CN112795555B

CN112795555B - High specific activity cellulase mutant and application thereof

Info

Publication number: CN112795555B
Application number: CN201911104794.5A
Authority: CN
Inventors: 刘艳萍; 吴秀秀; 黄亦钧
Original assignee: Qingdao Vland Biotech Group Co Ltd
Current assignee: Qingdao Vland Biotech Group Co Ltd
Priority date: 2019-11-13
Filing date: 2019-11-13
Publication date: 2023-07-21
Anticipated expiration: 2039-11-13
Also published as: CN112795555A; CN116121229A

Abstract

The invention relates to the technical field of genetic engineering and protein transformation, in particular to a high specific activity cellulase mutant and application thereof. The mutant provided by the invention comprises amino acid substitution at least one position selected from the group consisting of: 6,111, 120, 147, 179, 219. The specific activity of the mutant is obviously improved at 50 ℃, so that the mutant is favorable for the wide application of cellulase in the textile field.

Description

High specific activity cellulase mutant and application thereof

Technical Field

The invention relates to the technical field of genetic engineering and protein transformation, in particular to a high specific activity cellulase mutant and application thereof.

Background

Cellulase is a complex enzyme system composed of a plurality of hydrolytic enzymes, and is mainly divided into: the degradation of cellulose by the exo-beta-glucanase, endo-beta-glucanase and beta-glucosidase is completed under the synergistic effect of a plurality of enzyme components.

Cellulases are widely found in organisms in nature and are produced by bacteria, fungi, animals, etc. Cellulases generally used in industrial production are derived from fungi, more typically Trichoderma, aspergillus and Penicillium. Cellulases are one of the most widely used enzymes in industry, and are generally applied to textile industry, detergent industry, pulp and paper industry, feed and food industry, and have huge potential markets in oil extraction, medicine and the like.

Cellulases can be classified according to their primary sequence into various glycosyl hydrolase families, for example glycosyl hydrolase families 5, 7, 12 and 45 contain endoglucanases. Most textile acid cellulases belong to family 5, while most textile neutral cellulases are either family 12 or 45.

At present, cellulose fabrics are subjected to biological finishing, namely enzyme degradation finishing, by utilizing cellulase, and the cellulose fabrics are widely applied due to the effects of environmental protection, energy conservation and high efficiency. The fabric is fluffy, plump, soft, smooth, clear in cloth cover, good in drapability and strong in hygroscopicity after finishing, has a certain mercerizing effect, and can achieve a satisfactory finishing effect by using 0.5% -3% of cellulase. Neutral cellulase has mild effect on fabric degradation, little fabric strength loss and less staining, and can obtain a plump hand feeling after treatment, so that the application of the neutral cellulase in textile industry is wide, the need is urgent, most of the industrial cellulases generally have higher catalytic efficiency at the temperature higher than 50 ℃, but in the textile field, in order to save heating or cooling cost, and further in order to improve the color firmness of the fabric and reduce shrinkage of clothes, enzyme preparations with good performance and high specific activity at low temperature level (lower than 50 ℃) are urgently needed.

Disclosure of Invention

The invention aims to provide a high specific activity cellulase mutant and application thereof. The invention obtains mutant protein by protein engineering of cellulase. Compared with the wild type, the specific activity of the mutant is obviously improved, and the mutant can be widely applied to the field of textile processing.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention relates to a cellulase mutant comprising a sequence identical to SEQ ID NO:1 and at least one of positions 6, 111, 120, 147, 179 and 219 of the amino acid sequence having at least 90% identity to SEQ ID NO. 1.

In some embodiments of the invention, the amino acid sequence of the mutant has at least 91%,92%,93%,94%,95%,96%,97%,98%, or at least 99% identity as compared to SEQ ID NO. 1.

In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%,99.2%,99.3%,99.4%,99.5%,99.6%,99.7%,99.8%, or at least 99.9% identity compared to SEQ ID No. 1.

In some embodiments of the invention, the mutant comprises a substitution of at least one amino acid in the group consisting of: Q6T, S111N, H120Q, Q147R, D179S, S219T.

