CN113637762A - Application of miRNA related to melanoma in diagnosis and treatment of melanoma - Google Patents

Abstract

The invention discloses application of miRNA related to melanoma in diagnosis and treatment of melanoma, wherein the miRNA related to melanoma comprises miR-1321 and miR-139-5p, the miRNA combination has better diagnosis efficiency on melanoma, and the accuracy, sensitivity and specificity are higher.

Description

Application of miRNA related to melanoma in diagnosis and treatment of melanoma

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to application of miRNA related to melanoma in diagnosis and treatment of melanoma, more particularly to miRNA related to melanoma comprising miR-1321 and miR-139-5 p.

Background

Melanoma (Melanoma) is a highly malignant tumor derived from melanocytes, is called as malignant black for short, mostly occurs in skin, mucous membrane and internal organs, and in recent years, the morbidity and mortality of Melanoma worldwide are on the increase trend, accounting for 1% -3% of all malignant tumors, but the growth rate of Melanoma is increased year by year at 6% -7%, and the age of the Melanoma is on the trend of being younger, which is one of the malignant tumors with the fastest growth rate. The incidence of Melanoma has obvious ethnic difference, the incidence of Melanoma is highest in caucasians, the incidence of yellow and black people is relatively low (Garbe C, Leiter U. Melanoma epidemiology and tresnds [ J ]. Clin Dermatol, 2009, 27(01): 3-9), the incidence of Melanoma in China is 0.49/10 ten thousand, and is at a relatively low incidence level compared with high incidence areas in Europe and the United states, but because the malignancy of Melanoma is high, blood and lymph metastasis easily occurs, the clinical prognosis is poor, and the analysis and research on Melanoma in China are relatively few, the research on the incidence mechanism and the treatment method of Melanoma are still needed, and a new target point is provided for the diagnosis and treatment of Melanoma.

Early Melanoma can reach 90% of its survival rate through surgery-based treatment, but malignant Melanoma is very invasive, very prone to early metastasis, and has a very low cure rate once metastasis has occurred (Russo A E, Torrisi E, Bevelacqua Y, et al. Melanoma: molecular profiling and organizing target therapeutics [ J ]. International patent journal of oncology, 2009, 34(6): 1481-1489.). Meanwhile, melanoma is less sensitive to chemotherapy and radiotherapy, the survival rate of advanced metastatic melanoma is only about 10%, and the recurrence rate is as high as 60%. In recent years, related targeted therapies such as mitogen-activated protein kinase (MAPK) pathway inhibitors, anti-cytotoxic T lymphocyte-associated antigen-4 (CTLA-4) and programmed cell death protein 1 (PD-1)/programmed cell death ligand 1 (PD-L1) pathway blockers and biological immunotherapy have appeared, so that the treatment of melanoma is greatly improved, but the treatment fails, the treatment effect is not durable, or serious side effects appear in the treatments, the overall treatment effect is not ideal, and the pathogenesis of the treatment is still unclear, so that the further research is carried out on the melanoma, and the pathogenesis and the regulation mechanism of the melanoma are further researched. The discovery of new targets associated with their development and progression could provide new strategies for the clinical treatment of melanoma, allowing the search for more effective, robust and personalisable treatment regimens.

miRNA (microRNA) also called microRNA is widely existed in eukaryote, is a small endogenous and non-coding RNA, is expressed in 60% of coding protein genes of mammals, and plays a corresponding physiological role, the abnormal expression and abnormal function of the miRNA are related to the development and progress of a plurality of human diseases, including various malignant tumors, and a plurality of regulating miRNAs also exist in melanoma, so that an effective method can be provided for the diagnosis and treatment of the miRNA which is differentially expressed in the melanoma and regulates the growth of melanoma cells.

Disclosure of Invention

In view of the above, in order to overcome the technical defects existing in the prior art, the present invention aims to provide the application of melanoma-associated mirnas including miR-1321 and miR-139-5p in the diagnosis and treatment of melanoma.

The above object of the present invention is achieved by the following technical solutions:

in a first aspect, the present invention provides the use of a reagent for detecting a biomarker for the manufacture of a product for the early diagnosis of melanoma.

Further, the biomarkers are miR-1321 and miR-139-5 p.

Further, the agent is selected from:

a probe that specifically recognizes the biomarker; or

A primer that specifically amplifies the biomarker.

Further, the sequences of primers for specifically amplifying the biomarkers miR-1321 and miR-139-5p are respectively shown as SEQ ID NO 7-SEQ ID NO 8 and SEQ ID NO 9-SEQ ID NO 10.

A biomarker, as used herein, refers to a miRNA that is differentially expressed between a subject having a second phenotype (e.g., no disease) and a subject having a first phenotype (e.g., having a disease), specifically, that is significantly differentially present (i.e., increased or decreased) in a biological sample from a subject or a group of subjects having a first phenotype (e.g., having a disease) as compared to a biological sample from a subject or a group of subjects having a second phenotype (e.g., no disease); biomarkers can be differentially present at any level, but are generally present at levels increased by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, or more; or generally at a level that is reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% (i.e., absent).

