CN112795555A - High-specific-activity cellulase mutant and application thereof - Google Patents
High-specific-activity cellulase mutant and application thereof Download PDFInfo
- Publication number
- CN112795555A CN112795555A CN201911104794.5A CN201911104794A CN112795555A CN 112795555 A CN112795555 A CN 112795555A CN 201911104794 A CN201911104794 A CN 201911104794A CN 112795555 A CN112795555 A CN 112795555A
- Authority
- CN
- China
- Prior art keywords
- mutant
- cellulase
- enzyme
- ser
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/2437—Cellulases (3.2.1.4; 3.2.1.74; 3.2.1.91; 3.2.1.150)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Abstract
The invention relates to the technical field of genetic engineering and protein modification, in particular to a high-specific-activity cellulase mutant and application thereof. The present invention provides a mutant comprising an amino acid substitution at least one position selected from the group consisting of: 6,111, 120, 147, 179, 219. The specific activity of the mutant is obviously improved at 50 ℃, so that the cellulase can be widely applied to the textile field.
Description
Technical Field
The invention relates to the technical field of genetic engineering and protein modification, in particular to a high-specific-activity cellulase mutant and application thereof.
Background
Cellulase is a complex enzyme system composed of a plurality of hydrolytic enzymes, and is mainly divided into the following enzymes according to the different functions of catalytic reaction: the degradation of cellulose by exo-beta-glucanase, endo-beta-glucanase and beta-glucosidase and cellulase is completed under the synergistic action of various enzyme components.
Cellulases are widely present in organisms in the natural world, and can be produced in bacteria, fungi, animals, and the like. Cellulases generally used in industrial production are derived from fungi, typically Trichoderma, Aspergillus and Penicillium. Cellulases are one of the most widely used enzymes in industry, and have great potential markets in general in the textile industry, detergent industry, pulp and paper industry, feed and food industry, oil recovery, medicine, etc.
Cellulases can be classified by their primary sequence into various glycosyl hydrolase families, e.g., glycosyl hydrolase families 5, 7, 12 and 45 contain endoglucanases. Most of the textile acid cellulases belong to family 5, while most of the textile neutral cellulases are family 12 or 45.
At present, cellulose fabrics are subjected to biological finishing, namely enzyme degradation finishing, by using cellulase, and the cellulose fabrics are widely applied due to the effects of environmental protection, energy conservation and high efficiency. The fabric is fluffy, plump, soft, smooth, clear in cloth cover, good in drapability, strong in hygroscopicity and has a certain mercerizing effect, and the cellulose is used in an amount of 0.5-3%, so that a satisfactory finishing effect can be achieved. Neutral cellulase has mild fabric degradation effect, less fabric strength loss and less staining, and can obtain plump hand feeling after treatment, so that the neutral cellulase is widely applied in the textile industry and has urgent need, most industrial cellulase generally has higher catalytic efficiency under the condition of higher than 50 ℃, but in the textile field, in order to save heating or cooling cost, the enzyme preparation still has good performance and high specific activity under the low temperature level (lower than 50 ℃) in order to improve the fastness of fabric color and reduce the shrinkage of clothes is urgently needed.
Disclosure of Invention
The invention aims to provide a cellulase mutant with high specific activity and application thereof. The mutant protein is obtained by carrying out protein engineering transformation on the cellulase. Compared with the wild type, the specific activity of the mutant is obviously improved, and the mutant can be widely applied to the field of textile processing.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention relates to a cellulase mutant, which comprises a mutant strain similar to SEQ ID NO:1 and an amino acid sequence having at least 90% identity to SEQ ID No. 1, and having an amino acid substitution at least one of position 6, 111, 120, 147, 179, 219 compared to SEQ ID No. 1.
In some embodiments of the invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity to SEQ ID No. 1.
In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity to SEQ ID No. 1.
In some embodiments of the invention, the mutant comprises a substitution of at least one amino acid of the group: Q6T, S111N, H120Q, Q147R, D179S, S219T.