In some embodiments of the invention, the mutant comprises the following substitutions or combinations of substitutions:

Q6T；

Q6T+ S111N；

Q6T+ H120Q；

Q6T+ Q147R；

Q6T+ D179S；

Q6T+ S219T；

Q6T+ S111N+ H120Q；

Q6T+ S111N+ Q147R；

Q6T+ S111N+ D179S；

Q6T+ S111N+ S219T；

Q6T+ H120Q+ Q147R；

Q6T+ H120Q+ D179S；

Q6T+ H120Q+ S219T；

Q6T+ Q147R+ D179S；

Q6T+ Q147R+ S219T；

Q6T+ D179S + S219T；

Q6T+ S111N+ H120Q+ Q147R；

Q6T+ S111N+ H120Q+ D179S；

Q6T+ S111N+ H120Q+ S219T；

Q6T+ H120Q+ Q147R+ D179S；

Q6T+ H120Q+ Q147R+ S219T；

Q6T+ Q147R+ D179S + S219T；

Q6T+ S111N+ H120Q+ Q147R+ D179S；

Q6T+ S111N+ H120Q+ Q147R+ S219T；

Q6T+ H120Q+ Q147R+ D179S+ S219T；

Q6T+ S111N + Q147R+ D179S+ S219T；

Q6T+ S111N + H120Q + D179S+ S219T；

Q6T+ S111N+ H120Q+ Q147R+ D179S+ S219T；

S111N；

S111N+H120Q；

S111N+Q147R；

S111N+ D179S；

S111N+S219T；

S111N + H120Q+ Q147R；

S111N + H120Q+ D179S；

S111N + H120Q+ S219T；

S111N + Q147R+ D179S；

S111N + Q147R+ S219T；

S111N + D179S+ S219T；

S111N + H120Q+ Q147R+ D179S；

S111N + H120Q+ Q147R+ S219T；

S111N + H120Q+ D179S + S219T；

S111N + Q147R+ D179S+ S219T；

S111N + H120Q+ Q147R+ D179S+ S219T；

H120Q；

H120Q +Q147R；

H120Q + D179S；

H120Q +S219T；

H120Q + Q147R+ D179S；

H120Q + Q147R+ S219T；

H120Q + D179S + S219T；

H120Q + Q147R+ D179S+ S219T；

Q147R；

Q147R+ D179S；

Q147R+ S219T；

Q147R+ D179S+ S219T；

D179S；

D179S+ S219T；

S219T。

the invention also relates to a DNA molecule for encoding the cellulase mutant.

The invention also relates to a recombinant expression vector comprising the DNA molecule.

The invention also relates to a host cell comprising the recombinant expression vector.

In some embodiments of the invention, the host cell is Trichoderma reeseiTrichoderma reesei）。

The recombinant expression vector is transferred into Trichoderma reesei host cells for recombinant expression, and the obtained cellulase mutant has higher specific activity.

The invention also relates to application of the cellulase mutant in the textile field.

The cellulase mutant provided by the invention has higher specific activity at 50 ℃. Compared with the wild type, the specific activity of the cellulase mutants respectively containing Q6T, S111N, H120Q, Q147R, D179S and S219T single-point mutation is generally improved by 7.1-50 percent under the condition of 50 ℃. Wherein, the specific activities of the S111N single-point mutant and the Q147R single-point mutant are respectively improved by 50 percent and 30 percent, and unexpected technical effects are obtained.

In addition, the invention provides cellulase mutants comprising at least 2, at least 3, at least 4, at least 5, at least 6 mutation sites of Q6T, S111N, H120Q, Q147R, D179S, S219T. For example: two-point mutants of Q6T+S111N, S111N+H120Q, S111N+Q147R, H Q+Q147R, Q147R+S219T and the like; three-point mutants such as Q6T+S111 N+H2120Q, Q T+S111N+Q147R, S N+H2tQ+S219T, S111N+Q147R+S219T, H Q+Q147 R+S219T; four-point mutants such as Q6T+S111 N+H2tQ+S219T, Q T+H2tQ+Q147 R+S219T, S N+H2tQ+Q147 R+S219T; five-point mutants such as Q6T+S111 N+H2t1Q+Q147 R+S219T, S N+H2t1Q+Q147 R+D179 S+S219T and six-point mutants such as Q6T+S111 N+H2t1Q+Q147 R+D179 S+S219T have the specific activity which is generally improved by 10% -82% compared with that of wild cellulase NT45 under the condition of 50 ℃, and unexpected technical effects are obtained.