The miR-1321 provided by the invention comprises miR-1321 and a homolog, a mutant and an isoform thereof, the term covers full-length, unprocessed miR-1321 and any processed miR-1321 in a cell, the term covers a naturally-occurring variant (such as a splicing variant or an allelic variant) of miR-1321, a specific sequence of the miR-1321 provided by the invention can be inquired in a miRBase database (http:// microrna.sanger.ac.uk /), and in a specific embodiment of the invention, the sequence of miR-431 is shown as SEQ ID NO. 13;

sequence of miR-1321:

ACAUUAUGAAGCAAGUAUUAUUAUCCCUGUUUUACAAAUAAGGAAAUAAACUCAGGGAGGUGAAUGUGAUCAAAGAUAG（SEQ ID NO:13）

the miR-139-5p provided by the invention comprises miR-139-5p and homologues, mutants and isoforms thereof, the term covers full-length, unprocessed miR-139-5p and any form of miR-139-5p which is derived from processing in cells, the term covers naturally occurring variants (such as splice variants or allelic variants) of miR-139-5p, and the specific sequence of miR-139-5p provided by the invention can be inquired in a miRBase database (http:// microrna.sanger.ac.uk /), and in the specific embodiment of the invention, the sequence of miR-139-5p is shown as SEQ ID NO: 14;

sequence of miR-139-5 p:

UCUACAGUGCACGUGUCUCCAGU（SEQ ID NO:14）

the combined diagnostic efficacy of miR-1321, miR-139-5p, miR-1321 and miR-139-5p is verified by a Receiver operating characteristic curve (ROC), the Area under the curve (AUC) refers to the Area under the ROC curve which is well known to a person skilled in the art, and the determination of the Area under the curve (AUC) is helpful for comparing the accuracy of the classifier through the whole data range. Classifiers with larger area under the curve (AUC) have greater ability to accurately classify an unknown between two groups of interest (e.g., cancer samples and normal or control samples). In distinguishing between two populations (e.g., a group with melanoma versus a control group that is not melanoma), a receiver operating characteristic curve (ROC) is useful for graphically representing the performance of a particular feature (e.g., any of the biomarkers and/or additional biomedical information described in the present disclosure). Typically, the above feature data across the entire population (e.g., patient group and control group) is sorted in ascending order based on a single feature value. Then, for each value of the above-described features, a true positive rate and a false positive rate for the data are calculated. The true positive rate is determined by calculating the number of cases higher than or equal to a value for the characteristic thereof and dividing the number of cases by the total number of cases. The false positive rate is determined by counting the number of control groups above the value for the characteristic and dividing by the total number of control groups. Although the definition refers to the case where the characteristic of the patient group is high relative to the control group, the definition also applies to the case where the characteristic of the patient group is low relative to the control group (in this case, the number of samples whose values are lower than the above characteristic can be calculated). A receiver operating characteristic curve (ROC) may be generated for other Single calculations, but also for a Single characteristic, in order to provide a Single sum value (e.g., more than two characteristics may be mathematically combined (e.g., added, subtracted, multiplied, etc.), for example, which may be represented by a receiver operating characteristic curve (ROC). Additionally, combinations of multiple characteristics that can derive a single calculated value can be plotted against a receiver operating characteristic curve (ROC). These combinations of characteristics may constitute tests. The receiver operating characteristic curve (ROC) is a graph showing the true positive rate (sensitivity) of the test relative to the false positive rate (1-specificity) of the test.

In a second aspect the invention provides a product for early diagnosis of melanoma.

Further, the product comprises a reagent for detecting the biomarkers in the sample to be detected, wherein the biomarkers are miR-1321 and miR-139-5 p.

Further, the product comprises a kit and a chip;

preferably, the kit comprises primers, probes or chips which specifically bind to miR-1321 and miR-139-5 p;

preferably, the chip comprises a solid phase carrier and a probe which is attached to the solid phase carrier and specifically recognizes miR-1321 and miR-139-5 p.

Further, the sample to be tested is derived from a subject;

the subject as used in the present invention refers to any animal, and also refers to human and non-human animals. The term "non-human animal" includes all vertebrates, e.g., mammals, such as non-human primates (particularly higher primates), sheep, dogs, rodents (such as mice or rats), guinea pigs, goats, pigs, cats, rabbits, cattle, and any domestic or pet animal; and non-mammals, such as chickens, amphibians, reptiles, and the like. In a preferred embodiment, the subject is a human.

The sample to be tested in the present invention is meant to include any sample obtained by collecting and sampling cells, tissues or body fluids, wherein, including but not limited to, the source of the tissue or cell sample may be solid tissue from fresh, frozen and/or preserved organ or tissue samples, or biopsy or aspirate, blood or any blood component; body fluids such as cerebrospinal fluid, amniotic fluid, peritoneal fluid or interstitial fluid. The tissue sample may be primary or in vitro cultured cells or cell lines. Alternatively, the tissue or cell sample is taken from a diseased tissue/organ. The tissue sample may contain compounds naturally mixed with the tissue, such as preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics, or the like, preferably the test sample is blood or tissue derived from the subject, more preferably the test sample is blood derived from the subject.

Further, the kit of the present invention further comprises: container, instructions for use, positive control, negative control, buffer, adjuvant or solvent. For example, a solution for suspending or immobilizing cells, a detectable label or label, a solution for facilitating hybridization of nucleic acids, a solution for lysing cells, or a solution for nucleic acid purification.

Furthermore, the kit of the present invention may further comprise instructions for using the kit, wherein the instructions describe how to use the kit for detection and how to use the detection result to determine whether melanoma is present or not or whether the melanoma is at risk.

Further, with the kit of the present invention, miR-1321 and miR-139-5p can be detected by various methods selected from the group consisting of (including but not limited to): real-time quantitative reverse transcription PCR, biochip detection method, southern blotting, northern blotting or in situ hybridization. The detection mode can be adjusted and changed by those skilled in the art according to actual conditions and needs.