In some embodiments of the invention, the mutant comprises the following substitution or combination of substitutions:
Q6T；
Q6T+ S111N；
Q6T+ H120Q；
Q6T+ Q147R；
Q6T+ D179S；
Q6T+ S219T；
Q6T+ S111N+ H120Q；
Q6T+ S111N+ Q147R；
Q6T+ S111N+ D179S；
Q6T+ S111N+ S219T；
Q6T+ H120Q+ Q147R；
Q6T+ H120Q+ D179S；
Q6T+ H120Q+ S219T；
Q6T+ Q147R+ D179S；
Q6T+ Q147R+ S219T；
Q6T+ D179S + S219T；
Q6T+ S111N+ H120Q+ Q147R；
Q6T+ S111N+ H120Q+ D179S；
Q6T+ S111N+ H120Q+ S219T；
Q6T+ H120Q+ Q147R+ D179S；
Q6T+ H120Q+ Q147R+ S219T；
Q6T+ Q147R+ D179S + S219T；
Q6T+ S111N+ H120Q+ Q147R+ D179S；
Q6T+ S111N+ H120Q+ Q147R+ S219T；
Q6T+ H120Q+ Q147R+ D179S+ S219T；
Q6T+ S111N + Q147R+ D179S+ S219T；
Q6T+ S111N + H120Q + D179S+ S219T；
Q6T+ S111N+ H120Q+ Q147R+ D179S+ S219T；
S111N；
S111N+H120Q；
S111N+Q147R；
S111N+ D179S；
S111N+S219T；
S111N + H120Q+ Q147R；
S111N + H120Q+ D179S；
S111N + H120Q+ S219T；
S111N + Q147R+ D179S；
S111N + Q147R+ S219T；
S111N + D179S+ S219T；
S111N + H120Q+ Q147R+ D179S；
S111N + H120Q+ Q147R+ S219T；
S111N + H120Q+ D179S + S219T；
S111N + Q147R+ D179S+ S219T；
S111N + H120Q+ Q147R+ D179S+ S219T；
H120Q；
H120Q +Q147R；
H120Q + D179S；
H120Q +S219T；
H120Q + Q147R+ D179S；
H120Q + Q147R+ S219T；
H120Q + D179S + S219T；
H120Q + Q147R+ D179S+ S219T；
Q147R；
Q147R+ D179S；
Q147R+ S219T；
Q147R+ D179S+ S219T；
D179S；
D179S+ S219T；
S219T。
the invention also relates to a DNA molecule for coding the cellulase mutant.
The invention also relates to a recombinant expression vector containing the DNA molecule.
The invention also relates to a host cell comprising the recombinant expression vector.
In some embodiments of the invention, the host cell is trichoderma reesei (trichoderma reesei) (ii)Trichoderma reesei）。
The recombinant expression vector is transferred into a trichoderma reesei host cell for recombinant expression, and the obtained cellulase mutant has higher specific activity.
The invention also relates to application of the cellulase mutant in the textile field.
The cellulase mutant provided by the invention has higher specific activity at 50 ℃. Compared with the wild type, the specific activity of the cellulase mutants respectively containing single-point mutations of Q6T, S111N, H120Q, Q147R, D179S and S219T is generally improved by 7.1-50% at 50 ℃. The specific activities of the S111N single-point mutant and the Q147R single-point mutant are respectively improved by 50% and 30%, and unexpected technical effects are achieved.
In addition, the invention provides cellulase mutants comprising at least 2, at least 3, at least 4, at least 5, at least 6 mutation sites in Q6T, S111N, H120Q, Q147R, D179S, S219T. For example: two-point mutants such as Q6T + S111N, S111N + H120Q, S111N + Q147R, H120Q + Q147R and Q147R + S219T; three-point mutants such as Q6T + S111N + H120Q, Q6T + S111N + Q147R, S111N + H120Q + S219T, S111N + Q147R + S219T, H120Q + Q147R + S219T; four-point mutants such as Q6T + S111N + H120Q + S219T, Q6T + H120Q + Q147R + S219T, S111N + H120Q + Q147R + S219T; compared with the wild-type cellulase NT45, the specific activity of the five-point mutants such as Q6T + S111N + H120Q + Q147R + S219T, S111N + H120Q + Q147R + D179S + S219T and the six-point mutants such as Q6T + S111N + H120Q + Q147R + D179S + S219T at 50 ℃ is generally improved by 10% -82%, and unexpected technical effects are achieved.
In conclusion, compared with the wild type cellulase mutant, the cellulase mutant is more suitable for the field of textile industry, can greatly reduce the dosage of cellulase, save labor hour and energy, and reduce production cost.
Detailed Description
The present invention uses conventional techniques and methods used IN the fields of genetic engineering and MOLECULAR BIOLOGY, such as the methods described IN MOLECULAR CLONING, A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. The present invention is not limited to any particular methodology, protocols, and reagents described.
The present invention will be described in detail with reference to specific embodiments.
EXAMPLE 1 screening of cellulase mutants
In order to improve the enzyme activity of the wild-type cellulase NT45 (the amino acid sequence is SEQ ID NO:1, and the coding nucleotide sequence is SEQ ID NO: 2) under the low-temperature condition, the applicant screens amino acids near the active site of the enzyme by a directed evolution technology.
PCR primers NtE-F1, NtE-R1 were designed as follows:
NtE-F1：GGCGAATTCATGCGCTCCT CCACCATTC (restriction enzymes underlined)EcoRI recognition sites);
NtE-R1：ATAGCGGCCGCTTAGGCGCACTGGTGGTAGTAGTC (restriction enzymes underlined)NotI recognition site).