In conclusion, the cellulase mutant disclosed by the invention is more suitable for being applied to the textile industry field than a wild type cellulase mutant, can greatly reduce the dosage of cellulase, saves labor hours and energy sources, and reduces the production cost.

Detailed Description

The present invention uses conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in MOLECULAR CLONING: A LABORATORY MANUAL,3nd Ed (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. The invention is not limited to any particular method, protocol, or reagents described.

The present invention will be described in detail with reference to the following embodiments.

EXAMPLE 1 screening of cellulase mutants

In order to improve the enzyme activity of wild-type cellulase NT45 (the amino acid sequence is SEQ ID NO:1, the encoding nucleotide sequence is SEQ ID NO: 2) under low temperature conditions, the applicant has carried out a large number of mutation screening on amino acids near the active site of the enzyme by directed evolution technology.

PCR primers NtE-F1 and NtE-R1 were designed as follows:

NtE-F1：GGCGAATTCATGCGCTCCT CCACCATTC (restriction enzyme underlined)EcoRI recognition sites);

NtE-R1：ATAGCGGCCGCTTAGGCGCACTGGTGGTAGTAGTC (restriction enzyme underlined)NotI recognition site).

Using wild cellulase NT45 gene (SEQ ID NO: 2) as a template, using the primers to carry out PCR amplification by using a GeneMorph II random mutation PCR kit (Stratagene), recovering PCR products by gel,EcoRI、Notand I, connecting the obtained product with a pET21a carrier subjected to enzyme digestion, converting the obtained product into escherichia coli BL21 (DE 3), coating the obtained product on an LB+Amp plate, inversely culturing at 37 ℃, picking the obtained product to 96-well plates one by using toothpicks after the transformant appears, adding 150 mu L of LB+Amp culture medium containing 0.1 mM IPTG into each well, culturing at 220rpm at 37 ℃ for about 6h, centrifuging, discarding the supernatant, resuspending the thallus with buffer solution, and repeatedly freezing and thawing to break walls to obtain escherichia coli cell lysate containing cellulase.

Taking 50 mu L of lysate to two new 96-well plates, respectively measuring the cellulase enzyme activity and the protein content of the lysate at 50 ℃, and calculating the specific activities of different mutants.

Experimental results show that some mutations have no influence on the specific activity of the cellulase at 50 ℃, some mutations even make the specific activity worse, and other mutations can improve the specific activity of the cellulase, but the enzymatic properties of the cellulase are obviously changed after the mutations, and all the mutations are not satisfactory. Finally, the applicant obtained mutation sites with significantly improved specific activity at 50 ℃, respectively: Q6T, S111N, H120Q, Q147R, D179S, S219T.

On the basis of cellulase NT45, the invention provides cellulase mutants containing single mutation sites of Q6T, S111N, H120Q, Q147R, D179S and S219T respectively.

The invention also provides cellulase mutants comprising at least 2, at least 3, at least 4, at least 5, at least 6 mutation sites in Q6T, S111N, H Q, Q147R, D179S, S219T. For example: two-point mutants of Q6T+S111N, S111N+H120Q, S111N+Q147R, H Q+Q147R, Q147R+S219T and the like; three-point mutants such as Q6T+S111 N+H2120Q, Q T+S111N+Q147R, S N+H2tQ+S219T, S111N+Q147R+S219T, H Q+Q147 R+S219T; four-point mutants such as Q6T+S111 N+H2tQ+S219T, Q T+H2tQ+Q147 R+S219T, S N+H2tQ+Q147 R+S219T; five-point mutants such as Q6T+S111 N+H2t1Q+Q147 R+S219T, S111 N+H2t1Q+Q147 R+D179 S+S219T and six-point mutants such as Q6T+S111 N+H2t1Q+Q147 R+D179 S+S219T.

