, which is 1.5 times that of the mutant.

7.2 patterning application of denim fabric

The application temperature is 35-60 ℃; the treatment time is 10-60 minutes; the pH range is 4.0-8.5;

the above process conditions can be applied to the processes of desizing and unhairing and raising under the condition of single stone washing; the applicable bath ratio ranges from 1:5 to 1:30, and the used equipment types are industrial washing machines and the like.

The cellulase mutant provided by the invention has the advantages of clean hair removal, uniform flowering and small flowering point, and achieves the same flowering effect, the addition amount of the cellulase mutant KDNE-D is 8g/L, and the addition amount of the wild-type cellulase NCE4 is up to 12g/L, which is 1.5 times of that of the mutant.

The experimental results show that the cellulase mutant can be widely applied to the field of textile processing, is applied within the range of pH 4.0-8.5, and has good effect; the wool is removed completely, and the strength loss of the fabric is small; washing the jean with water, wherein the blossoming is small, the flower spots are small, and the batch difference is stable; and the application effect of the same protein content is 1.5 times of that of the wild type, so that the addition amount of the enzyme can be greatly reduced, the cost is saved, and the economic benefit is improved.

Sequence listing

<110> Islands blue biological group Co Ltd

WEIFANG KDN BIOTECH Co.,Ltd.

<120> cellulase high-producing strain and application thereof

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 284

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Ala Asp Gly Lys Ser Thr Arg Tyr Trp Asp Cys Cys Lys Pro Ser Cys

1 5 10 15

Gly Trp Ala Lys Lys Ala Pro Val Asn Gln Pro Val Phe Ser Cys Asn

20 25 30

Ala Asn Phe Gln Arg Leu Thr Asp Phe Asp Ala Lys Ser Gly Cys Glu

35 40 45

Pro Gly Gly Val Ala Tyr Ser Cys Ala Asp Gln Thr Pro Trp Ala Val

50 55 60

Asn Asp Asp Phe Ala Phe Gly Phe Ala Ala Thr Ser Ile Ala Gly Ser

65 70 75 80

Asn Glu Ala Gly Trp Cys Cys Ala Cys Tyr Glu Leu Thr Phe Thr Ser

85 90 95

Gly Pro Val Ala Gly Lys Lys Met Val Val Gln Ser Thr Ser Thr Gly

100 105 110

Gly Asp Leu Gly Ser Asn His Phe Asp Leu Asn Ile Pro Gly Gly Gly

115 120 125

Val Gly Ile Phe Asp Gly Cys Thr Pro Gln Phe Gly Gly Leu Pro Gly

130 135 140

Gln Arg Tyr Gly Gly Ile Ser Ser Arg Asn Glu Cys Asp Arg Phe Pro

145 150 155 160

Asp Ala Leu Lys Pro Gly Cys Tyr Trp Arg Phe Asp Trp Phe Lys Asn

165 170 175

Ala Asp Asn Pro Ser Phe Ser Phe Arg Gln Val Gln Cys Pro Ala Glu

180 185 190

Leu Val Ala Arg Thr Gly Cys Arg Arg Asn Asp Asp Gly Asn Phe Pro

195 200 205

Ala Val Gln Ile Pro Ser Ser Ser Thr Ser Ser Pro Val Gly Gln Pro

210 215 220

Thr Ser Thr Ser Thr Thr Ser Thr Ser Thr Thr Ser Ser Pro Pro Val

225 230 235 240

Gln Pro Thr Thr Pro Ser Gly Cys Thr Ala Glu Arg Trp Ala Gln Cys

245 250 255

Gly Gly Asn Gly Trp Ser Gly Cys Thr Thr Cys Val Ala Gly Ser Thr

260 265 270

Cys Thr Lys Ile Asn Asp Trp Tyr His Gln Cys Leu

275 280

<210> 2

<211> 855

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gctgatggca agtccacccg ctactgggac tgctgcaagc cttcgtgcgg ctgggccaag 60