Using wild cellulase NT45 gene (SEQ ID NO: 2) as a template, performing PCR amplification by using the primer and a GeneMorph II random mutation PCR kit (Stratagene), recovering PCR products by using the gel,EcoRI、Notconnecting the I subjected to enzyme digestion treatment with a pET21a vector subjected to the same enzyme digestion, converting the I into escherichia coli BL21(DE3), coating the escherichia coli BL21 on an LB + Amp flat plate, carrying out inverted culture at 37 ℃, after transformants appear, picking the transformants one by one to a 96-well plate by using toothpicks, adding 150 mu L of LB + Amp culture medium containing 0.1 mM IPTG into each well, carrying out culture at 37 ℃ and 220rpm for about 6h, centrifuging, discarding supernatant, resuspending the thalli by using buffer solution, and repeatedly freezing and thawing to obtain escherichia coli cell wall-breaking lysate containing cellulase.
50 mu L of lysate is taken out to two new 96-well plates, the cellulase activity and the protein content are respectively measured under the condition of 50 ℃, and the specific activity of different mutants is calculated.
The experimental result shows that some mutations have no influence on the specific activity of the cellulase at 50 ℃, some mutations even make the specific activity worse, and in addition, some mutations can improve the specific activity of the cellulase, but the enzymatic properties of the cellulase are obviously changed after the mutations, and the mutations do not meet the requirements. Finally, the applicant obtained mutation sites with significantly improved specific activity at 50 ℃, respectively: Q6T, S111N, H120Q, Q147R, D179S, S219T.
On the basis of the cellulase NT45, the invention provides cellulase mutants respectively containing single mutation sites of Q6T, S111N, H120Q, Q147R, D179S and S219T.
The invention also provides cellulase mutants comprising at least 2, at least 3, at least 4, at least 5, at least 6 mutation sites in Q6T, S111N, H120Q, Q147R, D179S, S219T. For example: two-point mutants such as Q6T + S111N, S111N + H120Q, S111N + Q147R, H120Q + Q147R and Q147R + S219T; three-point mutants such as Q6T + S111N + H120Q, Q6T + S111N + Q147R, S111N + H120Q + S219T, S111N + Q147R + S219T, H120Q + Q147R + S219T; four-point mutants such as Q6T + S111N + H120Q + S219T, Q6T + H120Q + Q147R + S219T, S111N + H120Q + Q147R + S219T; five-point mutants such as Q6T + S111N + H120Q + Q147R + S219T, S111N + H120Q + Q147R + D179S + S219T and six-point mutants such as Q6T + S111N + H120Q + Q147R + D179S + S219T.
Example 2 expression of cellulase mutants in Trichoderma reesei
According to the codon preference of trichoderma, the gene sequence SEQ ID NO. 2 of the cellulase NT45 and the gene sequence of the mutant are optimized and synthesized respectively, and two enzyme cutting sites KpnI and MluI are added at the two ends of the 5 'and 3' of the synthesized sequence respectively.
2.1 expression vector construction
The synthesized plasmid is cut by restriction enzymes KpnI (Fermentas) and XbaI respectively; simultaneously carrying out enzyme digestion on the plasmid pTGII by using restriction enzymes KpnI (Fermentas) and XbaI; purifying the enzyme products by using a gel purification kit, and connecting the two enzyme products by using T4 DNA ligase (Fermentas); the ligation products were transformed into Trans5 alpha E.coli (Transgen) and selected with ampicillin, and several clones were sequenced to ensure accuracy (Invitrogen). And (4) obtaining the recombinant plasmid containing the cellulase gene after the sequencing is correct.
Plasmids were purified from E.coli clones with correct sequencing using a plasmid quantitation kit (Axygen).
2.2 protoplast preparation
Inoculating cellulase gene-deficient host strain Trichoderma reesei U4 spore suspension on PDA plate, and culturing at 30 deg.C
6 days; after the spore production is rich, cutting a colony of about 1cm multiplied by 1cm into a liquid culture medium containing 120mL YEG + U (0.5% yeast powder, 1% glucose, 0.1% uridine), and carrying out shake culture at 30 ℃ and 220rpm for 14-16 h; filtering with sterile gauze to collect mycelium, and washing with sterile water; placing the mycelium in a triangular flask containing 20mL of 10mg/mL lyase solution (Sigma L1412) and reacting at 30 ℃ and 90rpm for 1-2 h; the progress of protoplast transformation was examined by microscopic observation.
Pre-cooled 20mL of 1.2M sorbitol (1.2M sorbitol, 50mM Tris-Cl, 50mM CaCl)2) Adding into the triangular flask, shaking gently, filtering with sterile Miracloth, collecting filtrate, centrifuging at 3000rpm and 4 deg.C for 10 min; discarding the supernatant, adding pre-cooled 5mL of 1.2M sorbitol solution to suspend the thalli, and centrifuging at 3000rpm and 4 ℃ for 10 min; discarding the supernatant, adding appropriate amount of precooled 1.2M sorbitol, suspending and packaging (200. mu.L/tube, protoplast concentration of 10)8one/mL).