EXAMPLE 2 expression of cellulase mutants in Trichoderma reesei

According to the codon preference of trichoderma, the gene sequence SEQ ID NO. 2 of cellulase NT45 and the gene sequence of mutant are respectively optimized and synthesized, and two enzyme cutting sites KpnI and MluI are respectively added at the 5 'and 3' ends of the synthesized sequence.

2.1 construction of expression vectors

The synthesized plasmid is respectively subjected to enzyme digestion by restriction enzymes KpnI (Fermentas) and XbaI; simultaneously, restriction enzymes KpnI (Fermentas) and XbaI are used for carrying out enzyme digestion on plasmid pTGII; purifying the cleavage products by using a gel purification kit, and connecting the two cleavage products by using T4 DNA ligase (Fermentas); the ligation products were transformed into Trans5α E.coli (Transgen), selected with ampicillin, and several clones were sequenced (Invitrogen) to ensure accuracy. And after the sequencing is correct, the recombinant plasmid containing the cellulase gene is obtained.

Plasmid was purified from E.coli clones with correct sequencing results using the plasmid midvolume preparation kit (Axygen).

2.2 protoplast preparation

Taking a host bacterium Trichoderma reesei U4 spore suspension of cellulase gene defect type, inoculating on a PDA plate, and culturing at 30 DEG C

For 6 days; after the spore is produced in a rich way, cutting a colony with the length of about 1cm multiplied by 1cm, placing the colony in a liquid culture medium containing 120mL of YEG+U (0.5% yeast powder, 1% glucose and 0.1% uridine), and carrying out shaking culture at 30 ℃ and 220rpm for 14-16 h; filtering and collecting mycelium with sterile gauze, and cleaning with sterile water once; mycelium was placed in a triangular flask containing 20mL 10mg/mL of lyase solution (Sigma L1412), at 30℃and 90rpm for 1-2 h; protoplast transformation progression was examined by microscopic observation.

Precooling 20mL of 1.2M sorbitol (1.2M sorbitol, 50mM Tris-Cl,50mM CaCl) ₂ ) Adding into the above triangular flask, shaking gently, filtering with sterile Miracloth filter cloth, collecting filtrate, centrifuging at 3000rpm at 4deg.C for 10min; removing the supernatant, adding precooled 5mL 1.2M sorbitol solution to suspend the thalli, centrifuging at 3000rpm and 4 ℃ for 10min; removing supernatant, adding appropriate amount of precooled 1.2M sorbitol, suspending, and packaging (200 μl/tube, protoplast concentration 10) ⁸ and/mL).

2.3 expression vector transformation and Strain verification

The following operations were all performed on ice, 10. Mu.g of recombinant plasmid was added to a sterile 7mL centrifuge tube containing 200. Mu.L of protoplast solution, followed by 50. Mu.L of 25% PEG (25% PEG,50mM Tris-Cl,50mM CaCl2), gently flicked tube bottom mix, and left on ice for 20min; 2mL of 25% PEG is added, and the mixture is placed for 5min at room temperature after uniform mixing; 4mL of 1.2M sorbitol was added, gently mixed, and poured into an upper medium (0.1% MgSO4,1% KH2PO4,0.6% (NH 4) 2SO4,1% glucose, 18.3% sorbitol, 0.35% agarose) melted and maintained at 55deg.C; after gentle mixing, the mixture was spread on a prepared lower medium plate (2% glucose, 0.5% (NH 4) 2SO4,1.5% KH2PO4,0.06% MgSO4,0.06% CaCl2,1.5% agar), and cultured at 30℃for 5-7 d until transformants grew. And selecting the transformant to a lower culture medium plate for re-screening, and culturing for 2 days at 30 ℃ to obtain the strain with smoother colony edge morphology as the positive transformant.

A proper amount of mycelium is taken and placed in a 2mL centrifuge tube, and 100mg of sterile quartz sand and 400 mu L of extraction buffer (100 mM Tris-HCl,100mM EDTA,250mM NaCl,1%SDS) are added; shaking vigorously with a bead beating instrument for 2min; after 20min of water bath at 65 ℃,200 mu L of 10M NH is added ₄ AC, ice bath for 10min; centrifuging at 13000rpm for 10min; taking the supernatant, adding 2 times of absolute ethyl alcohol, and standing at-20 ℃ for 30min; centrifuging at 13000rpm for 10min, and discarding supernatant; washing with 70% ethanol for 2 times; air-dryingDissolving in water, and storing at-20deg.C.