aaggctcccg tgaaccagcc tgtcttctcc tgcaacgcca acttccagcg tctcactgac 120

ttcgacgcca agtccggctg cgagccgggc ggtgtcgcct actcgtgcgc cgaccagacc 180

ccatgggctg tgaacgacga cttcgcgttc ggttttgctg ccacctctat tgccggcagc 240

aatgaggcgg gctggtgctg cgcctgctac gagctcacct tcacatccgg tcctgttgct 300

ggcaagaaga tggtcgtcca gtccaccagc actggcggtg atcttggcag caaccacttc 360

gatctcaaca tccccggcgg cggcgtcggc atcttcgacg gatgcactcc ccagttcggc 420

ggtctgcccg gccagcgcta cggcggcatc tcgtcccgca acgagtgcga tcggttcccc 480

gacgccctca agcccggctg ctactggcgc ttcgactggt tcaagaacgc cgacaacccg 540

agcttcagct tccgtcaggt ccaatgccca gccgagctcg tcgctcgcac cggatgccgc 600

cgcaacgacg acggcaactt ccctgccgtc cagatcccct ccagcagcac cagctctccg 660

gtcggccagc ctaccagtac cagcaccacc tccacctcca ccacctcgag cccgcccgtc 720

cagcctacga ctcccagcgg ctgcactgct gagaggtggg ctcagtgcgg cggcaatggc 780

tggagcggct gcaccacctg cgtcgctggc agcacctgca cgaagattaa tgactggtac 840

catcagtgcc tgtag 855

<210> 3

<211> 267

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Ala Asp Gly Lys Ser Thr Arg Tyr Trp Asp Cys Cys Lys Pro Ser Cys

1 5 10 15

Gly Trp Ala Lys Lys Ala Pro Val Asn Gln Pro Val Phe Ser Cys Asn

20 25 30

Ala Asn Phe Gln Arg Leu Thr Asp Phe Asp Ala Lys Ser Gly Cys Glu

35 40 45

Pro Gly Gly Val Ala Tyr Ser Cys Ala Asp Gln Thr Pro Trp Ala Val

50 55 60

Asn Asp Asp Phe Ala Phe Gly Phe Ala Ala Thr Ser Ile Ala Gly Ser

65 70 75 80

Asn Glu Ala Gly Trp Cys Cys Ala Cys Tyr Glu Leu Thr Phe Thr Ser

85 90 95

Gly Pro Val Ala Gly Lys Lys Met Val Val Gln Ser Thr Ser Thr Gly

100 105 110

Gly Asp Leu Gly Ser Asn His Phe Asp Leu Asn Ile Pro Gly Gly Gly

115 120 125

Val Gly Ile Phe Asp Gly Cys Thr Pro Gln Phe Gly Gly Leu Pro Gly

130 135 140

Gln Arg Tyr Gly Gly Ile Ser Ser Arg Asn Glu Cys Asp Arg Phe Pro

145 150 155 160

Asp Ala Leu Lys Pro Gly Cys Tyr Trp Arg Phe Asp Trp Phe Lys Asn

165 170 175

Ala Asp Asn Pro Ser Phe Ser Phe Arg Gln Val Gln Cys Pro Ala Glu

180 185 190

Leu Val Ala Arg Thr Gly Cys Arg Arg Asn Asp Asp Gly Asn Phe Pro

195 200 205

Ala Val Gln Ile Pro Ser Ser Ser Thr Ser Ser Ser Pro Pro Val Gln

210 215 220

Pro Thr Thr Pro Ser Gly Cys Thr Ala Glu Arg Trp Ala Gln Cys Gly

225 230 235 240

Gly Asn Gly Trp Ser Gly Cys Thr Thr Cys Val Ala Gly Ser Thr Cys

245 250 255

Thr Lys Ile Asn Asp Trp Tyr His Gln Cys Leu

260 265

<210> 4

<211> 804

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gctgatggca agtccacccg ctactgggac tgctgcaagc cttcgtgcgg ctgggccaag 60

