CN115704017A

CN115704017A - Alkaline xylanase mutant

Info

Publication number: CN115704017A
Application number: CN202110901863.6A
Authority: CN
Inventors: 吴秀秀; 李馨培
Original assignee: Qingdao Vland Biotech Group Co Ltd
Current assignee: Qingdao Vland Biotech Group Co Ltd
Priority date: 2021-08-06
Filing date: 2021-08-06
Publication date: 2023-02-17

Abstract

The invention relates to the technical field of genetic engineering and protein modification, in particular to a novel alkaline xylanase mutant. The invention provides a mutant containing at least one mutation site in Q24P, S38V/K/W/H/T/I, G40M/R/K/F/H, D41P, N56L/I/P/K, A57E/D/Y, A59K/R/I/M/H, H61F/Y, A75S, T80M, T103I, T107E, T114Y, D129L, Q132R/M, D135M, N143D, K144R, T149L, Q151N/Y, C154N, D157E, A160E, N165D, V166I, N167S/W, T177V and D192E based on wild-type xylanase H1. The mutant has obviously improved tolerance to high temperature and alkaline environment, and is beneficial to wide application in the field of papermaking.

Description

Alkaline xylanase mutant

Technical Field

The invention relates to the technical field of genetic engineering and protein engineering, in particular to an alkaline xylanase mutant.

Background

The papermaking industry is always a serious pollution industry, and along with the increasing attention of China on environmental protection and the enhancement of pollution treatment strength in recent years, the requirements on the pulping and papermaking process are higher and higher, and the development is towards the green environmental protection direction in the aspects of improvement of the production process and addition of the papermaking auxiliary agent. The application of biological enzyme in pulping and papermaking industry is more and more extensive, and the biological enzyme has application in various stages of process flow, such as cooking, bleaching, pulping, waste paper deinking, stickies control and the like. The research on the application of the biological enzyme in pulp bleaching is a hotspot of the application of the biological enzyme in papermaking in recent years, and the biological enzyme is added in the bleaching process, so that the dosage of a chemical bleaching agent can be reduced, the whiteness of the bleached pulp is improved, the content of ionic garbage in the bleaching waste liquid is reduced, and the recycling rate of white water is improved. Commonly used enzyme preparations in pulp bleaching are xylanases and laccases.

Xylanase in the broad sense refers to a complex enzyme system capable of degrading hemicellulose xylan which is abundantly present in the nature, especially in plant fibers, and includes beta-1, 4-endoxylanase, beta-xylosidase, alpha-L-arabinosidase and the like. The xylanase in the narrow sense mainly refers to beta-1,4-endo-xylanase. The beta-1,4-endo-xylanase mainly acts on beta-1,4-glycosidic bonds in xylan molecules, and degrades xylan into micromolecular xylooligosaccharide, xylobiose and the like by cutting off the beta-1,4-glycosidic bonds, and a few amounts of xylose and arabinose. Beta-xylosidase, alpha-L-arabinosidase and the like mainly degrade xylo-oligosaccharide into monosaccharide further, so that xylan is completely degraded into monosaccharide.

The xylanase has wide sources, and animals, plants and microorganisms in nature can produce the xylanase. The microorganisms are the most extensive sources of xylanase, and most of the screening research on xylanase at present starts from microorganisms, mainly from some bacteria and fungi. The research shows that: bacterial secreted xylanases are both acidic and alkaline, whereas fungal secreted xylanases are only alkaline xylanases. Therefore, the strains can be screened according to the actual application requirements of the xylanase. At present, xylanase is produced mainly by fermenting bacteria, fungi and the like.

At present, xylanase is widely applied to the pulping and papermaking industry, and the xylanase is mostly applied to a bleaching section of a pulping and papermaking process as a bleaching auxiliary. Many studies have found that xylanase pretreatment can improve the bleaching performance of paper pulp and improve the paper whiteness of the bleached paper pulp. Garg et al, using xylanase from Bacillus stearothermophilus SDX at 60 ℃ for 120 min, found a 4.75% improvement in pulp brightness after enzyme treatment. In addition, after application in many pulp mills at home and abroad, xylanase is added before a bleaching working section, the bleaching cost of chemical pulp can be reduced under the condition of reaching the required whiteness, and the bleaching load can be reduced by about 5-20%.

However, in the actual production process, the pulp bleaching environment is mostly high-temperature alkaline environment, and general xylanase is difficult to survive in the environment and hardly plays a role, so that the development of xylanase with temperature resistance and alkali resistance is needed. The xylanase with temperature resistance and alkali resistance is prepared by means of protein engineering, and can be widely applied to the papermaking industry.

Disclosure of Invention

The invention aims to provide a novel alkaline xylanase mutant. The heat resistance of the mutant is obviously improved, and the wide application of the mutant in the field of papermaking is facilitated.

In order to achieve the above object, the present invention provides the following technical solutions:

the present invention relates to a xylanase mutant comprising an amino acid sequence having at least 90% identity to SEQ ID No. 1 and comprising a substitution of an amino acid in at least one position selected from the group consisting of SEQ ID No. 1: 24, 38, 40, 41, 56, 57, 59, 61, 75, 80, 103, 107, 114, 129, 132, 135, 143, 144, 149, 151, 154, 157, 160, 165, 166, 167, 177, 192.

In some embodiments of the invention, the amino acid sequence of the mutant has at least 91%,92%,93%,94%,95%,96%,97%,98%, or at least 99% identity to SEQ ID No. 1.

In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%,99.2%,99.3%,99.4%,99.5%,99.6%,99.7%,99.8%, or at least 99.9% identity to SEQ ID No. 1.

In some embodiments of the invention, the mutant comprises a substitution of at least one amino acid of the group: Q24P, S38V/K/W/H/T/I, G40M/R/K/F/H, D41P, N56L/I/P/K, A57E/D/Y, A59K/R/I/M/H, H61F/Y, A75S, T80M, T103I, T107E, T114Y, D129L, Q132R/M, D135M, N143D, K144R, T149L, Q151N/Y, C154N, D157E, A160E, N165D, V166I, N167S/W, T177V, D192E.

The invention also relates to DNA molecules encoding the xylanase mutants.

The invention also relates to a recombinant expression vector containing the DNA molecule.

The invention also relates to a host cell comprising the recombinant expression vector.

The plasmid is transferred into a host cell, and the heat resistance and alkali resistance of the xylanase mutant subjected to recombinant expression are remarkably improved.

In some embodiments of the invention, the host cell is pichia pastoris (a: (b))Pichia pastoris）。

In some embodiments of the invention, the host cell is trichoderma reesei (trichoderma reesei) (ii)Trichoderma reesei）。

The invention also provides application of the xylanase mutant in the field of papermaking.

The invention provides a mutant containing at least one mutation site in Q24P, S38V/K/W/H/T/I, G40M/R/K/F/H, D41P, N56L/I/P/K, A57E/D/Y, A59K/R/I/M/H, H61F/Y, A75S, T80M, T103I, T107E, T114Y, D129L, Q132R/M, D135M, N143D, K144R, T149L, Q151N/Y, C154N, D157E, A160E, N165D, V166I, N167S/W, T177V, D192E based on wild-type xylanase H1. Compared with wild xylanase H1, the single-point mutant provided by the invention has the advantage that the relative enzyme activity under the condition of 75 ℃ is generally improved by 12.2-71.4%. Wherein, the relative enzyme activity of the mutant containing S38T, S3238 zxft 3242P, T V single points is over 80 percent at 75 ℃, which is much higher than that of the wild-type xylanase H1, and unexpected technical effects are obtained.

After 2 hours of treatment under the condition of pH9.0-11.0, the enzyme activity residual rate of the wild xylanase H1 and the single-point mutant thereof is generally higher than 91 percent, and almost no enzyme activity loss exists;

after 2 hours of treatment under the condition of pH12.0, the enzyme activity residual rate of the wild type xylanase H1 is only 45.06%, while the enzyme activity residual rate of the xylanase single-point mutant is as high as 61.51-93.29%, especially the enzyme activity residual rates of mutants containing S38T, S W, D P, T V single-point are respectively as high as 90.6%, 92.33%, 93.11% and 93.29%. Therefore, the single-point mutant provided by the invention has obviously improved tolerance to alkaline environment and unexpected technical effect.

In conclusion, the xylanase mutant provided by the invention has obviously improved tolerance to high temperature and alkaline environment, thereby being beneficial to the wide application of xylanase in the field of papermaking.

Detailed Description

The invention discloses a xylanase mutant, a preparation method and application thereof, and a DNA molecule, a vector and a host cell for coding the xylanase mutant. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

The present invention applies to conventional techniques and methods used in the fields of genetic engineering and MOLECULAR biology, such as MOLECULAR CLONING: a Laboratory Manual,3nd Ed. (Sambrook, 2001) and Current Protocols IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can adopt other conventional methods, experimental schemes and reagents in the field on the basis of the technical scheme described in the invention, and the invention is not limited to the specific embodiment of the invention. For example, the following experimental materials and reagents may be selected for use in the present invention:

bacterial strain and carrier: coli DH 5. Alpha. And Pichia pastoris GS115, vectors pPIC9k, amp, G418 were all purchased from Invitrogen.