2.3 expression vector transformation and Strain validation
The following procedures were all performed on ice, 10. mu.g of recombinant plasmid was added to a sterile 7mL centrifuge tube containing 200. mu.L of protoplast solution, 50. mu.L of 25% PEG (25% PEG, 50mM Tris-Cl, 50mM CaCl 2) was then added, the tube bottom was flicked and mixed, and the mixture was left on ice for 20 min; adding 2mL of 25% PEG, uniformly mixing, and standing at room temperature for 5 min; 4mL of 1.2M sorbitol was added, gently mixed and poured into the upper medium (0.1% MgSO4, 1% KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorbitol, 0.35% agarose) which was melted and maintained at 55 ℃; after being gently mixed, the mixture is spread on a prepared lower layer culture medium plate (2% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.06% MgSO4, 0.06% CaCl2 and 1.5% agar) and cultured for 5-7 days at the temperature of 30 ℃ until transformants grow out. And selecting transformants to a lower layer culture medium plate for secondary screening, and culturing at 30 ℃ for 2d, wherein the strains with smooth colony edge morphology are positive transformants.
Placing an appropriate amount of mycelium into a 2mL centrifuge tube, adding 100mg of sterile quartz sand and 400. mu.L of extraction buffer (100 mM Tris-HCl, 100mM EDTA, 250mM NaCl, 1% SDS); shaking vigorously for 2min with bead beating instrument; after being bathed in water at 65 ℃ for 20min, 200 mu L of 10M NH is added4AC, ice-bath for 10 min; centrifuging at 13000rpm for 10 min; taking the supernatant, adding 2 times of anhydrous ethanol, and standing at-20 deg.C for 30 min; centrifuging at 13000rpm for 10min, and discarding the supernatant; washing with 70% ethanol for 2 times; air drying, dissolving in water, and storing at-20 deg.C.
The genomic DNA of the transformant extracted above is used as a template, and primers M6-F and M6-R are used for carrying out PCR amplification on a target gene for verification.
M6-F：ATGCGCTCCT CCACCATTC
M6-R: TTAGGCGCACTGGTGGTAGTAGTC PCR the amplification condition is 94 ℃ for 4 min; 94 ℃ for 40 s; at 58 ℃ for 40s, at 72 ℃ for 1min, for 30 cycles; 7min at 72 ℃ and 16 ℃; and (3) recovering the PCR amplification product by using a gel recovery kit and performing sequencing analysis.
According to the method, the applicant respectively constructs the Trichoderma reesei engineering strain for obtaining the recombinant expression cellulase NT45 and the mutant.
Example 3 fermentation validation
Respectively inoculating the Trichoderma reesei engineering strains obtained by the construction on a PDA solid plate, culturing at 30 ℃ for 6 days, after spores are abundant, taking two hypha blocks with the diameter of 1cm, inoculating the two hypha blocks into a 250 mL triangular flask (1.5% of glucose, 1.7% of lactose, 2.5% of corn steep liquor and 0.44% (NH) containing 50 mL fermentation medium4)2SO4，0.09% MgSO4，2% KH2PO4，0.04% CaCl20.018% tween-80, 0.018% trace elements), cultured at 30 ℃ for 48 hours, and then at 25 ℃ for 48 hours. And centrifuging the fermentation liquor to obtain fermentation supernatants respectively containing the cellulase NT45 and the mutant.
3.1 enzyme Activity assay
(1) Definition of cellulase Activity
Under the conditions of 50 ℃ and pH value of 6.0, the enzyme amount required for degrading and releasing 1 mu mol of reducing sugar from 5 mg/ml of carboxymethyl cellulose sodium solution per minute is one enzyme activity unit U, and the reducing sugar is equal to glucose.
(2) Cellulase enzyme determination method
Adding 0.5 mL CMC substrate into each of the three test tubes, and preheating with the enzyme solution to be tested in 50 deg.C water bath for 5 min. 0.5 mL of the solution to be detected was added to each of the first and second test tubes, and the mixture was reacted in a water bath at 50 ℃ for 15 min while counting the time. After the reaction, 1.5 mL of DNS reagent is added into each of the three test tubes, and 0.5 mL of enzyme solution to be detected is added into the third test tube. The three tubes were taken out and shaken up, and then reacted for 5min in a boiling water bath. It was rapidly cooled to room temperature and adjusted to 5.0 mL with water. And (3) measuring the absorbance of the first and second test tube solutions at 540 nm wavelength by using the third test tube solution as a control, preferably, the absorbance is 0.25-0.35. The absolute value of the difference between the absorbance of the enzyme liquid reaction solution to be detected and the absorbance of the enzyme liquid reaction solution for horizontal control is not more than 0.015.