aaggctcccg tgaaccagcc tgtcttctcc tgcaacgcca acttccagcg tctcactgac 120

ttcgacgcca agtccggctg cgagccgggc ggtgtcgcct actcgtgcgc cgaccagacc 180

ccatgggctg tgaacgacga cttcgcgttc ggttttgctg ccacctctat tgccggcagc 240

aatgaggcgg gctggtgctg cgcctgctac gagctcacct tcacatccgg tcctgttgct 300

ggcaagaaga tggtcgtcca gtccaccagc actggcggtg atcttggcag caaccacttc 360

gatctcaaca tccccggcgg cggcgtcggc atcttcgacg gatgcactcc ccagttcggc 420

ggtctgcccg gccagcgcta cggcggcatc tcgtcccgca acgagtgcga tcggttcccc 480

gacgccctca agcccggctg ctactggcgc ttcgactggt tcaagaacgc cgacaacccg 540

agcttcagct tccgtcaggt ccaatgccca gccgagctcg tcgctcgcac cggatgccgc 600

cgcaacgacg acggcaactt ccctgccgtc cagatcccct ccagcagcac cagctcgagc 660

ccgccagtcc agcctacgac tcccagcggc tgcactgctg agaggtgggc tcagtgcggc 720

ggcaatggct ggagcggctg caccacctgc gtcgctggca gcacctgcac gaagattaat 780

gactggtatc atcagtgcct gtag 804

<210> 5

<211> 1038

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgatggaat acgcgcaata tccacagcag caacacaatt cccacgcagg ttacgcgagc 60

tctgccgccg gtgcaagtat cacgtcgccc accagccacg gcatcaacca gcacgccgtg 120

caatcgtcgc ccgtcaacgc atcgcagcag cagcagcaac aacaacagca acagcaacaa 180

caacaacaac aacagcaaca acagcagcag cagcaacaac aacagcagca gcagcagcag 240

cagcagcagt ctcagcagca acaccagcct gctcaggccc cagctcacgg catgtatcaa 300

ccacagtacg gcgtgcccca gcccagcatg cagcaggtgc cgtatggcat ccctggcatc 360

caggctgccg caatggccgc cacagccgcc gcctcaggct ccggctaccc ttacatgcac 420

tcggatccga gcatgcctca cacgtcgccg cgcatgccca gcgctaagaa ggatggccgg 480

ccgtctcctc gcatgaacag catttcccag atccccggcc gccgcatgag ccaagtcacc 540

agcccgggcg tgccgagtgc ccccggcatg atgaaccacg gcggaccccg gcccccgccc 600

atgcctcccg cccctgccat gcagcaccca cagtcgccag agatgcccgc cggcgccgtc 660

gaagagtcgc cattgtacgt caatgcgaaa cagttccacc gaatcctcaa gcggcgcgtc 720

gcccgccagc gtctcgaaga gcagttgcgg ttgacttcca aaggacgaaa gccctacctg 780

cacgagtcca gacacaacca tgcgatgcgc aggcctcgtg gacccggtgg tcgattcttg 840

acagcagagg aggtggccgc catggaatcc aagggagggc tagacggcaa gggtgagggt 900

tcggacgatg tctcacctgg caagtcctca gatgccccga gcgggaagcg caagtcggaa 960

tctggcccct cgacgtccag caagaagccc aaaacacaaa gcgacaacgg cgaaggaaat 1020

gcagaagacg ccagttaa 1038

Claims (2)

1. The Trichoderma reesei strain is characterized in that the preservation number of the Trichoderma reesei strain is CCTCC NO: M2017841.

2. Use of the Trichoderma reesei strain of claim 1 in the fermentative production of a cellulase.

Images