Enzyme and kit: PCR enzyme and ligase were purchased from Takara, restriction enzyme was purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomais Biotech.

The formula of the culture medium is as follows:

coli medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH7.0;

yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;

yeast screening medium (MD medium): 2% peptone, 2% agarose;

BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH6.0), 1.34% YNB, 4X 10 ^-5 % biotin, 1% glycerol;

BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH6.0), 1.34% YNB, 4X 10 ^-5 % biotin, 0.5% methanol;

LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100. Mu.g/mL ampicillin, pH7.0;

LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl,1.5% agar, 100. Mu.g/mL ampicillin, pH7.0;

upper medium: 0.1% of MgSO ₄ ，1%KH ₂ PO ₄ ，0.6%(NH ₄ ) ₂ SO ₄ 1% glucose, 18.3% sorbitol, 0.35% agarose;

lower medium plate: 2% glucose, 0.5% (NH) ₄ ) ₂ SO ₄ ，1.5%KH ₂ PO ₄ ，0.06%MgSO ₄ ，0.06%CaCl ₂ 1.5% agar.

The invention is further illustrated by the following examples:

EXAMPLE 1 construction of recombinant plasmid

Will originate from paecilomyces (A. Variegatus) ((B))Paecilomyces. sp) The xylanase gene (GeneBank ACS 26244.1) according to Pichia codon preferenceOptimization was performed and 6 bases GAATTC (EcoR I cleavage site) were added before the start codon ATG and GCGGCCGC (Not I cleavage site) after the stop codon TAA. The optimized nucleotide sequence was synthesized by the Shanghai Czeri bioengineering company Limited. The xylanase is named as H1, and the amino acid sequence of the xylanase is SEQ ID NO:1, and the coding nucleotide sequence is SEQ ID NO:2.

digesting the xylanase gene by using restriction enzymes EcoR I and Not I (Fermentas); at the same time, plasmid pPIC9K was digested with the restriction enzymes EcoR I and Not I. The cleavage products were purified using a gel purification kit and ligated with T4 DNA ligase (Fermentas). The ligation product was transformed into DH 5. Alpha. E.coli (Invitrogen) and selected with ampicillin. To ensure accuracy, several clones were sequenced.

Plasmids were purified from E.coli clones with correct sequencing using a plasmid miniprep kit (Omega) to obtain 1 recombinant plasmid, which was designated pPIC9K-H1.

EXAMPLE 2 screening of high temperature and alkali resistant mutants

In order to further improve the resistance of xylanase H1 to high temperature and alkaline conditions, it was subjected to protein structure analysis by the Applicant. The protein is GH11 family xylanase, the structure of the xylanase is a beta-jelly roll structure, and the surface of the protein and the active center of the protein are exposed in the external environment, so that the stability of the surface structure of the enzyme and the stability of the active center of the enzyme can be directly influenced by the change of the external environment, particularly high-temperature or strong acid-base environment, and the integral rigidity of the protein and the integral structure of the enzyme are improved and stabilized to improve the tolerance of the enzyme in the environment. The gene is further mutated under the premise of not destroying the secondary structure and the active center of the protein.

1.1 design of PCR primers H1-F1, H1-R1:

H1-F1：GGCGAATTCATGATGATTGGTATCACTTCTTTTGC (restriction enzyme EcoRI recognition site underlined);

H1-R1：ATAGCGGCCGC TTAACCGACGTCTGCAACGGTAATTC（restriction enzyme NotI recognition site underlined).

H1 gene (SEQ ID NO: 1) is used as a template, the primers are used for carrying out PCR amplification by using a GeneMorph II random mutation PCR kit (Bomeis), PCR products are recovered through gel, ecoRI and NotI are subjected to enzyme digestion treatment and then are connected with pET21a vectors subjected to the same enzyme digestion, the products are transformed into escherichia coli BL21 (DE 3), the escherichia coli BL21 (DE 3) are coated on an LB + Amp flat plate and are inversely cultured at 37 ℃, after transformants appear, toothpicks are used for selecting the transformants to a 96 pore plate one by one, 150ul LB + Amp culture medium containing 0.1mM IPTG is added into each pore, the escherichia coli is cultured at 37 ℃ and 220rpm for about 6H, supernatant is centrifuged, thalli are resuspended by using buffer solution, and freeze thawing and wall breaking are repeated, so that escherichia coli cell lysate containing xylanase is obtained.

Three lysates were taken out separately for the following treatments: diluting the first and second lysates with buffer solution of pH8.0, treating the third lysate with preheated buffer solution of 0.05M borax-0.2M sodium hydroxide of pH10.0 at 37 deg.C for 2 hr, and diluting with buffer solution; taking each 30 ul of the treated lysate, respectively placing the lysate in three new 96-well plates, and adding substrates prepared by 30 ul and corresponding buffer solutions into the three 96-well plates; and (3) reacting the first part of the treated lysate with the third part of the treated lysate at 50 ℃ for 30 min, and reacting the second part of the treated lysate at 75 ℃ for 30 min, and then determining the generated reducing sugar by using a DNS method. And respectively calculating the enzyme activity levels of different mutants.

The experimental results show that different mutants retain different activities. Some mutations also have higher enzyme activity under high-temperature reaction conditions and strong alkali treatment conditions, and some mutations even make the tolerance of the mutations worse; in addition, some mutations can improve the tolerance of xylanase, but the enzymological properties of the mutant are obviously changed, and the mutations do not meet the requirements. Finally, the applicant screens and obtains mutation sites which can obviously improve the tolerance of the xylanase and can not obviously influence the enzyme activity and the original enzymology property: Q24P, S38V, S38K, S38W, S38H, S38T, S38I, G40M, G40R, G40K, G40F, G40H, D41P, N56L, N56I, N56P, N56K, a57E, a57D, a57Y, a59K, a59R, a59I, a59M, a59H, H61F, H61Y, a75S, T80M, T103I, T107E, T114Y, D129L, Q132R, Q132M, D135M, N143D, K144R, T149L, Q151N, Q151Y, C154N, D157E, a160E, N165D, V166I, N167S, N177W, T177V, D192E.

On the basis of wild type xylanase H1, the invention provides mutants respectively containing the single mutation sites.

And respectively obtaining the coding nucleotide sequences of the xylanase mutants by referring to the amino acid sequences of the mutants.

Example 3 expression of xylanase in Pichia pastoris

3.1 construction of expression vectors

The gene sequences of xylanase H1 and a mutant thereof are respectively optimized according to the codon preference of pichia pastoris, the xylanase H1 and the mutant thereof are synthesized by Shanghai Czeri bioengineering GmbH, and EcoRI and NotI two enzyme cutting sites are respectively added at the two ends of the 5 'and 3' of the synthetic sequence.

The synthetic xylanase H1 and its mutant gene sequences were separately digested with EcoRI and NotI, ligated with the same digested pPIC-9K vector overnight at 16 ℃ and transformed into E.coli DH5a, spread on LB + Amp plates, inverted cultured at 37 ℃ and, after the transformants appeared, colony PCR (reaction System: single clone picked from template, rTaqDNA polymerase 0.5ul,10 xBuffer 2.0. Mu.L, dNTPs (2.5 mM) 2.0. Mu.L, 5'AOX primer (10 mM): 0.5. Mu.L, 3' AOX primer: 0.5. Mu.L, ddH ₂ O14.5 μ L, reaction procedure: pre-denaturation at 95 ℃ for 5min,30 cycles: 30sec at 94 ℃, 30sec at 55 ℃, 2min at 72 ℃ and 10min at 72 ℃). And (5) verifying positive clones, and obtaining correct recombinant expression plasmids after sequencing verification.

3.2 construction of Pichia engineering Strain

3.2.1 Yeast competent preparation

YPD plate activation is carried out on a Pichia pastoris GS115 strain, 48 h is cultured at 30 ℃, then the activated GS115 is inoculated to be monoclonal in 6 mL of YPD liquid culture medium, the culture is carried out at 30 ℃ and 220rpm for about 12 h, then the inoculated bacteria liquid is transferred to a triangular flask filled with 30mL of YPD liquid culture medium, the culture is carried out at 30 ℃ and 220rpm for about 5 hours, the density of the bacteria is detected by an ultraviolet spectrophotometer, after the OD600 value is in the range of 1.1-1.3, 4mL of bacteria are respectively collected into a sterilized EP tube by centrifugation at 4 ℃ and 9000rpm for 2min, the supernatant is gently discarded, the residual supernatant is sucked by sterilized filter paper, then precooled 1mL is used for re-suspending the bacteria by sterilized water, the bacteria are centrifuged at 4 ℃ and 9000rpm for 2min, the supernatant is gently discarded, 1mL of sterilized water is reused, and washing is carried out again, the supernatant is centrifuged at 4 ℃ and 9000rpm for 2min, and the precooled 1mL of sorbitol (1 mol/L) is re-suspended; centrifugation was carried out at 9000rpm for 2min at 4 ℃ and the supernatant was discarded, and the cells were gently resuspended in 100-150. Mu.l of sorbitol (1 mol/L) which had been precooled.

3.2.2 transformation and selection

The recombinant expression plasmids obtained by 3.1 construction are linearized by Sac I, the linearized fragments are purified and recovered, and then are transformed into pichia pastoris GS115 by an electroporation method, pichia pastoris recombinant strains are obtained by screening on MD plates, and then multi-copy transformants are screened on YPD plates (0.5 mg/mL-8 mg/mL) containing different concentrations of geneticin.

The obtained transformants were transferred to BMGY medium, respectively, and shake-cultured at 30 ℃ and 250rpm for 1 day; then transferring the culture medium into a BMMY culture medium, and performing shaking culture at 30 ℃ and 250 rpm; adding 0.5% methanol every day to induce expression of 4 d; centrifuging at 9000rpm for 10min to remove thallus, and obtaining fermentation supernatant respectively containing xylanase H1 and xylanase mutant.

(1) Definition of xylanase Activity units

The amount of enzyme required for the release of 1. Mu. Mol of reducing sugars by degradation per minute from a xylan solution having a concentration of 5mg/ml at a temperature of 50 ℃ and a pH of 8.0 is one unit of enzyme activity, expressed in U.

(2) Xylanase enzyme activity determination method

10.0 ml xylan solution was aspirated and equilibrated at 50 ℃ for 20 min.

10.0 ml was pipetted into the diluted enzyme solution and equilibrated at 50 ℃ for 5 min.

Blank sample determination: 2.00 ml was pipetted with the appropriate diluted enzyme solution (equilibrated at 50 ℃) and added to a graduated tube, followed by addition of 5ml DNS reagent and electromagnetic shaking of 3 s. Then adding 2.0 ml xylan solution, equilibrating at 50 deg.C for 30 min, and heating in boiling water bath for 5 min. Cooling to room temperature with tap water, adding water to a constant volume of 25 ml, electromagnetically oscillating 3 s E-And 5s. The absorbance A was measured at 540 nm using the standard blank as a blank _B 。

And (3) sample determination: sucking 2.00 ml diluted enzyme solution (balanced at 50 ℃), adding into a graduated test tube, adding 2.0 ml xylan solution (balanced at 50 ℃), electromagnetically vibrating for 3 s, and accurately keeping the temperature at 50 ℃ for 30 min. 5.0 ml DNS reagent was added and the reaction was stopped by electromagnetic shaking 3 s. Heating in boiling water bath for 5min, cooling to room temperature with tap water, adding water to constant volume of 25 ml, and electromagnetically vibrating for 3 s. The absorbance A was measured at 540 nm using the standard blank as a blank _E 。

X _D =

。

In the formula:

X _D -xylanase activity in sample dilution, U/ml;

A _E -absorbance of the enzyme reaction solution;

A _B -absorbance of the enzyme blank;

k-the slope of the standard curve;

C _O -the intercept of the standard curve;

m — molar mass of xylose M (C5 XYN110O 5) = 150.2 g/mol;

t-enzymolysis reaction time, min;

1000-conversion factor, 1 mmol = 1000 μmol;

X _D the value should be between 0.04 and 0.10U/ml. If not, the dilution of the enzyme solution should be reselected and the assay performed.

X = X _D ·D _f （2）

X-xylanase Activity in the sample, U/ml;

df is the dilution of the sample.

(3) Measurement results

Enzyme activity detection is carried out according to the method, and the result shows that: the enzyme activity of the fermentation supernatant of the recombinant Pichia pastoris strain for recombinant expression of xylanase H1 and the mutant thereof obtained by the construction is 310-550U/mL.

Example 4 expression of xylanase in Trichoderma reesei

Firstly, according to the codon preference of trichoderma, the gene sequences of xylanase H1 and mutants thereof are respectively optimized. The optimized gene sequence is synthesized by Shanghai Czeri bioengineering GmbH, and two enzyme cutting sites KpnI and MluI are respectively added at the two ends of the 5 'and 3' of the synthetic sequence.

4.1 construction of expression vectors

The synthesized xylanase gene fragment and the pSC1G vector were digested with restriction enzymes KpnI and MluI (Fermentas), respectively, the digested products were purified using a gel purification kit, and the xylanase gene and the digested products of the pSC1G vector were ligated with T4 DNA ligase (Fermentas), respectively, and transformed E.coli Trans 5. Alpha. (Transgen), selected with ampicillin, and the clone was verified by sequencing (Invitrogen). And (4) obtaining the recombinant plasmid containing the xylanase gene after the sequencing is correct.

4.2 Construction of recombinant Trichoderma reesei strains

(1) Protoplast preparation

Taking a host bacterium (Trichoderma reesei) (III)Trichoderma reesei) Inoculating the UE spore suspension on a PDA flat plate, and culturing for 6 days at 30 ℃; after the spore production is rich, cutting a colony of about 1cm multiplied by 1cm into a liquid culture medium containing 120 mL YEG + U (0.5% yeast powder, 1% glucose and 0.1% uridine), and carrying out shake culture at 30 ℃ and 220rpm for 14 to 16 hours;

filtering with sterile gauze to collect mycelium, and washing with sterile water; placing the mycelium in a triangular flask containing 20 mL of 10mg/mL lyase solution (Sigma L1412), and reacting at 30 ℃ and 90 rpm for 1-2 h; observing and detecting the transformation progress of the protoplast by using a microscope;

pre-cooled 20 mL of 1.2M sorbitol (1.2M sorbitol, 50 mM Tris-Cl,50 mM CaCl ₂ ) Adding into the triangular flask, shaking gently, filtering with sterile Miracloth, collecting filtrate, centrifuging at 3000 rpm and 4 deg.C for 10 min; discarding the supernatant, adding pre-cooled 5mL of 1.2M sorbitol solution to suspend the thalli, centrifuging at 3000 rpm and 4 ℃ for 10 min; discarding the supernatant, and addingA pre-cooled amount of 1.2M sorbitol was suspended and dispensed (200. Mu.L/tube, protoplast concentration 10) ⁸ one/mL).

(2) Expression vector transformation

The following procedures were performed on ice, and 10. Mu.g of the recombinant plasmid constructed above was added to a7 mL sterile centrifuge tube containing 200. Mu.L of protoplast solution, followed by 50. Mu.L of 25% PEG (25% PEG,50 mM Tris-Cl,50 mM CaCl) ₂ ) Mixing the tube bottom, and standing on ice for 20 min; adding 2 mL of 25% PEG, uniformly mixing, and standing at room temperature for 5 min; adding 4mL of 1.2M sorbitol, gently mixing, pouring into a melted upper layer culture medium, and keeping the temperature at 55 ℃; and (3) after gently mixing, paving the mixture on a prepared lower layer culture medium plate, culturing at 30 ℃ for 5-7 days until transformants grow out, and selecting the grown transformants to the lower layer culture medium plate for re-screening, wherein the strains with smooth colony edge morphology are positive transformants.

According to the method, the applicant respectively constructs the Trichoderma reesei engineering strain for recombinant expression of xylanase H1 and the mutant thereof.

(3) Fermentation validation and enzyme activity determination

Respectively inoculating the Trichoderma reesei engineering strains obtained by the construction to a PDA solid flat plate, inversely culturing for 6-7 days in a constant-temperature incubator at 30 ℃, and respectively inoculating two hypha blocks with the diameter of 1cm to a fermentation medium (containing 50mL of 1.5% of glucose, 1.7% of lactose, 2.5% of corn steep liquor and 0.44% (NH) ₄ ) ₂ SO ₄ ，0.09%MgSO ₄ ，2%KH ₂ PO ₄ ，0.04%CaCl ₂ 0.018% tween-80,0.018% trace elements) was cultured at 30 ℃ for 48 hours and then at 25 ℃ for 48 hours in a 250mL Erlenmeyer flask. And (4) centrifuging the fermentation liquor to obtain fermentation supernatants respectively containing the xylanase H1 and the mutant thereof.

Enzyme activity detection is carried out according to the method, and the result shows that: the enzyme activity of the trichoderma reesei recombinant strain fermentation supernatant of the recombinant expression xylanase H1 and the mutant thereof obtained by the construction is 300-500U/mL.

Example 5 thermotolerance analysis of xylanase mutants

Diluting the fermentation supernatant of the recombinant strain by 10 times with 0.1M disodium hydrogen phosphate-0.05M citric acid buffer solution, and measuring the enzyme activity of the diluted xylanase under the conditions of 50 ℃ and 75 ℃ respectively. The relative enzyme activity at 75 ℃ is calculated according to 100 percent of the enzyme activity of the fermentation supernatant at 50 ℃. Specific results are shown in table 1.

Relative enzyme activity (%) = sample enzyme activity at 75 ℃ or sample enzyme activity at 50 ℃ is multiplied by 100%.

TABLE 1 xylanase H1 and its mutants relative enzyme activity levels at 75 deg.C

Xylanase and single-point mutant thereof	Relative enzyme activity (%)/75 deg.C/50 deg.C
		Wild type H1	49%
Q24P	56%
		S38T	84%
N56I	68%
		G40M	56%
G40R	58%
		G40K	55%
G40F	59%
		G40H	60%
S38V	69%
		S38K	68%
S38W	82%
		S38H	68%
S38T	62%
		S38I	69%
D41P	84%
		N56L	59%
N56I	68%
		N56P	59%
N56K	60%
		A57E	61%
A57D	59%
		A57Y	68%
A59K	64%
		A59R	62%
A59I	72%
		A59M	71%
A59H	59%
		H61F	56%
H61Y	67%
		A75S	67%
T80M	65%
		T103I	57%
T107E	67%
		T114Y	58%
Q132M	59%
		Q132R	55%
D135M	72%
		N143D	64%
K144R	60%
		T149L	55%
Q151N	62%
		Q151Y	69%
C154N	56%
		D157E	56%
A160E	68%
		N165D	64%
N167S	58%
		N167W	58%
T177V	81%

As can be seen from the data in Table 1, compared with the wild type xylanase H1, the relative enzyme activity of the single-point mutant provided by the invention at 75 ℃ is generally improved by 12.2-71.4%. Wherein, the relative enzyme activity of the mutants containing S38T, S38W, D P, T V single points at 75 ℃ is over 80 percent, which is far higher than that of the wild-type xylanase H1. Therefore, the single-point mutant provided by the invention has remarkably improved heat resistance and obtains unexpected technical effects.

Example 6 analysis of xylanase mutants for tolerance to alkaline Environment

Diluting the fermentation supernatant of the recombinant strain to 50U/ml by using deionized water; adding 1ml of supernatant into preheated 10min 9ml of buffer solution with corresponding pH (pH 9.0, 10.0, 11.0, 12.0), and treating at 37 deg.C for 2 hr; after the reaction, 5ml of supplementary solution is quickly added and shaken up; then, the enzyme activity was measured by diluting with a buffer solution. And calculating the enzyme activity residual rate by taking the enzyme activity of the untreated fermentation supernatant as 100 percent.

Enzyme activity residual rate (%) = enzyme activity of treated sample/enzyme activity of untreated sample × 100%.

The results show that: after 2 hours of treatment under the condition of pH9.0-11.0, the enzyme activity residual rate of the wild xylanase H1 and the single-point mutant thereof is generally higher than 91 percent, and almost no enzyme activity loss exists;

after 2 hours of treatment under the condition of pH12.0, the enzyme activity residual rate of the wild type xylanase H1 is only 45.06%, while the enzyme activity residual rate of the xylanase single-point mutant is as high as 61.51-93.29%, especially the enzyme activity residual rates of mutants containing S38T, S W, D P, T V single-point are respectively as high as 90.6%, 92.33%, 93.11% and 93.29%. Therefore, the single-point mutant provided by the invention has obviously improved tolerance to alkaline environment and unexpected technical effects.

In conclusion, the mutant sites Q24P, S38V, S38K, S38W, S38H, S38T, S38I, G40M, G40R, G40K, G40F, G40H, D41P, N56L, N56I, N56P, N56K, a57E, a57D, a57Y, a59K, a59R, a59I, a59M, a59H, H61F, H61Y, a75S, T80M, T103I, T107E, T114Y, D129L, Q132R, Q132M, D135M, N143D, K144R, T149L, Q151N, Q151Y, C154N, D157E, a160E, N165D, V166I, N167S, N167W, T177V, D192E all obtained by screening according to the present invention can significantly improve the high-temperature and alkaline tolerance of xylanase in the papermaking industry, thereby facilitating the wide-range application of the xylanase in the papermaking industry.

Sequence listing

<110> Islands blue biological group Co Ltd

<120> an alkaline xylanase mutant

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 194

<212> PRT

<213> Paecilomyces (Paecilomyces. Sp)

<400> 1

Gln Thr Thr Pro Asn Ser Glu Gly Trp His Asp Gly Tyr Tyr Tyr Ser

1 5 10 15

Trp Trp Ser Asp Gly Gly Ala Gln Ala Thr Tyr Thr Asn Leu Glu Gly

20 25 30

Gly Thr Tyr Glu Ile Ser Trp Gly Asp Gly Gly Asn Leu Val Gly Gly

35 40 45

Lys Gly Trp Asn Pro Gly Leu Asn Ala Arg Ala Ile His Phe Asp Gly

50 55 60

Val Tyr Gln Pro Asn Gly Asn Ser Tyr Leu Ala Val Tyr Gly Trp Thr

65 70 75 80

Arg Asn Pro Leu Val Glu Tyr Tyr Ile Val Glu Asn Phe Gly Thr Tyr

85 90 95

Asp Pro Ser Ser Asp Ala Thr Asp Leu Gly Thr Val Glu Cys Asp Gly

100 105 110

Ser Thr Tyr Arg Leu Gly Lys Ser Thr Arg Tyr Asn Ala Pro Ser Ile

115 120 125

Asp Gly Ile Gln Thr Phe Asp Gln Tyr Trp Ser Val Arg Gln Asn Lys

130 135 140

Arg Ser Ser Gly Thr Val Gln Thr Gly Cys His Phe Asp Ala Trp Ala

145 150 155 160

Arg Ala Gly Leu Asn Val Asn Gly Asp His Tyr Tyr Gln Ile Val Ala

165 170 175

Thr Glu Gly Tyr Phe Ser Ser Gly Tyr Ala Arg Ile Thr Val Ala Asp

180 185 190

Val Gly

<210> 2

<211> 585

<212> DNA

<213> Paecilomyces (Paecilomyces. Sp)

<400> 2

caaaccactc caaactctga aggttggcat gacggttatt actactcttg gtggtctgac 60

ggtggagccc aggctacata caccaatttg gagggtggaa catacgaaat ctcttggggt 120

gacggaggaa acttggtcgg tggtaaggga tggaacccag gattgaatgc aagagccatt 180

cactttgatg gtgtctatca accaaacgga aactcttact tggcagttta cggttggaca 240

agaaacccat tggtcgagta ttacatcgtc gagaattttg gtacttatga cccttcttct 300

gatgctacag acttgggtac agtcgagtgc gatggatcta catatagatt gggaaagtct 360

accagataca acgcaccttc tatcgacgga atccaaacat tcgatcagta ttggtctgtt 420

agacaaaata agagatcctc tggaaccgtt caaacaggat gccacttcga cgcttgggcc 480

agagctggat tgaacgtcaa cggtgaccac tattatcaaa ttgttgccac tgagggttat 540

ttctcttctg gttatgccag aattaccgtt gcagacgtcg gttaa 585

Claims

1. A xylanase mutant, characterized in that the mutant comprises an amino acid sequence having at least 90% identity to SEQ ID No. 1 and comprises a substitution of an amino acid in at least one position selected from the group consisting of: 24, 38, 40, 41, 56, 57, 59, 61, 75, 80, 103, 107, 114, 129, 132, 135, 143, 144, 149, 151, 154, 157, 160, 165, 166, 167, 177, 192.

2. The mutant of claim 1, wherein the amino acid sequence of the mutant has at least 91%,92%,93%,94%,95%,96%,97%,98%, or at least 99% identity to SEQ ID No. 1.

3. The mutant of claim 1, wherein the amino acid sequence of the mutant has at least 99.1%,99.2%,99.3%,99.4%,99.5%,99.6%,99.7%,99.8%, or at least 99.9% identity to SEQ ID No. 1.

4. The mutant according to any one of claims 1 to 3, which comprises a substitution of at least one amino acid of the group: Q24P, S38V/K/W/H/T/I, G40M/R/K/F/H, D41P, N56L/I/P/K, A57E/D/Y, A59K/R/I/M/H, H61F/Y, A75S, T80M, T103I, T107E, T114Y, D129L, Q132R/M, D135M, N143D, K144R, T149L, Q151N/Y, C154N, D157E, A160E, N165D, V166I, N167S/W, T177V, D192E.

5. A DNA molecule encoding a xylanase mutant according to any one of claims 1-4.

6. A recombinant expression plasmid comprising the DNA molecule of claim 5.

7. A host cell comprising the recombinant expression plasmid of claim 6.

8. The host cell of claim 7, wherein the host cell is Pichia pastoris (Pichia pastoris)) (IIPichia pastoris）。

9. The host cell of claim 7, wherein the host cell is Trichoderma reesei (T.reesei)Trichoderma reesei）。

10. Use of a xylanase mutant according to any one of claims 1-4 in the field of papermaking.