Enzyme activity X ═ (glucose equivalent/180/15/0.5). times.n
Wherein: x is enzyme activity unit, IU/g (mL);
180-conversion of glucose from micrograms to micromoles;
15-reaction time of the solution to be tested and the substrate;
0.5-the amount of enzyme solution to be measured added;
n is the dilution multiple.
(3) Measurement results
Enzyme activity detection is carried out according to the method, and the result shows that: the enzyme activity of the constructed recombinant expression wild cellulase NT45 and the Trichoderma reesei engineering bacteria fermentation supernatant of the mutant thereof at 50 ℃ is 33-110U/mL.
Protein content determination
(1) The determination method comprises the following steps:
the Coomassie brilliant blue (Bradford) binding method for determining protein content is a combined method of a colorimetric method and a pigment method. Coomassie Brilliant blue G-250 is reddish brown in acidic solution, turns blue when combined with protein, conforms to beer's law in a certain concentration range of protein, and can be measured colorimetrically at 595 nm. Absorbing a large amount of the active ingredients within 3-5 minutes, and stabilizing for at least 1 hour. Within the range of 10-1000 mug/mL, the light absorption value is in direct proportion to the protein concentration.
According to the volume ratio of the enzyme solution to the Coomassie brilliant blue solution of 1:5, and left to stand for 10 mm, and the protein content was determined by Coomassie Brilliant blue (Bradford) binding method.
(2) Protein content measurement results
And respectively detecting the content of the cellulase protein in the fermentation supernatant of the trichoderma reesei engineering bacteria according to the method. The results show that: the protein content of the fermentation supernatant of the trichoderma reesei engineering bacteria for recombining and expressing the wild cellulase NT45 and the mutant thereof at 50 ℃ is 0.04-0.1 mg/mL.
Calculation of specific Activity
"Specific Activity" means: the number of units of enzyme activity per weight of protein is generally expressed as U/mg protein. In general, the higher the specific activity of the enzyme, the purer the enzyme.
Specific activity calculation formula: specific activity (U/mg) = enzyme activity (U/mL)/protein content (mg/mL).
The specific activity of the fermentation supernatant of the trichoderma reesei engineering bacteria of the recombinant expression cellulase NT45 and the mutant thereof constructed in the embodiment 3 of the invention at 50 ℃ is shown in table 1.
TABLE 1 specific Activity of cellulase NT45 and its mutants at 50 deg.C
| Cellulase enzymes | Specific activity at 50 deg.C |
| Cellulase NT45 | 280 |
| Q6T single point mutant | 308 |
| S111N single point mutant | 420 |
| H120Q single point mutant | 300 |
| Q147R single point mutant | 364 |
| D179S single point mutant | 310 |
| S219T Single Point mutant | 322 |
As can be seen from the data in Table 1, compared with the wild-type cellulase NT45, the specific activity of the single-point mutant provided by the invention at 50 ℃ is generally improved by 7.1% -50%, thereby demonstrating that the specific activity of the single-point mutant provided by the invention at 50 ℃ is remarkably improved. The specific activities of the S111N single-point mutant and the Q147R single-point mutant are respectively improved by 50% and 30%, and unexpected technical effects are achieved.
In addition, the invention provides cellulase mutants comprising at least 2, at least 3, at least 4, at least 5, at least 6 mutation sites in Q6T, S111N, H120Q, Q147R, D179S, S219T. For example: two-point mutants such as Q6T + S111N, S111N + H120Q, S111N + Q147R, H120Q + Q147R and Q147R + S219T; three-point mutants such as Q6T + S111N + H120Q, Q6T + S111N + Q147R, S111N + H120Q + S219T, S111N + Q147R + S219T, H120Q + Q147R + S219T; four-point mutants such as Q6T + S111N + H120Q + S219T, Q6T + H120Q + Q147R + S219T, S111N + H120Q + Q147R + S219T; compared with the wild-type cellulase NT45, the specific activity of the five-point mutants such as Q6T + S111N + H120Q + Q147R + S219T, S111N + H120Q + Q147R + D179S + S219T and the six-point mutants such as Q6T + S111N + H120Q + Q147R + D179S + S219T at 50 ℃ is generally improved by 10% -82%, and unexpected technical effects are achieved.
Example 4 application of cellulase mutants in the textile field
4.1 wool-removing dyeing one-bath process for knitted fabric and woven fabric
The application temperature is 35-55 ℃;
the treatment time is 30-150 min;
the pH range is 4.0-8.5;
the above process conditions are particularly suitable for the case of dyeing one bath; the applicable bath ratio ranges from 1:5 to 1:30, the types of the used equipment are an overflow dyeing machine, a jig dyeing machine, a water washing machine and the like, and the dosage of the cellulase mutant is 300-.
The cellulase mutant provided by the invention has the advantages of clean hair removal, small strength loss on fabrics and capability of realizing one-bath integration of dyeing and hair removal processes.