The genome DNA of the extracted transformant is used as a template, and primers M6-F and M6-R are used for carrying out PCR amplification on target genes for verification.

M6-F：ATGCGCTCCT CCACCATTC

M6-R: TTAGGCGCACTGGTGGTAGTAGTC PCR amplification conditions were 94℃for 4min;94 ℃ for 40s;58 ℃ 40s,72 ℃ 1min,30 cycles; 7min at 72℃and 16 ℃; and (5) recovering PCR amplification products by using a gel recovery kit and performing sequencing analysis.

According to the method, the applicant respectively constructs and obtains recombinant expression cellulase NT45 and Trichoderma reesei engineering strains of the mutants.

Example 3 fermentation verification

Inoculating Trichoderma reesei engineering strain obtained by the above construction to PDA solid plate, culturing at 30deg.C for 6d, collecting two pieces of mycelium blocks with diameter of 1cm after spore is abundant, inoculating into 250 mL triangular flask containing 50 mL fermentation medium (1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH) ₄ ) ₂ SO ₄ ，0.09% MgSO ₄ ，2% KH ₂ PO ₄ ，0.04% CaCl ₂ 0.018% tween-80,0.018% trace elements), at 30 ℃ for 48 hours, then at 25 ℃ for 48 hours. And centrifuging the fermentation liquor to obtain fermentation supernatant respectively containing the cellulase NT45 and the mutants.

3.1 Enzyme activity assay

(1) Definition of cellulase enzyme activity

The amount of enzyme required to degrade and release 1. Mu. Mol of reducing sugar per minute from a sodium hydroxymethyl cellulose solution with a concentration of 5 mg/ml at 50 ℃ and a pH value of 6.0 is one enzyme activity unit U, and the reducing sugar is glucose equivalent.

(2) Cellulase enzyme assay method

Three test tubes were each added with 0.5 mL CMC substrate and preheated in a water bath at 50℃for 5min with the enzyme solution to be tested. And adding 0.5. 0.5 mL to-be-detected liquid into each of the first test tube and the second test tube, timing, and reacting for 15 min in a water bath at 50 ℃. After the reaction was completed, 1.5 mL of DNS reagent was added to each of the three test tubes, and the third test tube was supplemented with 0.5. 0.5 mL of enzyme solution to be tested. After taking out and shaking three test tubes, the reaction was carried out in a boiling water bath for 5 min. Cool rapidly to room temperature and set with water to 5.0. 5.0 mL. The absorbance of the first test tube and the second test tube is preferably 0.25-0.35 under the condition of 540 and nm wavelength by taking the third test tube as a control. The absolute value of the difference between the absorbance of the enzyme liquid reaction liquid to be detected and the absorbance of the enzyme liquid reaction liquid is controlled to be not more than 0.015.

Enzyme activity x= (glucose equivalent/180/15/0.5) ×n

Wherein: x is enzyme activity unit, IU/g (mL);

180—glucose converted from micrograms to micromolar;

15-reaction time of the test solution with the substrate;

0.5-adding the amount of enzyme to be detected in the reaction;

n-dilution factor.

(3) Measurement results

The enzyme activity detection is carried out according to the method, and the result shows that: the enzyme activity of the recombinant expression wild cellulase NT45 and the mutant thereof obtained by the construction is 33-110U/mL under the condition of 50 ℃.

Protein content determination

(1) The measuring method comprises the following steps:

the determination of protein content by coomassie brilliant blue (Bradford) binding is a complex method of colorimetry combined with the pigment method. Coomassie brilliant blue G-250 appears brownish red in acidic solution, turns blue when bound to protein, and accords with beer's law in a certain concentration range of protein, and can be colorimetrically measured at 595 nm. A large amount of absorption is obtained in 3-5 minutes, and the absorption is stable for at least 1 hour. In the range of 10-1000. Mu.g/mL, absorbance is proportional to protein concentration.

According to the volume ratio of the enzyme solution to the coomassie brilliant blue solution of 1:5, and standing for 10 mm, and determining protein content by Coomassie Brilliant blue (Bradford) binding method.