Further, the solid phase carrier for preparing the chip of the present invention includes various materials commonly used in the field of gene chips, such as (but not limited to) nylon membrane, glass or silicon slice modified with active groups (such as aldehyde group, amino group, etc.), unmodified glass slice, plastic slice, etc.

Further, the chip is a miRNA chip, which can be prepared by a conventional manufacturing method of a biochip known in the art, for example, if the solid support is a modified glass slide or a silicon wafer, the 5' end of the probe contains a poly-dT string modified with an amino group, the oligonucleotide probe can be prepared into a solution, and then spotted on the modified glass slide or the silicon wafer by using a spotting machine to arrange the solution into a predetermined sequence or array, and then the miRNA chip can be fixed by standing overnight, so that the miRNA chip of the present invention can be obtained. If the nucleic acid does not contain amino modifications, reference can also be made to the following documents: the "Gene diagnostic technique-non-Radioactive operation Manual" edited by Wangshen five; J.L.erisi, V.R.Iyer, P.O.BROWN. expanding the metabolic and genetic control of gene expression a genetic scale, Science 1997, 278: 680 and Marisher, Jiang China Master edition, biochip, Beijing: chemical industry Press, 2000, 1-130.

The invention also provides application of the biomarker in constructing a calculation model for predicting melanoma.

Further, the biomarkers are miR-1321 and miR-139-5 p;

preferably, the calculation model is constructed by taking the expression levels of miR-1321 and miR-139-5p as input variables.

In a third aspect, the present invention provides the use of a biomarker for screening for a candidate drug for the prevention and/or treatment of melanoma.

Further, the biomarkers are miR-1321 and miR-139-5 p.

In a fourth aspect of the present invention, there is provided a method of screening a candidate drug for the prevention and/or treatment of melanoma.

Further, the method comprises the steps of:

(1) treating a system expressing or containing miR-1321 and miR-139-5p by using a substance to be screened;

(2) detecting the expression levels of miR-1321 and miR-139-5p in the system;

(3) if the substance to be screened can reduce the expression level of miR-1321 and increase the expression level of miR-139-5p, the substance is a candidate drug for preventing and/or treating melanoma.

Further, the system is selected from: a cell system, a subcellular system, a solution system, a tissue system, an organ system, or an animal system.

In a fifth aspect, the invention provides the use of a biomarker in the manufacture of a medicament for the treatment of melanoma.

Further, the biomarkers are miR-1321 and miR-139-5 p.

Further, the medicine comprises an inhibitor for reducing the expression level of miR-1321 and an accelerant for increasing the expression level of miR-139-5 p.

Further, the sequence of the inhibitor for reducing the expression level of miR-1321 is shown in SEQ ID NO 1;

the promoter for increasing the expression level of miR-139-5p has a sequence shown in SEQ ID NO 2-SEQ ID NO 3.

The sixth aspect of the invention provides a medicament for treating melanoma.

Further, the medicine comprises an inhibitor for reducing the expression level of miR-1321 and an accelerant for increasing the expression level of miR-139-5 p;

preferably, the sequence of the inhibitor for reducing the expression level of miR-1321 is shown in SEQ ID NO 1;

preferably, the promoter for increasing the expression level of miR-139-5p has a sequence shown in SEQ ID NO 2-SEQ ID NO 3.

Further, the medicine also comprises a pharmaceutically acceptable carrier and/or an auxiliary material.

Further, the pharmaceutically acceptable carrier and/or adjuvant refers to those recognized in the art and includes, for example, pharmaceutically acceptable materials, compositions or excipients, such as liquid or solid fillers, diluents, solvents or encapsulating materials, involved in carrying or transporting any subject composition from one organ or portion of the body to another organ or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the subject composition and not injurious to the patient. In certain embodiments, the pharmaceutically acceptable carrier and/or adjuvant is pyrogen-free. Some examples of materials that may be used as pharmaceutically acceptable carriers and/or adjuvants include: (1) sugars such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered gum tragacanth; (5) malt; (6) gelatin; (7) talc powder; (8) cocoa butter and suppository waxes; (9) oils such as peanut oil, cottonseed oil, sunflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols such as glycerol, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) ringer's solution; (19) ethanol; (20) phosphate buffer; (21) other non-toxic compatible substances used in pharmaceutical formulations.

Compared with the prior art, the invention has the advantages and beneficial effects that:

the miR-1321 and miR-139-5p combination is found to be used for diagnosing and treating early melanoma for the first time, and the miR-1321 and miR-139-5p combination is proved to have better diagnosis efficiency, higher sensitivity and specificity through experiments.

Drawings

Embodiments of the invention are described in detail below with reference to the attached drawing figures, wherein:

FIG. 1 shows a graph of the results of miR-1321 and miR-139-5p differentially expressed between the control group and the melanoma group, wherein, A is a graph: miR-1321, Panel B: miR-139-5 p;

FIG. 2 shows the results of ROC curve for the validation of the diagnostic efficacy of miR-1321 and miR-139-5p on melanoma, wherein, A is shown as follows: miR-1321, Panel B: miR-139-5 p;

FIG. 3 shows a ROC curve result chart of the diagnostic efficacy validation of the miR-1321+ miR-139-5p combination on melanoma;

FIG. 4 is a graph showing the results of the relative expression amounts of miR-1321 and miR-139-5p, wherein, Panel A: miR-1321, Panel B: miR-139-5 p;

FIG. 5 shows a statistical graph of the results of the effects of the combination of miR-1321 inhibitor, miR-139-5p mimics and miR-1321 inhibitor + miR-139-5p mimics on the proliferation rate of melanoma cells;

FIG. 6 shows a result graph of the effect of the combination of miR-1321 inhibitor, miR-139-5p mimics and miR-1321 inhibitor + miR-139-5p mimics on the apoptosis rate of melanoma cells, wherein, A is shown as follows: blank control, panel B: negative control group, panel C: miR-1321 inhibitor group, panel D: miR-139-5p mimics group, E picture: miR-1321 inhibitor + miR-139-5p mimics.