4.2 patterning and dehairing application of denim fabric
The application temperature is 35-55 ℃;
the treatment time is 10-60 min;
the pH range is 4.0-8.5;
the above process conditions can be applied to the processes of desizing and unhairing and raising under the condition of single stone washing; the applicable bath ratio ranges from 1:5 to 1:30, the used equipment types are an industrial washing machine and the like, and the dosage of the cellulase mutant is 220- & ltSUB & gt 800U/L.
The cellulase mutant provided by the invention has the advantages of clean hair removal, uniform flowering, small flower spots and small strength loss on fabrics.
The experimental results show that the high specific activity cellulase mutant can be widely applied to the field of textile processing, can be applied at the low temperature of 35-55 ℃ and in the pH range of 4.0-8.5, can be directly used without acid regulation, and has good effect; the wool is removed completely, and the strength loss of the fabric is small; washing the jean with water, wherein the blossoming is small, the flower spots are small, and the batch difference is stable; the salt resistance is good, and the method can be directly used for the polishing and dyeing one-bath process after neutralization and deoxidization, thereby greatly saving the working hours and reducing the production cost.
And compared with the wild cellulase NT45, the dosage of the cellulase mutant required for achieving the same treatment effect is reduced by 36-68%, so that the enzyme cost in the processing process is obviously reduced, and the method is favorable for further improving and reducing the production cost.
Sequence listing
<110> Islands blue biological group Co Ltd
<120> cellulase mutant with high specific activity and application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 272
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 1
Ala Ser Gly Ser Gly Gln Ser Thr Arg Tyr Trp Asp Cys Cys Lys Pro
1 5 10 15
Ser Cys Ser Trp Ser Gly Lys Ala Ser Val Asn Arg Pro Val Leu Ala
20 25 30
Cys Asp Ala Asn Asn Asn Pro Leu Ser Asp Ala Ser Val Lys Ser Gly
35 40 45
Cys Asp Gly Gly Ser Ala Tyr Thr Cys Ala Asn Asn Ser Pro Trp Ala
50 55 60
Val Asn Asp Gln Leu Ser Tyr Gly Phe Ala Ala Thr Lys Leu Ser Gly
65 70 75 80
Gly Thr Glu Ser Ser Trp Cys Cys Ala Cys Tyr Ala Leu Thr Phe Thr
85 90 95
Ser Gly Pro Val Ala Gly Lys Thr Met Val Val Gln Ser Thr Ser Thr
100 105 110
Gly Gly Asp Leu Gly Ser Asn His Phe Asp Ile Asn Met Pro Gly Gly
115 120 125
Gly Val Gly Leu Phe Asp Gly Cys Thr Arg Gln Phe Gly Gly Leu Pro
130 135 140
Gly Ala Gln Tyr Gly Gly Ile Ser Ser Arg Ser Gln Cys Asp Ser Phe
145 150 155 160
Pro Ala Ala Leu Lys Pro Gly Cys Gln Trp Arg Phe Asp Trp Phe Gln
165 170 175
Asn Ala Asp Asn Pro Asn Phe Thr Phe Lys Gln Val Gln Cys Pro Ser
180 185 190
Glu Leu Thr Ser Arg Thr Gly Cys Lys Arg Asn Asp Asp Ser Gln Phe
195 200 205
Pro Val Phe Thr Pro Pro Ser Gly Gly Gly Ser Asn Pro Ser Thr Pro
210 215 220
Thr Thr Pro Pro Ser Ser Gly Gly Gly Ser Gly Cys Thr Ala Asp Lys
225 230 235 240
Tyr Ala Gln Cys Gly Gly Ser Gly Trp Ser Gly Cys Thr Asn Cys Pro
245 250 255
Ser Gly Ser Thr Cys Lys Thr Ile Asn Asp Tyr Tyr His Gln Cys Ala
260 265 270
<210> 2
<211> 819
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gcctcgggct cgggccagtc cacccgctac tgggactgct gcaagcccag ctgctcctgg 60
tcgggcaagg cctccgtcaa ccgccccgtc ctcgcctgcg acgccaacaa caaccccctg 120
tcggacgcca gcgtcaagtc cggctgcgac ggcggctccg cctacacctg cgccaacaac 180
tcgccctggg ccgtcaacga ccagctctcc tacggcttcg ccgccaccaa gctgtcgggc 240
ggcacggaga gctcctggtg ctgcgcctgc tacgccctca cctttacgtc cggccccgtc 300
gccggcaaga ccatggtcgt ccagagcacc tccacgggcg gcgacctggg cagcaaccac 360
ttcgacatca acatgcccgg cggcggcgtc ggcctcttcg acggctgcac gcgccagttt 420
ggcggcctgc ccggcgccca gtacggcggc atttcgagcc gcagccagtg cgactccttc 480
cccgccgccc tcaagcccgg ctgccagtgg cgcttcgact ggtttcagaa cgccgacaac 540
cccaacttca cctttaagca ggtccagtgc ccctcggagc tgaccagccg cacgggctgc 600
aagcgcaacg acgacagcca gttccccgtc tttacccccc cctccggcgg cggctcgaac 660
cccagcacgc ccaccacgcc cccctcctcg ggcggcggct ccggctgcac cgccgacaag 720
tacgcccagt gcggcggctc cggctggtcg ggctgcacga actgccccag cggctccacc 780
tgcaagacca tcaacgacta ctaccaccag tgcgcctaa 819
Claims (10)
1. A cellulase mutant, characterized in that the mutant comprises an amino acid sequence having at least 90% identity to SEQ ID No. 1 and comprises an amino acid substitution in at least one position selected from the group consisting of SEQ ID No. 1: 6,111, 120, 147, 179, 219.