(2) Protein content measurement results

And respectively detecting the content of cellulase protein in the fermentation supernatant of the Trichoderma reesei engineering bacteria according to the method. The results show that: recombinant expression wild cellulase NT45 and mutant thereof have protein content of 0.04-0.1 mg/mL at 50 ℃.

Calculation of specific Activity

"specific activity (Specific Activity)" means: the number of units of enzyme activity per unit weight of protein is generally expressed as U/mg protein. In general, the higher the specific activity of an enzyme, the purer the enzyme.

The specific activity calculation formula: specific activity (U/mg) =enzyme activity (U/mL)/protein content (mg/mL).

The specific activity of the recombinant expression cellulase NT45 and mutants thereof obtained in the embodiment 3 of the invention, namely the fermentation supernatant of Trichoderma reesei engineering bacteria at 50 ℃, is shown in Table 1.

TABLE 1 specific Activity of cellulase NT45 and mutants thereof at 50℃

Cellulase enzymes	Specific activity at 50 DEG C
		Cellulase NT45	280
Q6T single point mutant	308
		S111N single point mutant	420
H120Q single point mutant	300
		Q147R single point mutant	364
D179S single point mutant	310
		S219T single point mutant	322

As can be seen from the data in Table 1, compared with the wild type cellulase NT45, the specific activity of the single-point mutant provided by the invention is generally improved by 7.1% -50% at 50 ℃, so that the specific activity of the single-point mutant provided by the invention is obviously improved at a low temperature of 50 ℃. Wherein, the specific activities of the S111N single-point mutant and the Q147R single-point mutant are respectively improved by 50 percent and 30 percent, and unexpected technical effects are obtained.

EXAMPLE 4 use of cellulase mutants in the textile sector

4.1 dehairing and dyeing one bath process for knitted fabric and woven fabric

The application temperature is 35-55 ℃;

the treatment time is 30-150 min;

the pH range is 4.0-8.5;

the process conditions are particularly suitable for the condition of dyeing in the same bath; the applicable bath ratio is in the range of 1:5-1:30, the type of equipment used is overflow dyeing machine, jig dyeing machine, washing machine and the like, and the dosage of the cellulase mutant is 300-900U/L.

The cellulase mutant provided by the invention is clean in hair removal, has small strength loss on fabrics, and can realize the integrated one-bath of dyeing and hair removal processes.

4.2 Application of jean fabric in flower forming and hair removal

The application temperature is 35-55 ℃;

the treatment time is 10-60 min;

the pH range is 4.0-8.5;

the process conditions can be applied to the dehairing and flower forming process under the condition of desizing and independent stone milling; the applicable bath ratio is in the range of 1:5-1:30, the type of equipment used is industrial washing machine, and the dosage of the cellulase mutant is 220-800U/L.

The cellulase mutant provided by the invention has the advantages of clean hair removal, uniform flower formation, smaller flower points and small strength loss to fabrics.

The experimental result shows that the high specific activity cellulase mutant can be widely applied to the textile processing field, can be applied at the low temperature of 35-55 ℃ and the pH value of 4.0-8.5, can be directly used without acid regulation, and has good effect; the hair is removed cleanly, and the strength loss of the fabric is small; the jean is washed with water, the flower is small, the flower point is small, and the batch difference is stable; the salt tolerance is good, and the polishing and dyeing one-bath process which can be used for neutralization and deoxidization can be directly used, so that the working hours can be greatly saved, and the production cost can be reduced.

And compared with wild cellulase NT45, the dosage of the cellulase mutant required for achieving the same treatment effect is reduced by 36-68%, so that the enzyme cost in the processing process is obviously reduced, and the production cost is further improved.

Sequence listing

<110> Qingdao blue biological group Co.Ltd

<120> a high specific activity cellulase mutant and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 272

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 1

Ala Ser Gly Ser Gly Gln Ser Thr Arg Tyr Trp Asp Cys Cys Lys Pro

1 5 10 15

Ser Cys Ser Trp Ser Gly Lys Ala Ser Val Asn Arg Pro Val Leu Ala

20 25 30

Cys Asp Ala Asn Asn Asn Pro Leu Ser Asp Ala Ser Val Lys Ser Gly

35 40 45

Cys Asp Gly Gly Ser Ala Tyr Thr Cys Ala Asn Asn Ser Pro Trp Ala

50 55 60

Val Asn Asp Gln Leu Ser Tyr Gly Phe Ala Ala Thr Lys Leu Ser Gly

65 70 75 80

Gly Thr Glu Ser Ser Trp Cys Cys Ala Cys Tyr Ala Leu Thr Phe Thr

85 90 95

Ser Gly Pro Val Ala Gly Lys Thr Met Val Val Gln Ser Thr Ser Thr

100 105 110

Gly Gly Asp Leu Gly Ser Asn His Phe Asp Ile Asn Met Pro Gly Gly

115 120 125

Gly Val Gly Leu Phe Asp Gly Cys Thr Arg Gln Phe Gly Gly Leu Pro

130 135 140

Gly Ala Gln Tyr Gly Gly Ile Ser Ser Arg Ser Gln Cys Asp Ser Phe

145 150 155 160

Pro Ala Ala Leu Lys Pro Gly Cys Gln Trp Arg Phe Asp Trp Phe Gln

165 170 175

Asn Ala Asp Asn Pro Asn Phe Thr Phe Lys Gln Val Gln Cys Pro Ser

180 185 190

Glu Leu Thr Ser Arg Thr Gly Cys Lys Arg Asn Asp Asp Ser Gln Phe

195 200 205

Pro Val Phe Thr Pro Pro Ser Gly Gly Gly Ser Asn Pro Ser Thr Pro

210 215 220

Thr Thr Pro Pro Ser Ser Gly Gly Gly Ser Gly Cys Thr Ala Asp Lys

225 230 235 240

Tyr Ala Gln Cys Gly Gly Ser Gly Trp Ser Gly Cys Thr Asn Cys Pro

245 250 255

Ser Gly Ser Thr Cys Lys Thr Ile Asn Asp Tyr Tyr His Gln Cys Ala

260 265 270

<210> 2

<211> 819

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

gcctcgggct cgggccagtc cacccgctac tgggactgct gcaagcccag ctgctcctgg 60

tcgggcaagg cctccgtcaa ccgccccgtc ctcgcctgcg acgccaacaa caaccccctg 120

tcggacgcca gcgtcaagtc cggctgcgac ggcggctccg cctacacctg cgccaacaac 180

tcgccctggg ccgtcaacga ccagctctcc tacggcttcg ccgccaccaa gctgtcgggc 240

ggcacggaga gctcctggtg ctgcgcctgc tacgccctca cctttacgtc cggccccgtc 300

gccggcaaga ccatggtcgt ccagagcacc tccacgggcg gcgacctggg cagcaaccac 360

ttcgacatca acatgcccgg cggcggcgtc ggcctcttcg acggctgcac gcgccagttt 420

ggcggcctgc ccggcgccca gtacggcggc atttcgagcc gcagccagtg cgactccttc 480

cccgccgccc tcaagcccgg ctgccagtgg cgcttcgact ggtttcagaa cgccgacaac 540

cccaacttca cctttaagca ggtccagtgc ccctcggagc tgaccagccg cacgggctgc 600

aagcgcaacg acgacagcca gttccccgtc tttacccccc cctccggcgg cggctcgaac 660

cccagcacgc ccaccacgcc cccctcctcg ggcggcggct ccggctgcac cgccgacaag 720

tacgcccagt gcggcggctc cggctggtcg ggctgcacga actgccccag cggctccacc 780

tgcaagacca tcaacgacta ctaccaccag tgcgcctaa 819

Claims

1. A cellulase mutant, which is characterized in that the 111 th amino acid of the cellulase with the amino acid sequence of SEQ ID NO. 1 is changed from Ser to Asn.

2. A DNA molecule encoding the cellulase mutant of claim 1.

3. A vector having the DNA molecule of claim 2.

4. A host cell comprising the vector of claim 3.

5. The host cell of claim 4, wherein the host cell is Trichoderma reeseiTrichoderma reesei）。

6. Use of the cellulase mutant according to claim 1 in the textile field.