Detailed Description

The present invention is further illustrated below with reference to specific examples, which are intended to be illustrative only and are not to be construed as limiting the invention. As will be understood by those of ordinary skill in the art: various changes, modifications, substitutions and alterations can be made to the embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents. The following examples are examples of experimental methods not indicating specific conditions, and the detection is usually carried out according to conventional conditions or according to the conditions recommended by the manufacturers.

Example 1 screening of genes differentially expressed in melanoma

1. Data sourcing and processing

Public Gene Expression data and complete clinical annotations were searched in a Gene Expression integration database (Gene Expression Omnibus, GEO), and a Melanoma (Melanoma) Gene Expression dataset GSE20994 was downloaded from the GEO database (http:// www.ncbi.nlm.nih.gov/GEO /), including blood sample data of healthy controls and Melanoma patients, at a sample size of Case: normal = 35: and 22, annotating the gene expression matrix by using an annotation file, taking an average value of a plurality of probes corresponding to the same gene as the expression quantity of the gene expression matrix, and then obtaining the gene expression matrix file.

2. Differential expression analysis

Differential expression analysis was performed on the data using the "limma" package in the R software, where the screening criteria for differentially expressed genes were: | log₂FC|>0.5，adj.P value<0.05。

3. Results of the experiment

The experimental result shows that 397 are obtained in total through screening, 190 are up-regulated and 207 are down-regulated, wherein the expression of the biomarker miR-1321 related to the invention in the blood sample of a melanoma patient is remarkably up-regulated, and the expression of the biomarker miR-139-5p related to the invention in the blood sample of the melanoma patient is remarkably down-regulated, and the result is shown in Table 1, figure 1A and figure 1B.

TABLE 1 differential expression results of miR-1321 and miR-139-5p

Example 2 verification of miR-1321 and miR-139-5p diagnostic efficacy

1. Experimental methods

Receiver Operating Characteristic (ROC) analysis is performed by using R package 'pROC', an ROC curve is drawn, AUC values, sensitivities and specificities of the differentially expressed genes miR-1321, miR-139-5p and miR-1321+ miR-139-5p obtained by screening in the example 1 as detection variables are respectively analyzed, the diagnosis efficiency of the indexes miR-1321, miR-139-5p and miR-1321+ miR-139-5p on melanoma is judged, and the expression quantity of miRNA is directly used for analysis when the diagnosis efficiency of single miRNA is judged. Calling a pROC package, reading in an expression quantity matrix constructed by target miRNA, and running a command for drawing an ROC curve, wherein the command adopts for circulation and simultaneously relates to a command for adding AUC, Thres (threshold value) and Smooth (fitted curve). When the diagnosis efficiency of miRNA combination is judged, firstly, Logistic regression analysis is carried out on miRNA by using glmnet, the influence of certain prediction variable on result probability at each level is observed by using a prediction function by using an established Logistic regression model, the prediction probability is calculated, an ROC curve of the prediction result is drawn, and the diagnosis efficiency of miR-1321, miR-139-5p and miR-1321+ miR-139-5p is analyzed.

2. Results of the experiment

The results are shown in the table 2, the figure 2A, the figure 2B and the figure 3, and the results show that the miR-1321 and the miR-139-5p jointly applied to the diagnosis of melanoma has higher accuracy, sensitivity and specificity, the AUC value is 0.840 and is obviously superior to the diagnosis efficiency of single genes miR-1321 and miR-139-5p, and the miR-1321 and miR-139-5p jointly has better diagnosis efficiency.

TABLE 2 diagnostic potency results for miR-1321, miR-139-5p, miR-1321+ miR-139-5p

Example 3 study on the relationship between the expression of miR-1321 and miR-139-5p and the proliferation and apoptosis of melanoma cells

1. Experimental Material

The main experimental equipment, experimental reagents and consumables involved in the experiment are shown in tables 3 and 4.

TABLE 3 Main Equipment involved in the experiment

TABLE 4 major reagents involved in the experiment

2. Cell source

Melanoma cells A375 were purchased from Shanghai institute of cell biology, Chinese academy of sciences and were introduced for long term culture in the laboratory. A375 culture medium is DMEM +10% FBS +1% P/S solution at 37 deg.C and 5% CO₂Culturing under the conditions of 95% air and saturated humidity.

3. Cell culture

(1) A375 melanoma cell resuscitation

The cell recovery method adopts a method of rapid melting in a water bath. Before the experiment, protection is carried out, gloves and protective masks are worn, an A375 melanoma cell cryopreservation tube is taken out from liquid nitrogen, information such as label name, cryopreservation date and the like is observed, the required cells are determined, and then the cells are placed quicklyPlacing in a prepared water bath kettle at 37 deg.C, rapidly thawing frozen solution within 1 min, sterilizing to prevent infection, protecting bottle cap, transferring frozen cells into centrifuge tube with a straw, adding PBS buffer solution, blowing to ensure complete thawing, placing centrifuge tube into centrifuge, adjusting rotation speed to 1000 rpm/min, maintaining for 5 min, taking out supernatant, keeping substances at bottom layer of centrifuge tube, adding appropriate amount of DMEM, suspending, planting in T25 culture bottles at a ratio of 1:2, adding DMEMF culture medium 5 mL into each culture bottle, observing suspended round cells under the mirror to represent that the cells have been successfully transferred, and placing into a culture bottle containing 5% CO₂Culturing in a cell incubator at constant temperature of 37 ℃;

(2) a375 melanoma cell exchange solution

The time for A375 melanoma cells to begin to adhere to the wall is about 4-6 hours generally, the cells can be adhered to the wall completely within one day generally, the cells after adhering to the wall are polygonal, the cells can be changed according to the color of the observed culture solution and the observation condition under a mirror, the DMEM complete culture medium is required to be preheated in a constant-temperature water bath kettle at 37 ℃, a Pasteur tube can be used for sucking the old culture solution on the cells, the cells do not contact the lower part of the culture dish as far as possible, scratches caused by bottom-layer cells are prevented, and the cells are not uniformly grown. Washing with 37 deg.C water bath preheated PBS buffer solution slowly along the side wall to remove some necrotic cells, washing with 37 deg.C water bath preheated PBS three times, adding 37 deg.C water bath preheated 5 mL DMEM complete culture medium into the culture dish, and adding 5% CO₂And culturing in a constant-temperature incubator at 37 ℃. The whole process is carried out aseptically, the pasteur tube is discarded in time after contacting the outside, the process is clean and convenient, and the long time is not suitable;

(3) passage of A375 melanoma cells

About 2-3 days, A375 melanoma cells reached 80% -100% cell fusion when passaged. Personal protection was performed before the experiment, in an ultra-clean bench sterilized in advance for 30 min, Pasteur tubes were used, old culture medium was discarded, and 37 ℃ water was usedWashing with preheated PBS for three times, adding 1 mL of trypsin with concentration of 0.25%, placing in a37 ℃ constant temperature incubator, timing for about 1 min to determine whether cells are completely digested, observing under an inverted microscope, stopping digestion of trypsin if most of round cells are suspended, adding 1-2 mL of 5-10 mL of DMEM/F-12 complete culture medium preheated in 37 ℃ water bath, blowing cells in time to completely suspend the cells, transferring into a centrifuge tube, balancing the centrifuge, adjusting the rotation speed to 1000 rpm/min, centrifuging for about 5 min, subculturing according to the ratio of 1:3-1:5, placing 5-10 mL of DMEM/F-12 complete culture medium in a culture dish, placing in 37 ℃ and 5% CO₂The cell incubator of (1) for culturing.

4. Cell transfection

(1) Taking A375 cells in logarithmic growth phase, and adjusting cell density to 1 × 10 with culture medium⁵The cells are inoculated into 6-hole plates, 2 mL of cell suspension is added into each hole, each group comprises two holes, and the cells are cultured overnight at 37 ℃;

(2) 2 hours before transfection, the medium is changed into a serum-free medium;

(3) the transfection procedure, for each transfection sample, was prepared as follows:

1) counting cells one day before transfection, adding 1 mL into 6-well plate to make cell density of the plate not less than 2 × 10⁵A plurality of;

2) for each well of cells, 10. mu.L of 100 nM inhibitor or mimics was diluted with 250. mu.L of serum-free medium and incubated for 5 min at room temperature;

3) for each well of cells, 5 μ L Lipo2000 was diluted with 250 μ L serum free medium and incubated for 5 min at room temperature;

4) mixing the liquids in the step 2) and the step 3), and incubating for 20 min at room temperature;

5) replacing pre-divided adherent cells with serum-free medium, adding the above complex, and culturing at 37 deg.C with 5% CO₂Culturing for 6 hr, adding growth medium containing serum, and culturing at 37 deg.C under 5% CO₂And culturing for 48 hours. Collecting a cell sample, washing twice with PBS, discarding liquid, and extracting RNA subsequently;

the experiments were set up as 3 groups: blank control group (A375 melanoma cells), negative control group (inhibitor-NC or mimics-NC group) and experimental group (inhibitor or mimics group).

Wherein, the sequence information of the inhibitor aiming at miR-1321 is as follows:

5’-AUCACAUUCACCUCCCUG-3’（SEQ ID NO:1）

the sequence information of the mimics for miR-139-5p is as follows:

sense strand 5'-UCUACAGUGCACGUGUCUCCAGU-3' (SEQ ID NO: 2)

The antisense strand is 5'-ACUGGAGACACGUGCACUGUAGA-3' (SEQ ID NO: 3)

Sequence information of inhibitor-NC is as follows:

5’-CAGUACUUUUGUGUAGUACAAA-3’（SEQ ID NO:4）

the sequence information of the mimics-NC is as follows:

the sense strand is 5'-UUUGUACUACACAAAAGUACUG-3' (SEQ ID NO: 5)

The antisense strand is 5'-CAGUACUUUUGUGUAGUACAAA-3' (SEQ ID NO: 6)

5. QPCR (quantitative polymerase chain reaction) detection of expression levels of miR-1321 and miR-139-5p in cells

(1) Extraction of sample Total RNA (Trizol method)

1) Taking a proper amount of a sample to be detected, adding liquid nitrogen, grinding and crushing;

2) the ground samples were transferred to 1.5 mL EP tubes with 1 mL Trizol;

3) adding 500 mu L of phenol chloride into a 1.5 mL EP tube, shaking and mixing uniformly, and standing for 5 minutes;

4) centrifuge at 12000 rpm for 10 minutes at 4 ℃ and carefully pipette the supernatant into a new 1.5 mL EP tube;

5) adding 700 μ L isopropanol into the separated supernatant, and mixing well;

6) centrifuging at 12000 rpm at 4 deg.C for 10 min, and carefully discarding the supernatant;

7) washing the precipitate with 75% ethanol once, and air drying at room temperature;

8) dissolving the RNA precipitate by 50 mu L DEPC water;

9) and (5) detecting by agarose gel electrophoresis.

(2) Total RNA quality detection

1) The concentration and purity of RNA were determined using a nucleic acid concentration meter, which was previously zeroed with DEPC water for RNA lysis, and the procedure was as follows: lifting the sample arm to apply the sample to the test base; the sample arm was lowered and absorbance detection was initiated using software on the computer. A sample column can be automatically pulled out between the upper optical fiber and the lower optical fiber, and then detection is carried out; after the detection is finished, lifting the sample arm, and wiping the samples on the upper base and the lower base clean by clean dust-free paper;

2) and (3) concentration determination: a reading at 260 nm of 1 indicates 40 ng RNA/μ L. The formula for calculating the RNA concentration of the sample is as follows: A260X 40 ng/muL;

3) and (3) purity detection: the ratio of A260/A280 of the RNA solution is a method for detecting RNA purity, and the ratio ranges from 1.8 to 2.1.

(3) Reverse transcription to synthesize cDNA

Reverse transcription was performed using the Invitrogen reverse transcription kit superscript III;

the reaction system 1 is established as shown in Table 5, and is mixed evenly and centrifuged for 5 minutes at 65 ℃, and then is placed on ice after the reaction is finished;

TABLE 5 composition of reaction System 1

The reaction system 2 was set up as shown in Table 6;

TABLE 6 composition of reaction System 2

Mixing, centrifuging, and placing at 42 deg.C in water bath for 60 min; taking out, reacting at 85 deg.C for 10 min, inactivating reverse transcriptase, and standing at-20 deg.C.

(4) Real-time fluorescent quantitative detection

Firstly, designing amplification primers of QPCR, wherein specific primer sequences are as follows:

miR-1321：

the forward primer was 5'-CAGGGAGGTGAATGTGAT-3' (SEQ ID NO: 7);

the reverse primer is 5'-CTCAACTGGTGTCGTG-3' (SEQ ID NO: 8);

miR-139-5p：

the forward primer was 5'-TCTACAGTGCACGTGTCTC-3' (SEQ ID NO: 9);

the reverse primer is 5'-CTCAACTGGTGTCGTG-3' (SEQ ID NO: 10);

u6 internal reference primer:

the forward primer was 5'-GCTTCGGCAGCACATATACTAAAAT-3' (SEQ ID NO: 11);

the reverse primer is 5'-CGCTTCACGAATTTGCGTGTCAT-3' (SEQ ID NO: 12);

the Real time PCR reaction system is set up as shown in Table 7;

TABLE 7 Real time PCR reaction System

After the system is mixed uniformly, the mixture is instantaneously separated and placed on a fluorescent quantitative PCR instrument for reaction according to the conditions shown in the table 8;

TABLE 8 Realtime PCR reaction conditions

And analyzing relative quantitative results of each group of samples, wherein the calculation formulas of the relative expression amounts of miR-1321 and miR-139-5p are as follows:

6. cell proliferation assay

In the embodiment, CCK-8 cell proliferation experiments are adopted to detect the influence of miR-1321, miR-139-5p and miR-1321+ miR-139-5p expression on A375 melanoma cell proliferation, untreated A375 melanoma cells are used as a blank control group, A375 melanoma cells transfected with inhibitor-NC or mimics-NC are used as a negative control group, and A375 melanoma cells transfected with inhibitor or mimics are used as an experimental group;

cell suspensions of the above groups were prepared, and the cells were seeded into 96-well plates at 100. mu.L per well, 3 multiple wells per group, and cultured for 12 hours to adhere to the wall. Add 10. mu.L of CCK8 assay solution to each well and continue incubation for 1 h. The absorbance at 450 nm is measured by a microplate reader, and the absorbance value is in direct proportion to the proliferation capacity of the cells. And recording the related data, and analyzing the proliferation condition of each group of cells according to the detected OD value.

7. Apoptosis assay

In the embodiment, flow cytometry is adopted to detect the influence of miR-1321, miR-139-5p and miR-1321+ miR-139-5p expression on A375 melanoma cell apoptosis, firstly, A375 melanoma cells which are not transfected, are transfected with miR-1321 inhibitor, are transfected with miR-139-5p mimics, and are simultaneously transfected with miR-1321 inhibitor and miR-139-5p mimics are collected, washed and then are fixed by ethanol, and then are subjected to cell resuspension and cell filtration, and are dyed by PI dye solution, and then are detected by a flow cytometer;

in the apoptosis detection, different quadrants in a flow cytometry detection result chart represent different meanings, Q1-1 (annexin V-FITC) -/PI + represents necrotic cells, Q1-2 (annexin V + FITC) +/PI + represents middle and late apoptotic cells, Q1-4 (annexin V-FITC) +/PI-represents early apoptotic cells, Q1-3 (annexin V-FITC) -/PI-represents normal living cells, the percentage of each quadrant represents the proportion of corresponding cells, and the total apoptosis rate = middle and late apoptosis rate + early apoptosis rate.

8. Results of the experiment

The transfection result shows that, with the expression level of the blank control group miR-1321 as a reference set as 1, compared with the expression level (relative expression amount is 1) of the blank control group miR-1321 and the expression level of the negative control group (NC group) miR-1321 of the transfection inhibitor-NC, the expression level of the miR-1321 of the experimental group of the transfection inhibitor-1321 inhibitor is significantly reduced, and the difference has statistical significance (P < 0.05), while the blank control group and the negative control group have no significant difference (see FIG. 4A);

the transfection result shows that the expression level of the blank control group miR-139-5P is set as 1 as a reference, compared with the expression level (relative expression amount is 1) of the blank control group miR-139-5P and the expression level of the negative control group (NC group) miR-139-5P of the transfection mimics-NC, the expression level of the miR-139-5P of the experimental group of the transfection miR-139-5P mimics is obviously up-regulated, and the difference has statistical significance (P < 0.05), while the blank control group and the negative control group have no significant difference (see FIG. 4B);

the result of a cell proliferation experiment shows that the OD450 of an experimental group transfected with miR-1321 inhibitor is significantly lower than that of a blank control group and a negative control group (see Table 9 and figure 5), which indicates that miR-1321 can influence the proliferation activity of melanoma cells, and the expression level of miR-1321 is reduced to reduce the proliferation activity of the melanoma cells;

the result of a cell proliferation experiment shows that the OD450 of an experimental group transfected with miR-139-5p mimics is significantly lower than that of a blank control group and a negative control group (see Table 9 and figure 5), which indicates that miR-139-5p can influence the proliferation activity of melanoma cells, and the proliferation activity of the melanoma cells can be reduced by increasing the expression level of miR-139-5 p;

in addition, the proliferation rate and the inhibition rate of the cells of each group are calculated, the calculated results are respectively shown in tables 10 and 11, and the combination of the results with figure 5 shows that the proliferation rate of the cells co-transfected with miR-1321 inhibitor and miR-139-5p mimics is significantly lower than that of the cells singly transfected with miR-1321 inhibitor and miR-139-5p mimics;

using the formula q = E_A+B/(E_A+E_B-E_A×E_B) Judging whether the effect of the two combined use is better than that of the single use, wherein E_A+BThe inhibition rate of miR-1321 inhibitor + miR-139-5p mimics on melanoma cells, E_AIs the inhibition rate of miR-1321 inhibitor on melanoma cells, E_BThe inhibition rate of miR-139-5p mimics on melanoma cells is shown; if q =0.85-1.15, the inhibition effect of the miR-1321 inhibitor and the miR-139-5p mimics on the proliferation of melanoma cells is a synergistic effect instead of simple superposition, the synergy is that q is more than 1.15 and less than 20, the significant synergy is that q is more than 20, and the antagonism is that q is less than 0.85, namely that q is more than 1.15;

according to Table 11, calculating a synergistic q value by utilizing a King's formula, evaluating whether the combined effect of the miR-1321 inhibitor and the miR-139-5p mimics is stronger than a single effect or not, and substituting the combined effect into the calculated cell inhibition rate result to know that q = E_A+B/(E_A+E_B-E_A×E_B)=[(0.772+0.786+0.781)/3]/{[(0.344+0.335+0.332)/3]+[(0.346+0.334+0.337)/3]-[(0.344+0.335+0.332)/3]×[(0.346+0.334+0.337)/3]And the inhibition effect of the miR-1321 inhibitor and the miR-139-5p mimics on the proliferation of the melanoma cells is synergistic, namely the combination of the two shows synergistic treatment.

TABLE 9 statistics of results of cell proliferation experiments

TABLE 10 calculation results of cell proliferation rates of the respective groups

TABLE 11 calculation results of cytostatic rates of the respective groups

The result of an apoptosis experiment shows that the total apoptosis rate (10.05%) of cells of an experimental group transfected with miR-1321 inhibitor is significantly higher than that of a blank control group (3.05%) and a negative control group (2.96%) (see Table 12 and FIGS. 6A, 6B and 6C), which indicates that miR-1321 can influence the apoptosis capacity of melanoma cells, and the inhibition of the expression of miR-1321 can promote the apoptosis of the melanoma cells;

the result of an apoptosis experiment shows that the total apoptosis rate (10.18%) of cells of an experimental group transfected with miR-139-5p mimics is significantly higher than that of a blank control group (3.05%) and a negative control group (2.96%) (see Table 12 and FIGS. 6A, 6B and 6D), which indicates that miR-139-5p can influence the apoptosis capacity of melanoma cells, and the increase of the expression level of miR-139-5p can promote the apoptosis of the melanoma cells;

the results of apoptosis experiments showed that the total apoptosis rate (25.15%) of cells of the experimental group co-transfected with miR-1321 inhibitor and miR-139-5p mimics was significantly higher than that of the experimental group transfected with miR-1321 inhibitor alone (10.05%) and that of the experimental group transfected with miR-139-5p mimics alone (10.18%) (see Table 12 and FIG. 6C, FIG. 6D, FIG. 6E);

in addition, the cell inhibition ratios of the respective groups were calculated, and the results obtained by the calculation are shown in table 13, using the formula q = E_A+B/(E_A+E_B-E_A×E_B) Judging whether the effect of the two combined use is better than that of the single use, wherein E_A+BThe inhibition rate of miR-1321 inhibitor + miR-139-5p mimics on melanoma cells, E_AIs the inhibition rate of miR-1321 inhibitor on melanoma cells, E_BThe inhibition rate of miR-139-5p mimics on melanoma cells is shown; if q =0.85-1.15, the pure superposition is carried out, q is more than 1.15 and less than 20, the synergy is carried out, q is more than 20, the obvious synergy is carried out, q is less than 0.85, antagonism is carried out, namely the miR-1321 inhibitor and miR-139-5p mimics can be judged to have a synergistic effect on the apoptosis promotion effect of melanoma cells instead of the pure superposition;

according to the results of the cell inhibition rates calculated in table 13, the synergy q value was calculated by using the gold formula, and whether the combined effect of the miR-1321 inhibitor and the miR-139-5p mimics is stronger than the single effect or not was evaluated, and the results of the cell inhibition rates calculated by substituting q = E are known_A+B/(E_A+E_B-E_A×E_B) =0.2210/(0.0700+0.0713-0.0700 × 0.0713) =1.621, namely q =1.621, q > 1.15, which shows that the apoptosis promoting effect of miR-1321 inhibitor and miR-139-5p mimics on melanoma cells is a synergistic effect, and further proves that the miR-1321 inhibitor and miR-139-5p mimics are combined to be synergistic treatment instead of simple additive effect.

TABLE 12 statistics of results of apoptosis experiments

TABLE 13 calculation results of cytostatic rates of the respective groups

The above description of the embodiments is only intended to illustrate the method of the invention and its core idea. It should be noted that, for those skilled in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications will also fall into the protection scope of the claims of the present invention.

Sequence listing

<110> Beijing Baiao Cisco biomedical technology Co., Ltd

<120> application of melanoma-associated miRNA in diagnosis and treatment of melanoma

<141> 2021-10-11

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 18

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aucacauuca ccucccug 18

<210> 2

<211> 23

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ucuacagugc acgugucucc agu 23

<210> 3

<211> 23

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

acuggagaca cgugcacugu aga 23

<210> 4

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

caguacuuuu guguaguaca aa 22

<210> 5

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

uuuguacuac acaaaaguac ug 22

<210> 6

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

caguacuuuu guguaguaca aa 22

<210> 7

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cagggaggtg aatgtgat 18

<210> 8

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ctcaactggt gtcgtg 16

<210> 9

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tctacagtgc acgtgtctc 19

<210> 10

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ctcaactggt gtcgtg 16

<210> 11

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gcttcggcag cacatatact aaaat 25

<210> 12

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cgcttcacga atttgcgtgt cat 23

<210> 13

<211> 79

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

acauuaugaa gcaaguauua uuaucccugu uuuacaaaua aggaaauaaa cucagggagg 60

ugaaugugau caaagauag 79

<210> 14

<211> 23

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ucuacagugc acgugucucc agu 23

Claims (10)

1. Application of a reagent for detecting biomarkers in preparation of a product for early diagnosis of melanoma is characterized in that the biomarkers are miR-1321 and miR-139-5 p.

2. The use according to claim 1, wherein the agent is selected from the group consisting of:

a probe that specifically recognizes the biomarker; or

A primer that specifically amplifies the biomarker.

3. The use of claim 2, wherein the primers for specific amplification of the biomarkers miR-1321 and miR-139-5p have sequences shown in SEQ ID NO 7-SEQ ID NO 8 and SEQ ID NO 9-SEQ ID NO 10, respectively.

4. A product for early diagnosis of melanoma is characterized by comprising reagents for detecting biomarkers in a sample to be detected, wherein the biomarkers are miR-1321 and miR-139-5 p;

the product comprises a kit and a chip;

the kit comprises primers, probes or chips which are specifically combined with miR-1321 and miR-139-5 p;

the chip comprises a solid phase carrier and a probe which is attached to the solid phase carrier and specifically recognizes miR-1321 and miR-139-5 p.

5. The application of the biomarker in screening candidate drugs for preventing and/or treating melanoma is characterized in that the biomarker is miR-1321 and miR-139-5 p.

6. A method for screening a candidate drug for preventing and/or treating melanoma, comprising the steps of:

(1) treating a system expressing or containing miR-1321 and miR-139-5p by using a substance to be screened;

(2) detecting the expression levels of miR-1321 and miR-139-5p in the system;

(3) if the substance to be screened can reduce the expression level of miR-1321 and increase the expression level of miR-139-5p, the substance is a candidate drug for preventing and/or treating melanoma.

7. The application of the biomarker in the preparation of the medicine for treating melanoma is characterized in that the biomarker is miR-1321 and miR-139-5 p.

8. The use of claim 7, wherein the medicament comprises an inhibitor for reducing the expression level of miR-1321 and a promoter for increasing the expression level of miR-139-5 p.

9. The use of claim 8, wherein the inhibitor for reducing the expression level of miR-1321 has a sequence shown in SEQ ID NO 1;

the promoter for increasing the expression level of miR-139-5p has a sequence shown in SEQ ID NO 2-SEQ ID NO 3.

10. The drug for treating the melanoma is characterized by comprising an inhibitor for reducing the expression level of miR-1321 and an accelerant for increasing the expression level of miR-139-5 p;

the sequence of the inhibitor for reducing the expression level of miR-1321 is shown in SEQ ID NO 1;

the promoter for increasing the expression level of miR-139-5p has a sequence shown in SEQ ID NO 2-SEQ ID NO 3.

Images