2. The mutant of claim 1, wherein the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity to SEQ ID No. 1.
3. The mutant of claim 1, wherein the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity to SEQ ID No. 1.
4. The mutant according to claim 1, wherein the mutant comprises a substitution of at least one amino acid of the group consisting of: Q6T, S111N, H120Q, Q147R, D179S, S219T.
5. The mutant according to claim 4, which comprises a substitution or a combination of substitutions selected from the following substitutions and combinations of substitutions:
Q6T；
Q6T+ S111N；
Q6T+ H120Q；
Q6T+ Q147R；
Q6T+ D179S；
Q6T+ S219T；
Q6T+ S111N+ H120Q；
Q6T+ S111N+ Q147R；
Q6T+ S111N+ D179S；
Q6T+ S111N+ S219T；
Q6T+ H120Q+ Q147R；
Q6T+ H120Q+ D179S；
Q6T+ H120Q+ S219T；
Q6T+ Q147R+ D179S；
Q6T+ Q147R+ S219T；
Q6T+ D179S + S219T；
Q6T+ S111N+ H120Q+ Q147R；
Q6T+ S111N+ H120Q+ D179S；
Q6T+ S111N+ H120Q+ S219T；
Q6T+ H120Q+ Q147R+ D179S；
Q6T+ H120Q+ Q147R+ S219T；
Q6T+ Q147R+ D179S + S219T；
Q6T+ S111N+ H120Q+ Q147R+ D179S；
Q6T+ S111N+ H120Q+ Q147R+ S219T；
Q6T+ H120Q+ Q147R+ D179S+ S219T；
Q6T+ S111N + Q147R+ D179S+ S219T；
Q6T+ S111N + H120Q + D179S+ S219T；
Q6T+ S111N+ H120Q+ Q147R+ D179S+ S219T；
S111N；
S111N+H120Q；
S111N+Q147R；
S111N+ D179S；
S111N+S219T；
S111N + H120Q+ Q147R；
S111N + H120Q+ D179S；
S111N + H120Q+ S219T；
S111N + Q147R+ D179S；
S111N + Q147R+ S219T；
S111N + D179S+ S219T；
S111N + H120Q+ Q147R+ D179S；
S111N + H120Q+ Q147R+ S219T；
S111N + H120Q+ D179S + S219T；
S111N + Q147R+ D179S+ S219T；
S111N + H120Q+ Q147R+ D179S+ S219T；
H120Q；
H120Q +Q147R；
H120Q + D179S；
H120Q +S219T；
H120Q + Q147R+ D179S；
H120Q + Q147R+ S219T；
H120Q + D179S + S219T；
H120Q + Q147R+ D179S+ S219T；
Q147R；
Q147R+ D179S；
Q147R+ S219T；
Q147R+ D179S+ S219T；
D179S；
D179S+ S219T；
S219T。
6. a DNA molecule encoding the cellulase mutant of any one of claims 1-5.
7. A vector having the DNA molecule of claim 6.
8. A host cell comprising the vector of claim 7.
9. The host cell of claim 8, wherein the host cell is trichoderma reesei (trichoderma reesei) or trichoderma reesei (trichoderma reesei) or a mixture thereofTrichoderma reesei）。
10. Use of a cellulase mutant according to any one of claims 1-5 in the textile field.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310108663.4A CN116121229A (en) | 2019-11-13 | 2019-11-13 | High specific activity cellulase mutant and application thereof |
| CN201911104794.5A CN112795555B (en) | 2019-11-13 | 2019-11-13 | High specific activity cellulase mutant and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911104794.5A CN112795555B (en) | 2019-11-13 | 2019-11-13 | High specific activity cellulase mutant and application thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310108663.4A Division CN116121229A (en) | 2019-11-13 | 2019-11-13 | High specific activity cellulase mutant and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112795555A true CN112795555A (en) | 2021-05-14 |
| CN112795555B CN112795555B (en) | 2023-07-21 |
Family
ID=75803087
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310108663.4A Pending CN116121229A (en) | 2019-11-13 | 2019-11-13 | High specific activity cellulase mutant and application thereof |
| CN201911104794.5A Active CN112795555B (en) | 2019-11-13 | 2019-11-13 | High specific activity cellulase mutant and application thereof |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310108663.4A Pending CN116121229A (en) | 2019-11-13 | 2019-11-13 | High specific activity cellulase mutant and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN116121229A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116083403A (en) * | 2022-08-26 | 2023-05-09 | 青岛蔚蓝生物集团有限公司 | Cellulase mutant with improved specific activity and application thereof |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1426469A (en) * | 2000-04-24 | 2003-06-25 | 宝洁公司 | Enzyme variants having one or more D-amino acid substitutions |
| US20130337542A1 (en) * | 2011-02-09 | 2013-12-19 | Novozymes A/S | Cellulase Enzyme Mixtures For Depilling and Uses Thereof |
| CN104450653A (en) * | 2014-12-16 | 2015-03-25 | 青岛蔚蓝生物集团有限公司 | Cellulase mutant and application thereof |
| WO2017084560A1 (en) * | 2015-11-16 | 2017-05-26 | Novozymes A/S | Cellulase variants and polynucleotides encoding same |
| CN110093332A (en) * | 2018-01-30 | 2019-08-06 | 青岛蔚蓝生物集团有限公司 | A kind of cellulase variants and its superior strain |
-
2019
- 2019-11-13 CN CN202310108663.4A patent/CN116121229A/en active Pending
- 2019-11-13 CN CN201911104794.5A patent/CN112795555B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1426469A (en) * | 2000-04-24 | 2003-06-25 | 宝洁公司 | Enzyme variants having one or more D-amino acid substitutions |
| US20130337542A1 (en) * | 2011-02-09 | 2013-12-19 | Novozymes A/S | Cellulase Enzyme Mixtures For Depilling and Uses Thereof |
| CN104450653A (en) * | 2014-12-16 | 2015-03-25 | 青岛蔚蓝生物集团有限公司 | Cellulase mutant and application thereof |
| WO2017084560A1 (en) * | 2015-11-16 | 2017-05-26 | Novozymes A/S | Cellulase variants and polynucleotides encoding same |
| CN108463552A (en) * | 2015-11-16 | 2018-08-28 | 诺维信公司 | Cellulase variants and the polynucleotides that it is encoded |
| CN110093332A (en) * | 2018-01-30 | 2019-08-06 | 青岛蔚蓝生物集团有限公司 | A kind of cellulase variants and its superior strain |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
| CN116083403A (en) * | 2022-08-26 | 2023-05-09 | 青岛蔚蓝生物集团有限公司 | Cellulase mutant with improved specific activity and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN116121229A (en) | 2023-05-16 |
| CN112795555B (en) | 2023-07-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112795554B (en) | Low temperature resistant cellulase mutants | |
| US20150132820A1 (en) | Thermostable catalase | |
| CN103589701B (en) | Low-temperature cellulase and application thereof | |
| CN107109385A (en) | Fungal endoglucanase variant, their production and purposes | |
| CN112795555B (en) | High specific activity cellulase mutant and application thereof | |
| CN112501149B (en) | Alkaline protease mutant and gene, engineering bacterium, preparation method and application thereof | |
| CN107513527B (en) | Cellulase mutant and application thereof | |
| CN111793613B (en) | Low-temperature cellulase mutant and application thereof | |
| EP4155396A1 (en) | Phytase mutant | |
| CN104450651A (en) | Beta-glucosidase mutant and application thereof | |
| Yasir et al. | Cloning and functional characterization of endo-β-1, 4-glucanase gene from metagenomic library of vermicompost | |
| CN113717864B (en) | Cellulase high-yield strain and application thereof | |
| CN112877311B (en) | Heat-resistant beta-mannase mutant ManAK-2 and coding gene and application thereof | |
| CN116218820A (en) | Xylanase mutant and application thereof | |
| EP4029936A2 (en) | Additional endoglucanase variants and methods | |
| CN115247165A (en) | Cellulase mutant with improved specific activity and thermal stability | |
| CN114369588B (en) | Neutral cellulase mutant and application thereof | |
| CN116083403A (en) | Cellulase mutant with improved specific activity and application thereof | |
| CN104450653B (en) | Cellulase mutant and application thereof | |
| CN115478061A (en) | Cellulase mutants and compositions thereof | |
| CN116590258A (en) | High specific activity cellulase mutant and application thereof | |
| WO2020063267A1 (en) | Phytase mutant | |
| CN103725660B (en) | A kind of endoglucanase and application thereof | |
| KR102530487B1 (en) | Novel Pseudoalteromonas sp. ArcC09 strain with high cellulolytic ability, the strain-derived cellulase, and its production method | |
| CN117050977A (en) | High activity cellulase mutant and composition thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |