CN115976203B - Application of HAP1 in preparation of products for diagnosing, preventing and/or treating gastric cancer - Google Patents

Abstract

The invention relates to the field of medical biotechnology, in particular to application of HAP1 in preparing a product for diagnosing, preventing and/or treating gastric cancer. By detecting the expression level of HAP1, gastric cancer can be diagnosed early, effective treatment means can be carried out early, and the death rate of patients can be reduced; the invention provides a medicine for preventing and/or treating gastric cancer by taking HAP1 as a target spot and a core, which is expected to become a new means of tumor targeted therapy.

Description

Application of HAP1 in preparation of products for diagnosing, preventing and/or treating gastric cancer

Technical Field

The invention relates to the field of medical biotechnology, in particular to application of HAP1 in preparing a product for diagnosing, preventing and/or treating gastric cancer.

Background

Gastric cancer is a common multi-factor and complex malignant tumor worldwide, the incidence rate of gastric cancer is ranked five in all malignant tumors, and meanwhile, the gastric cancer is the fourth leading cause of death, the gastric cancer is a high-incidence and high-death area of gastric cancer in China, the incidence rate of gastric cancer accounts for 47% of the total incidence rate of gastric cancer, and the incidence rate and the death rate of gastric cancer account for the second place of all cancers, thereby seriously threatening the health and life of people. The pathogenesis of gastric cancer involves multiple factors such as environment, heredity and the like, wherein some genes play a key role, and the research and discussion of the biological functions of the genes are helpful for providing effective and accurate diagnosis methods, treatment targets and the like for clinic, so that the early diagnosis and early treatment of gastric cancer are improved, and the survival of patients is prolonged.

Tumor suppressor genes (Tumor suppressor genes) are genes which can inhibit cell growth and proliferation, induce apoptosis, and have the potential to inhibit cancer. When it is inactivated, the synergic oncogenes result in malignant transformation of cells. The current common isolated tumor suppressor gene and its function: (1) cell signaling and epigenetic regulation, such as APC's involved in signal transduction, NFl catalyzes the inactivation of RNAs, and the like. (2) Cell cycle negative regulation, such as Rb, p53, CDKN2A genes, are involved in cell cycle regulation. (3) Negative control transcription factors, such as WT, DCC and the like. (4) Regulatory genes associated with development and stem cell proliferation, such as APC, axin, VHL, WTl. (5) DNA mismatch repair, such as MSH, MLH, etc.

Huntingtin-related protein 1 (huntingtin-associated protein 1, HAP 1) is a neuronal protein that is expressed primarily in the nervous system, HAP1 being essential for maintaining neuronal survival and for regulating food intake and weight in animals. In addition to the key role of HAP1 in the central nervous system, HAP1 expression is also found in the endocrine and digestive systems. The research between HAP1 and cancer is increasing, mainly involving breast cancer, pancreatic cancer, acute lymphoblastic leukemia, etc.

Immunohistochemical results showed that HAP1 was differentially expressed in different types of endocrine organs and mucosa of the gastrointestinal tract. HAP1 expression is primarily concentrated in the pylorus of the stomach, particularly the basal gland of the pylorus gland of the stomach. Gastric body expression was less and cardiac part contained almost no HAP1 positive cells. The HAP1 gene is low-expressed in stomach cancer tissues and high-expressed in stomach mucosa tissues beside the cancer. The difference in the specific expression of HAP1 in the stomach suggests that HAP1 is related to the biological properties and functions of the stomach.

At present, the molecular mechanism of HAP1 gene in gastric cancer is not completely clear, and the clinical significance of function and expression change is not reported. Therefore, analyzing the relationship between HAP1 gene and gastric cancer occurrence and development, it is important to explore gastric cancer diagnosis and targeted therapeutic strategies for HAP1 gene pathway.

Disclosure of Invention

The invention provides the application of HAP1 in preparing products for diagnosing, preventing and/or treating gastric cancer, and the expression level of HAP1 can be detected to diagnose gastric cancer at early stage, so that effective treatment means can be carried out early, and the death rate of patients can be reduced; provides a medicine taking HAP1 as a target and core for preventing and/or treating gastric cancer, is hopeful to become a new means of tumor targeted therapy, and solves the problems existing in the prior art.

One of the technical schemes adopted by the invention is as follows:

the application of HAP1 as a biomarker in preparing early diagnosis gastric cancer or prognosis prediction products of gastric cancer.

Further, the product is a detection reagent or a diagnostic drug targeting HAP 1.

Further, the detection reagent or diagnostic drug includes a primer that specifically amplifies HAP 1; the primer comprises an upstream primer shown as SEQ ID NO.1 and a downstream primer shown as SEQ ID NO.2.

Further, the detection reagent or diagnostic drug makes early diagnosis of gastric cancer or prognosis of gastric cancer by the varying levels of HAP1 expression.

Further, the detection sample corresponding to the HAP1 expression level is stomach cancer tissue or paracancerous tissue.

Further, the detection reagent or the diagnostic drug comprises a probe, an antibody or a nucleic acid chip.

Further, the detection reagent or diagnostic drug is used for RT-PCR or real-time quantitative PCR detection based on HAP 1.

Further, the detection method comprises the following steps: RNA was first extracted and cDNA was prepared by reverse transcription using β -actin as a control. Real-time quantitative PCR detection was performed using a real-time fluorescent quantitative PCR instrument (Applied BiosystemS, USA). The total reaction volume was 10. Mu.l: 1 microliter of cDNA template; 1 microliter of primer; 5 microliters of 2 xqpcr Master Mix;3 microliters of sterile, enzyme-free water. The reaction parameters were as follows: preheating for 5 minutes at 95 ℃; the 40cycles were set as follows, 95℃for 15 seconds; 60 ℃ for 1 minute; finally, dissolution curve analysis and expression analysis are carried out.

The second technical scheme adopted by the invention is as follows:

use of HAP1 in the manufacture of a product for the prevention and/or treatment of gastric cancer.

Further, the product is a pharmaceutically acceptable medicament in any one of dosage forms, which is obtained by taking HAP1 as a target point.

Further, the dosage form of the medicine is powder, injection, capsule, tablet or oral liquid.

Further, the medicine comprises an expression vector which is constructed by the cancer suppressor gene HAP1 and the pLVX-Puro vector.

Further, the preparation method of the expression vector comprises the following operation steps:

(1) Obtaining cDNA: the open reading frame of the full-length HAP1 gene is obtained from total RNA of normal stomach tissues by adopting an RT-PCR method, then amplification is carried out, a forward primer HAP1-cF used for amplification is shown as SEQ ID NO.3, and a reverse primer HAP1-cR used for amplification is shown as SEQ ID NO. 4;

(2) Connecting the cDNA to a pLVX-Puro vector, transforming competent bacteria, culturing in an ampicillin-containing LB plate, selecting positive clone for culturing, and selecting correct clone by sequencing;

(3) Construction of an expression vector for the tumor suppressor Gene HAP1

Extracting correctly cloned plasmid, cutting with restriction enzymes XhoI and EcoRI, separating by 1% agarose gel electrophoresis, recovering target fragment, connecting into linearized pLVX-Puro vector, transforming competent bacteria, culturing in LB plate containing ampicillin, selecting positive clone for culturing, cutting and sequencing, identifying, preserving correct clone, extracting plasmid.

The third technical scheme adopted by the invention is as follows:

an expression vector for preventing or treating gastric cancer is prepared from HAP1 and pLVX-Puro.

The invention has the beneficial effects that:

the invention provides a new means and a method for targeting treatment of gastric cancer by researching the expression conditions of HAP1 protein and HAP1 gene in gastric cancer tissues and tissues beside the gastric cancer and specifically recovering the expression of the cancer suppressor gene in gastric cancer tissue cells on the basis of screening tumors with low expression of the HAP1 gene. The primer for specifically amplifying HAP1 is used as a reagent and a diagnostic drug, provides a diagnostic basis and an effective treatment means in the targeting treatment of gastric cancer, and provides a more timely clinical strategy for reducing the death rate of gastric cancer patients.

Drawings

FIG. 1 is a graph showing the detection of HAP1 expression levels in normal gastric mucosal tissue and gastric cancer tissue;

FIG. 2 shows the expression levels of HAP1 in gastric mucosal epithelial cells GES-1 and various gastric cancer cell lines;

FIG. 3 shows the effect of HAP1 on the proliferation function of gastric cancer cells;

FIG. 4 is a graph showing the effect of HAP1 on gastric cancer cell migration and invasion function;

FIG. 5 is the effect of HAP1 on apoptosis of gastric cancer cells;

wherein, a in FIG. 1 is the immunohistochemical detection of HAP1 expression levels in gastric cancer tissue and normal paracancerous tissue of clinical gastric cancer patients; in the figure 1, b is Western blot for detecting the expression level of HAP1 protein in normal gastric mucosa tissue and gastric cancer tissue; FIG. 1 c shows the RT-qPCR detection of the mRNA expression level of HAP1 in normal gastric mucosal and gastric cancer tissues;

FIG. 2a shows the protein expression level of HAP1 in Western blot detection of GES-1 and various gastric cancer cell lines; FIG. 2 b shows the RT-qPCR detection of mRNA expression levels of HAP1 in GES-1 and various gastric cancer cell lines; FIG. 2 c shows the protein levels of HAP1 in Western Blot detection of HAP1 overexpressing gastric cancer cell lines MKN-28 and AGS; FIG. 2 d shows the RT-qPCR detection of the mRNA expression levels of HAP1 in the HAP1 overexpressing gastric cancer cell line MKN-28 and AGS;

FIG. 3 a is a cell count experiment to examine the effect of over-expressed HAP1 on the proliferation function of MKN28 and AGS gastric cancer cell lines; FIG. 3 b is a graph showing the effect of the EdU assay on the proliferation function of the MKN28 and AGS gastric cancer cell lines when HAP1 is overexpressed; FIG. 3 c is a graph showing the effect of colony formation experiments to examine the tumorigenic potential of overexpressing HAP1 on MKN28 and AGS gastric cancer cell lines;

FIG. 4 a is a graph showing the effect of scratch assay on cell migration of MKN28 and AGS gastric cancer cell lines by over-expression of HAP 1; FIG. 4 b shows the effect of Transwell experiments to examine the invasive potential of overexpressing HAP1 on MKN28 and AGS gastric cancer cell lines; FIG. 4 c shows the Western blot detection of the expression levels of Epithelial-mesenchymal transition (EMT) -related marker proteins;

fig. 5 a shows the difference in apoptosis of MKN28, a gastric cancer cell that overexpresses HAP1 when glucose starved, was observed under a microscope; FIG. 5 b shows the effect of over-expression of HAP1 on apoptosis of gastric cancer cell lines MKN28 and AGS when glucose starvation was detected by Annexin V-FITC/PI staining flow cytometry; FIG. 5 c shows the effect of over-expression of HAP1 on the expression level of apoptosis-related signaling pathway proteins in gastric cancer cells MKN28 and AGS when glucose starvation was detected by Western blot.

Detailed Description

In order to clearly illustrate the technical features of the present solution, the present invention will be described in detail below with reference to the accompanying drawings.

The research of the inventor finds that the HAP1 protein and the HAP1 gene are low-expressed in gastric cancer tissues and high-expressed in gastric mucosa tissues beside the cancer, and the HAP1 protein and the HAP1 gene have the functions of inhibiting the growth of gastric cancer cells and prolonging the survival time of patients, so that the method specifically recovers the expression of the cancer suppressor gene in gastric cancer tissue cells on the basis of screening tumors with low expression of the HAP1 gene and is hopeful to become a new method and means for targeting treatment of gastric cancer.

The HAP1 protein sequence is as follows:

Met Arg Pro Lys Arg Leu Gly Arg CysCys Ala Gly Ser Arg Leu Gly Pro Gly Asp Pro Ala Ala Leu ThrCys Ala Pro Ser Pro Ser Ala Ser Pro Ala Pro Glu Pro Ser Ala Gln Pro Gln Ala Arg GlyThrGly Gln Arg Val Gly Ser Arg Ala Thr Ser Gly Ser Gln Phe Leu Ser Glu Ala Arg ThrGly Ala Arg Pro Ala Ser Glu Ala Gly Ala Lys Ala Gly Ala Arg Arg Pro Ser Ala Phe Ser Ala Ile Gln Gly Asp Val Arg Ser Met Pro Asp Asn Ser Asp Ala Pro TrpThr Arg Phe Val Phe Gln Gly Pro PheGly Ser Arg Ala ThrGly Arg GlyThrGly Lys Ala AlaGly Ile Trp Lys Thr Pro Ala Ala Tyr Val Gly Arg Arg Pro Gly Val Ser Gly Pro Glu Arg Ala AlaPhe Ile Arg Glu Leu Glu Glu Ala Leu Cys Pro Asn Leu Pro ProPro Val Lys Lys Ile Thr Gln Glu Asp Val Lys Val Met Leu Tyr Leu Leu Glu Glu Leu Leu Pro Pro Val Trp Glu Ser Val Thr Tyr GlyMet Val Leu Gln Arg Glu Arg Asp Leu AsnThr Ala Ala Arg Ile Gly Gln Ser Leu Val Lys Gln Asn Ser Val Leu Met Glu GluAsn Ser Lys Leu Glu Ala Leu LeuGly Ser Ala Lys Glu Glu Ile Leu Tyr Leu Arg His Gln Val Asn Leu Arg Asp Glu Leu Leu Gln Leu Tyr Ser Asp Ser Asp Glu Glu Asp Glu Asp Glu GluGluGluGluGluGlu Lys Glu Ala Glu GluGlu Gln Glu Glu GluGlu Ala Glu Glu Asp Leu Gln Cys Ala His Pro Cys Asp Ala Pro Lys Leu Ile Ser Gln Glu Ala Leu Leu His Gln His HisCys Pro Gln Leu Glu Ala Leu Gln Glu Lys Leu Arg Leu Leu Glu GluGluAsn His Gln Leu Arg Glu Glu Ala Ser Gln Leu Asp Thr Leu Glu Asp Glu Glu Gln Met Leu Ile Leu Glu Cys Val Glu Gln Phe Ser Glu Ala Ser Gln GlnMet Ala Glu Leu Ser Glu Val Leu Val Leu Arg Leu Glu Asn Tyr Glu Arg Gln Gln Gln Glu Val Ala Arg Leu Gln Ala Gln Val Leu Lys Leu Gln Gln Arg Cys Arg Met Tyr Gly Ala Glu Thr Glu Lys Leu Gln Lys Gln Leu Ala Ser Glu Lys Glu Ile Gln Met Gln Leu Gln Glu GluGluThr Leu Pro GlyPhe Gln Glu Thr Leu Ala Glu Glu Leu Arg Thr Ser Leu Arg ArgMet Ile Ser Asp Pro Val Tyr PheMet Glu Arg Asn Tyr Glu Met Pro Arg Gly Asp Thr Ser Ser Leu Arg Tyr Asp Phe Arg Tyr Ser Glu Asp Arg Glu Gln Val Arg GlyPhe Glu Ala Glu GluGly Leu Met Leu Ala Ala Asp Ile Met Arg Gly Glu Asp PheThr Pro Ala Glu GluPhe Val Pro Gln Glu Glu Leu Gly Ala Ala Lys Lys Val Pro Ala Glu GluGly Val Met Glu Glu Ala Glu Leu Val Ser Glu GluThr Glu GlyTrp Glu Glu Val Glu Leu Glu Leu Asp Glu Ala Thr Arg MetAsn Val ValThr Ser Ala Leu Glu Ala Ser Gly Leu Gly Pro Ser His Leu Asp MetAsn Tyr Val Leu Gln Gln Leu Ala AsnTrp Gln Asp Ala His Tyr Arg Arg Gln Leu Arg Trp Lys Met Leu Gln Lys Gly Glu Cys Pro His Gly Ala Leu Pro Ala Ala Ser Arg Thr Ser Cys Arg Ser SerCys Arg

the HAP1 gene sequence is as follows:

ATGCGCCCGA AGAGGTTGGG CCGGTGCTGC GCGGGGAGCC GGCTCGGACC CGGGGACCCA GCAGCACTCA CCTGTGCACC TTCGCCCTCA GCCAGTCCCG CTCCGGAGCC CTCTGCGCAG CCGCAGGCAC GGGGCACTGG ACAGAGAGTA GGATCCCGAG CCACCTCTGG ATCCCAGTTC CTCTCGGAAG CCCGCACCGG AGCTCGCCCG GCCTCGGAGG CTGGAGCCAA GGCAGGAGCC CGGCGCCCGT CCGCATTCTC GGCCATCCAA GGGGATGTCC GGTCTATGCC CGACAATTCG GACGCGCCGT GGACCCGCTT CGTATTCCAA GGGCCGTTTG GTTCCCGGGC CACTGGCCGG GGGACTGGAA AGGCAGCGGG CATCTGGAAG ACGCCAGCCG CCTACGTTGG CCGGCGACCC GGGGTGTCCG GCCCTGAGCG CGCCGCCTTT ATTCGGGAGC TGGAGGAAGC ACTGTGTCCT AACCTACCTC CGCCAGTCAA AAAGATCACC CAGGAAGACG TCAAAGTGAT GTTATATTTG CTGGAGGAGC TTCTCCCACC TGTCTGGGAG AGCGTTACCT ATGGGATGGT CCTGCAGAGA GAGAGGGACC TGAACACTGC AGCTCGCATC GGCCAGTCCC TGGTGAAACA GAACAGTGTT TTGATGGAGG AGAACAGCAA GCTGGAAGCC CTGCTGGGCT CAGCCAAGGA GGAGATTTTA TACCTCAGAC ACCAGGTGAA CTTGCGGGAT GAGCTCCTCC AGCTCTACTC AGATTCTGAT GAGGAGGATG AGGATGAAGA AGAGGAGGAG GAAGAAAAGG AGGCAGAAGA GGAACAGGAA GAAGAAGAAG CAGAGGAAGA CCTGCAGTGT GCTCATCCCT GTGATGCCCC TAAGCTGATT TCGCAGGAGG CATTGCTGCA CCAGCACCAC TGCCCACAGC TGGAAGCCTT GCAGGAGAAG CTGAGGCTGC TGGAGGAGGA GAATCATCAG CTGAGAGAAG AGGCCTCTCA ACTCGACACT CTTGAGGATG AGGAACAGAT GCTCATTCTG GAGTGTGTGG AGCAGTTTTC GGAGGCCAGC CAACAGATGG CTGAGCTGTC GGAGGTGCTG GTGCTCAGGC TGGAAAACTA TGAACGGCAG CAGCAGGAGG TCGCTCGGCT GCAGGCCCAG GTGCTGAAGC TGCAGCAGCG CTGCCGGATG TATGGGGCTG AGACTGAAAA GTTGCAGAAG CAGCTGGCTT CGGAGAAGGA AATCCAGATG CAGCTCCAGG AAGAGGAGAC TCTTCCTGGT TTCCAGGAGA CGCTGGCTGA GGAGCTCAGA ACGTCTCTAA GGAGGATGAT CTCAGACCCT GTGTATTTTA TGGAGAGGAA TTATGAGATG CCCAGAGGGG ACACATCCAG CCTAAGGTAT GATTTTCGCT ACAGTGAGGA TCGAGAGCAG GTGCGGGGGT TTGAGGCTGA GGAAGGGTTG ATGCTGGCAG CGGATATCAT GCGGGGGGAA GATTTCACGC CTGCGGAGGA GTTCGTGCCC CAGGAGGAGC TGGGGGCTGC CAAGAAGGTG CCGGCTGAGG AAGGGGTGAT GGAAGAGGCA GAGCTGGTGT CAGAGGAGAC CGAGGGCTGG GAGGAGGTGG AACTGGAGCT GGATGAGGCA ACGCGGATGA ACGTGGTGAC ATCAGCCCTGGAGGCCAGCG GCTTGGGCCC TTCACACCTG GACATGAATT ATGTCCTCCA GCAGCTGGCC AACTGGCAAG ATGCCCATTA CAGGCGGCAG CTGAGGTGGA AGATGCTCCA GAAAGGTGAG TGCCCCCACG GGGCCCTCCC TGCCGCCAGC CGGACAAGCTGCAGATCGTC GTGCCGATGA。

EXAMPLE 1 analysis of HAP1 expression levels in normal gastric mucosal tissue and gastric cancer tissue

1. Experimental method

1.1 immunohistochemical detection of HAP1 expression level in gastric cancer tissue and normal paracancerous tissue of clinical gastric cancer patient (1) specimen fixation: 4% paraformaldehyde is selected as a fixing agent, uniformly covered on a glass slide and dried;

(2) Dehydration, paraffin embedding and tabletting: fully dehydrating the tissue by using gradient ethanol (from low to high 50%,70%,80% and 100%), and then carrying out complete wax dipping treatment on the tissue to prepare paraffin sections;

(3) Dewaxing and hydrating paraffin sections: dewaxing at 60deg.C for 20 min, immediately treating with xylene I, II, III for 10 min, respectively, and hydrating with gradient ethanol (from high to low 100%,80%,70%, 50%);

(4) Antigen retrieval: immersing the slices into sodium citrate antigen restoration liquid, heating the slices by using a microwave oven for 6 minutes after the slices are completely soaked, repeating the heating for 4 times, and naturally cooling the slices for about 30 minutes after restoration to ensure that the temperature is about to be room temperature; (5) pass through: 200 mu L of 0.3% Triton-X-100 is added dropwise, the mixture is kept stand at room temperature for 10 minutes, then the permeation solution is dried, 200 mu L of PBS is added dropwise for washing for 3 minutes, and the washing is repeated for 3 times;

(6) Closing: 200. Mu.L of 5% BSA was added dropwise thereto, and the mixture was allowed to stand at room temperature for 30 minutes;

(7) Incubation resistance: the blocking solution was spun dry and washed with PBS solution according to 1:250 preparing HAP1 primary antibody working solution, dripping 200 mu L, placing a slide in a refrigerator for incubation overnight, and setting the temperature to be 4 ℃ generally;

(8) Anti-wash: taking out the slide, balancing at room temperature for 10 minutes, placing the slide into a dyeing rack containing PBS, washing the slide for 5 minutes by a shaking table at 100rpm, and repeating the washing for 5 times;

(9) Secondary antibody incubation: the PBS solution was used according to 1:1000 preparing a secondary antibody working solution, dropwise adding 200 mu L, and incubating for 30 minutes at room temperature;

(10) And (3) secondary antibody washing: taking out the slide, balancing at room temperature for 10 minutes, placing the slide into a dyeing rack containing PBS, washing the slide for 5 minutes by a shaking table at 100rpm, and repeating the washing for 5 times;

(11) Developing DAB;

(12) Hematoxylin staining for 10 min after PBS rinsing; hydrochloric acid is differentiated for 5 seconds, and ammonia water returns to blue for 5 seconds; eosin staining for 10 seconds, and washing with distilled water is required between the steps;

(13) Dehydrating: repeating for 2 times, treating with 50%,70%,80%,100% ethanol for 5 min and xylene for 10 min from low to high gradient;

(14) Sealing and photographing.

1.2Western blot detection of HAP1 protein expression level in primary gastric cancer specimens and adjacent normal tissue specimens

1.2.1 extraction of cellular proteins

(1) Grinding and cracking a human primary gastric cancer specimen and a neighboring normal tissue specimen, collecting cells, and then placing the cells on ice;

(2) The cells are crushed by ultrasound, and the ultrasound is carried out for 10 times for 1 second each time, wherein the ultrasound intensity is 30 percent and the frequency is 25 kHz;

(3) Centrifugation at 13,500rpm at 4℃for 10 min, transferring the supernatant from centrifugation to a fresh EP tube and placing on ice;

(4) Measurement of protein concentration by G250 method:

a protein standard curve was prepared using BSA (bovine serum albumin, 0.5. Mu.g/. Mu.L). The volumes shown in the following table were added to 5 EP tubes, respectively, to prepare five protein concentrations of 0, 0.05, 0.1, 0.15, 0.2. Mu.g/. Mu.L (see Table 1 below).

TABLE 1

Adding 1mL of G250 dye liquor, reversing and uniformly mixing, adding 200 mu L of dye liquor into a 96-well plate according to each well, and setting 4 repeats; measuring the absorbance value of the sample at an absorption wavelength of 595 nm; diluting a sample to be measured for 50 times, adding 1mL of G250 dye liquor, reversing and uniformly mixing, adding 200 mu L of the dye liquor into a 96-well plate per hole, setting 4 repetitions, and calculating the concentration of the sample according to a standard curve formula;

(5) Diluting all samples to the same protein concentration by using fresh cell lysate, and adding a corresponding volume of 5 XSDS protein loading buffer according to the total volume of the samples to finally dilute the samples to 1 XSDS;

(6) Boiling the protein at the temperature of 100 ℃ in a metal bath for 10 minutes; preserving at-20 ℃ for standby.

1.2.2 Western blotting

(1) Preparing SDS-PAGE gel (the concentration of the upper gel is 4% and the concentration of the lower gel is 10%);

(2) Loading 30-40 μg of extracted protein per well, transferring the protein on the gel to PVDF membrane activated by methanol after electrophoresis (Roche, 3010040001);

(3) 5% skim milk was blocked for 1 hour and diluted 1 time with TBST buffer;

(4) Incubating the PVDF membrane with the primary antibody on a shaker at 4 ℃ overnight;

(5) Rinsing with TBST buffer solution for 3 times every 5 minutes;

(6) Adding horseradish peroxidase-labeled secondary antibody (Beyotidme) in a proper proportion, and incubating for 1 hour on a shaking table;

(7) Rinsing with TBST buffer solution for 3 times every 5 minutes;

(8) ECL-enhanced chemiluminescent reagent (Bio-rad, 1705061) exposure was used.

1.3RT-qPCR detection of mRNA expression level of HAP1 in clinical gastric cancer tissue and adjacent Normal tissue specimens

1.3.1RNA extraction and detection of RNA concentration and purity

(1) Extracting total RNA of a gastric cancer specimen and a neighboring normal tissue specimen by using RNAiso Plus (Takara, 9109);

(2) The quality and concentration of the extracted RNA were determined using a Nanodrop ultra-micro spectrophotometer (Thermo Scientific, ND-1000);

1.3.2mRNA reverse transcription and real-time fluorescent quantitative PCR

(1) Reverse transcription PCR (10. Mu.L system)

Step (1) (60 ℃ C., 5 minutes):

TABLE 2 reverse transcription PCR (1) step reaction

Step (2) (42 ℃, 60 minutes; 70 ℃,10 minutes):

TABLE 3 reverse transcription PCR (2) step reaction

(2) Real-time fluorescent quantitative PCR (10 μl system):

pre-denaturation: 95 ℃ for 10 minutes; denaturation: 95 ℃ for 15 seconds; annealing/extension: 60 ℃ and 60 seconds (40 cycles) Table 4 real-time fluorescent quantitative PCR reaction

Primer sequence:

the inventor designs and synthesizes 3 pairs of RT-qPCR primers for amplifying HAP1, and verifies the specificity of the 3 pairs of primers through experiments. Detecting whether the PCR product has single strip and correct size through DNA gel electrophoresis after common PCR amplification; and (3) amplifying by an RT-qPCR experiment, respectively observing an amplification curve and a dissolution curve, and detecting the amplification efficiency. Finally, the optimal RT-qPCR primers for specific amplification of HAP1, i.e.the upstream primer SEQ ID NO.1 and the downstream primer SEQ ID NO.2 as shown below, were screened by comparison.

HAP1：

Forward：GGCCTCTCAACTCGACACTC(SEQ ID NO.1)

Reverse：GCTGCCGTTCATAGTTTTCCAG(SEQ ID NO.2)

β-actin：

Forward：CTGGAACGGTGAAGGTGACA(SEQ ID NO.5)

Reverse：AAGGGACTTCCTGTAACAATGCA(SEQ ID NO.6)

2. Analysis of results

As shown in the results of fig. 1 a, the HAP1 expression level of gastric cancer tissue is significantly reduced compared with that of normal paracancerous tissue, and the difference is statistically significant; as shown in the b result of fig. 1, the HAP1 protein level in gastric cancer tissue is significantly reduced compared with that in the adjacent normal stomach tissue; as shown in the results of FIG. 1 c, the mRNA expression level of HAP1 in gastric cancer tissues was also down-regulated.

EXAMPLE 2 analysis of expression levels of HAP1 in gastric mucosal epithelial cells GES-1 and various gastric cancer cells

1. Experimental method

1.1 detection of HAP1 protein expression level in gastric mucosal epithelial cells GES-1 and multiple gastric cancer cells by Western blot

See section 1.2-1.3 of example 1 for specific procedures.

2. Analysis of results

Further validating the results of example 2 above, the inventors evaluated HAP1 expression in vitro using a series of gastric cancer cell lines and gastric mucosal epithelial cells GES-1. Compared to GES-1, the western blot results show that the protein expression level of HAP1 was down-regulated in all gastric cancer cell lines compared to gastric mucosal epithelial cells GES-1 as shown in FIG. 2a, and that the mRNA expression level of HAP1 was also down-regulated in these gastric cancer cell lines as shown in FIG. 2 b.

EXAMPLE 3 cloning of HAP1 Gene and construction of expression vector

1. Experimental method

1.1HAP1 overexpression sequence amplification

HAP1 amplification primer sequence:

HAP1-F：CCGCTCGAGCGGAGATGCGCCCGAAGAGGTT(SEQ ID NO.3)

HAP1-R: CCGGAATTCCGGTCATCGGCACGACGATCTG (SEQ ID NO. 4) PCR amplification system is as shown in Table 5 (total volume: 50. Mu.L):

TABLE 5 PCR amplification System

1.2. Cleavage of lentiviral Gene overexpression vector pLV-Puro

The cleavage reaction system of lentiviral gene overexpression vector pLV-Puro is shown in Table 6 (37℃water bath; 3 hours):

TABLE 6 cleavage reaction of expression vector pLV-Puro

1.3 nucleic acid electrophoresis and recovery of the enzyme section

(1) 1% (M/V) agarose gel is prepared, and a newly prepared TAE electrophoresis buffer solution is required to be used in the electrophoresis process so as to ensure the electrophoresis and recovery effects. Electrophoresis is carried out on the PCR product or the double enzyme digestion product obtained in the step 2, required DNA fragment gel is cut under an ultraviolet gel cutting instrument after electrophoresis is finished, and the gel is collected and transferred into a 1.5mL EP tube;

(2) Recovery was performed using agarose gel DNA recovery kit. Adding equal amount of PN solution into an EP pipe containing the gel block, and carrying out water bath at 50 ℃ to gently overturn the EP pipe for many times when the EP pipe is in water bath so as to enable the gel block to reach a fully dissolved state (if the gel block is oversized, the gel block can be treated into fragments in advance);

(3) Placing a new adsorption column CA2 into a corresponding collecting pipe, adding the solution obtained in the step (2) into the adsorption column, standing for 2 minutes at room temperature, centrifuging at 12,000rpm for 1 minute, and pouring waste liquid (the adsorption column CA2 needs to be subjected to a column balancing step in advance);

(4) 600. Mu.L of the rinse solution (with absolute ethanol added) was added to the center of the column, and the column was centrifuged at 12,000rpm for 1 minute;

(5) Repeating step (4);

(6) Putting the adsorption column back to idle, centrifuging at 12,000rpm for 2 min to thoroughly remove the rinsing liquid, uncovering and standing for several min, and air drying;

(7) Placing a new EP tube below the adsorption column, adding an elution buffer solution into the center of the adsorption column, and standing at room temperature for 2-3 minutes; centrifuging at 12,000rpm to obtain a DNA solution;

(8) The concentration and purity of the recovered DNA fragment were measured by an ultraviolet spectrophotometer.

Construction of 1.4HAP1 expression vector

The target fragment DNA recovered after 1% agarose gel electrophoresis was ligated into linearized pLV-Puro, and the ligation reaction was performed overnight at room temperature as shown in Table 7.

TABLE 7 ligation of recombinant plasmids

1.5 Transformation of DNA and plasmid construction

(1) Taking out the packaged competent cells (100. Mu.L/EP tube) from the ultra-low temperature refrigerator, and dissolving on ice;

(2) Mixing competent cell suspension with 20 mu L of DNA ligation product in an EP tube, gently and fully homogenizing the system, and standing on ice for 30 min;

(3) Placing the EP pipe into a water bath at 42 ℃, carrying out heat shock for 45 seconds, taking out the EP pipe, and cooling on ice for 2-3 minutes;

(4) Uniformly coating the bacterial liquid on an LB solid medium containing ampicillin, after the bacterial liquid is completely absorbed, inversely placing the bacterial liquid into a bacterial incubator, and culturing at room temperature for 14-16 hours to obtain a monoclonal bacterial colony;

(5) The monoclonal bacteria are selected for culture, plasmids are extracted by using a kit, target fragments are amplified by a PCR method, and DNA gel electrophoresis is used for identification.

2. Analysis of results

As shown in the electrophoresis result of FIG. 3, the amplified fragment is about 1860bp, and is HAP1 positive clone, and the construction of the expression vector of the HAP1 gene is successful.

EXAMPLE 4 establishment of HAP1 over-expressed stable gastric cancer cell lines

1. Experimental method

1.1 lentiviral packaging

Lentiviral packaging was performed in HEK-293T cells (cell density around 90% required).

(1) Adding Lipofectamine-2000 transfection reagent into 150 mu L of serum-free culture solution, and standing for 5 minutes;

(2) Packaging plasmid pAX ₂ pMD2.G at 3:1 and 1.5g of core plasmid are added into 150 mu L of serum-free culture solution together; adding the (2) into a corresponding (1) pipe, and standing at room temperature for 20 minutes;

(3) The transfection mixture was added to the cell culture solution of a 35mm cell culture dish and mixed well. After 6-8 hours, change to 2mL fresh DMEM complete medium (10% fbs);

(4) After 36-48 hours, virus was collected, centrifuged at 8000g for 5 minutes, the whole supernatant was collected, filtered through a 0.45 μm filter membrane and the virus supernatant was transferred to a new collection tube for storage at-20 ℃.

1.2 cell transfection

The virus supernatant obtained by lentiviral packaging was infected with gastric cancer cell lines MKN28 and AGS (cell seeding density was generally controlled to be around 50%). The amount of virus to be added was determined based on the virus titer, while 10. Mu.g/L polybrene (1:1000 dilution) was added to accelerate the virus entry into the cells by charge. After 12 hours, the liquid change treatment can be carried out, and after 24-48 hours, the virus can be expressed in cells.

1.3 puromycin selection of stable cell lines

Cells were propagated in a cell culture medium containing puromycin to screen cell lines for stable over-expression plasmids.

(1) 48 hours after lentivirus infection of the cells, the cell culture medium was replaced with fresh medium containing puromycin (1 g/mL) by liquid exchange or digestion re-plating depending on the actual state of the cells;

(2) Every 2-3 days, the cells are passaged or changed, and fresh culture medium with proper concentration of puromycin is still required to be continuously supplemented;

(3) After 7 days of screening, HAP1 gene overexpression was verified by Western Blot and RT-qPCR.

2. Analysis of results

As shown in fig. 2 c, the protein level of HAP1 was significantly up-regulated in the experimental group in which Western Blot detected overexpression of HAP1 in gastric cancer cell lines MKN28 and AGS compared to the negative control group of empty PLV; as shown in fig. 2 d, the mRNA expression level of HAP1 was detected by real-time fluorescent quantitative PCR, and the mRNA expression level of HAP1 was significantly up-regulated in the experimental group overexpressing HAP1 in gastric cancer cell lines MKN28 and AGS compared to the negative control group of empty PLV, and the difference was statistically significant.

EXAMPLE 5HAP1 inhibiting proliferation function of gastric cancer cells

1. Experimental method

1.1 cell count assay

(1) By means ofBioTech Automated Cell Counter cell counterLine cell count, 1X 10 ⁵ A gastric cancer cell;

(2) Will be 1X 10 ⁵ The gastric cancer cells were cultured in RPMI 1640 medium containing 10% FBS, in 35mm cell culture dishes, and in humidified 5% CO at 37deg.C ₂ An incubator;

(3) Used in the designed timeBioTech Automated Cell Counter gastric cancer cells were counted and 3 replicates were performed.

1.2EdU assay to detect proliferation of gastric cancer cells overexpressing HAP1

(1) To achieve the concentration required for further experiments, edU (Beyotime, C0071S) was dissolved in dimethylsulfoxide (DMSO, sigma), stock concentration was 50mg/mL, then diluted in PBS;

(2) EdU was added to the cell culture dish 12 hours prior to harvest;

(3) After 12 hours, 100 μl of 4% formaldehyde was added to the gastric cancer cells, and after fixation for 15 minutes, the cells were rinsed twice with PBS. Then treated with PBS containing Tris buffered saline and 0.1% Triton X-100 for 15 min, then washed twice with PBS;

(4) Add 200. Mu.L of RiboBio staining solution to complete EdU-click reaction (30 minutes at room temperature protected from light), then rinse the cells with PBS, and re-suspend the cells with 500. Mu.L of PBS;

(5) Detection of EdU positive cells by flow cytometry, analysis was performed using FlowJo software.

2. Analysis of results

As the results in fig. 3 a show, cell count experiments were performed on MKN28 and AGS cell lines at different times, and it was found that overexpression of HAP1 significantly retarded the rate of cell proliferation; as shown by the b EdU experimental test results in fig. 3, MKN28 and AGS cell lines significantly delayed cell proliferation after over-expression of HAP 1.

EXAMPLE 6 clonogenic potential of HAP1 to inhibit gastric cancer cells

1. Experimental method

1.1 Cluster formation assay for determining the tumorigenicity of HAP 1-overexpressing gastric cancer cells

(1) Will be 2X 10 ³ Placing gastric cancer cells in a 60mm cell culture dish;

(2) A60 mm cell culture dish was placed in a 5% CO solution ₂ Is arranged in a humidifying incubator;

(3) After 1-2 weeks of cell growth, wash 2 times with PBS at room temperature;

(4) Cells were fixed in 4% paraformaldehyde and stained with 0.01% crystal violet solution for 15 minutes. The number of gastric cancer cell colonies was calculated using Image J software and survival frequency was statistically analyzed. Each set was set with 3 replicates.

2. Analysis of results

As shown in fig. 3 c, tumor cell clonogenic potential was significantly reduced after over-expression of HAP1 in MKN28 and AGS cells, indicating that HAP1 has clonogenic potential to inhibit gastric cancer cells.

EXAMPLE 7HAP1 inhibiting gastric cancer cell migration and invasion function

1. Experimental method

1.1 scratch test to detect the Effect of HAP1 on the migration function of gastric cancer cells

(1) The cells are planted in a cell culture dish with the thickness of 60mm, and when the density of the cultured cells reaches about 90%;

(2) Gently streaking a straight line in the dish with a 200 μl gun head;

(3) After washing off the suspension cells three times with PBS, the suspension cells are placed in a complete RPMI 1640 medium containing 10% FBS for incubation;

(4) The scratched wounds were photographed at 0 and 48 hours, respectively.

1.2 Transwell experiments to detect the influence of HAP1 on the invasion function of gastric cancer cells

(1) transwell experiments were performed in a transwell chamber (8 μm pore size), gastric cancer cells were serum starved for 24 hours;

(2) Cells were suspended in serum-free medium, 200. Mu.L was placed in the upper layer of the cell chamber (about 2X 10 per well ⁵ Individual cells); the lower chamber is a culture medium containing 10% serum;

(3) After 48 hours incubation in the cell incubator, non-invasive cells were removed from the upper surface of the transwell chamber with a cotton swab;

(4) After fixing the invading cells with 4% formaldehyde for about 10 minutes, staining with 0.05% crystal violet for 5-10 minutes at room temperature;

(5) Positive gastric cancer cells were counted in 5 random microscopic fields with 3 replicates per group.

1.3Western blot detection of the level of expression of the marker protein of Epithelial-mesenchymal transition (EMT) in MKN28 and AGS gastric cancer cells after gastric overexpression of HAP1

For specific experimental procedure see section 1.2.1-1.2.2 of example 1.

2. Analysis of results

As the results in fig. 4 a show, scratch experiments with MKN28 and AGS cells indicate that overexpression of HAP1 can inhibit cell migration; as shown in fig. 4 b, transwell experiments showed that MKN28 and AGS cells had significantly down-regulated invasive capacity when HAP1 was overexpressed; as shown in FIG. 4 c, western blot was performed to detect an Epithelial-mesenchymal transition (EMT) marker protein, and it was found that HAP1 overexpression strongly upregulated the protein level of E-cadherin, which was typically downregulated in gastric cancer cells, without significant changes in N-cadherin expression. Meanwhile, one of the EMT markers, vinetin, was down-regulated in MKN28 and AGS cells over-expressed by HAP 1. In conclusion, HAP1 inhibits the migration and invasive ability of gastric cancer cells.

Example 8HAP1 promotes apoptosis of gastric cancer cells

1. Experimental method

1.1 microscopic observations of the Effect of over-expressed HAP1 on apoptosis

(1) Taking a gastric cancer cell line MKN28 which over-expresses empty-load PLV as a negative control group, and taking a gastric cancer cell line MKN28 which over-expresses HAP1 as an experimental group;

(2) Count cells and then press 4X 10 ⁵ Density plating per mL, glucose starvation treatment after cell attachment for 24 hours, i.e. change normal 1640 medium to equal amount of sugarless 1640 medium (containing 10% fbs);

(3) Cell status was observed after starvation for 0 and 24 hours, respectively, and the status of apoptosis was recorded by microscopic photographing.

1.2 flow cytometry to detect apoptosis

(1) After culturing the overexpressed empty PLV and the overexpressed MKN28 of HAP1 in a sugarless medium for 24 hours, the cell culture supernatant was collected and added to a flow cell tube of 12X 75mm specification;

(2) Digesting the cells with EDTA-free pancreatin, and after complete medium termination of digestion, adding all cells and liquid to the flow tube;

(3) Rinsing the bottom of the cell culture dish again with precooled PBS, adding the cell culture dish into the flow tube, centrifuging at 2000rpm for 5 minutes, and reserving sediment;

(4) Adding 1mL of precooled PBS into each sample for resuspension, washing for 2 times, and centrifuging to obtain cells;

(5) Adding 1 Xapoptosis buffer to the cell pellet to resuspend the cells, 100. Mu.L of each sample;

(6) Then adding 5 mu L of PI dye solution, uniformly mixing and then incubating for 15 minutes in dark place;

(7) After incubation, 400 mu L of 1 Xapoptosis buffer solution is added, and after a few times of blowing and sucking, the mixture is filtered to a new flow tube through a 300-mesh nylon net;

(8) Selection of the appropriate channel apoptosis was detected using a BD FACS Aria II flow cytometer.

1.3Western blot detects apoptosis-related signal channel protein expression condition

For specific experimental procedure see section 1.2.1-1.2.2 of example 1.

2. Analysis of results

As shown in fig. 5 a, overexpression of HAP1 after 24 hours of glucose starvation promoted the death process of gastric cancer cells MKN28 and AGS, with more apparent apoptosis; as shown in fig. 5 b, annexin V-FITC/PI staining flow cytometry detection found that over-expression of HAP1 resulted in an increased proportion of MKN28 and AGS gastric cancer cell death, HAP1 promoted apoptosis; to explore the molecular mechanism by which HAP1 regulates cell death under energy deficit conditions, apoptosis-related signaling pathway proteins were examined, as shown in FIG. 5 c, with downregulation of pro-apoptotic factor Bcl-2, no significant change in Bax and Bcl-xl expression, and upregulation of clear Caspase-3 and Caspase-12 expression levels. In summary, HAP1 is involved in the apoptosis process and promotes apoptosis by regulating the expression of apoptosis-related proteins.

Conclusion: the expression of the gene HAP1 in gastric cancer tissues is reduced, and the expression level of the gene HAP1 is closely related to the prognosis survival time and the transfer probability of gastric cancer patients; by cloning cDNA of HAP1 and constructing an expression vector of HAP1 gene, the gene HAP1 can inhibit growth of gastric cancer cells, promote apoptosis and reduce migration and invasion capacity after being over-expressed in gastric cancer cells.

The above results indicate that: the HAP1 gene has a cancer-inhibiting function in gastric cancer. Detection of HAP1 gene expression can be used for diagnosis of gastric cancer. And the purpose of treating tumors can be achieved by recovering the cancer inhibiting function of the HAP1 gene. Therefore, the novel potential cancer suppressor gene HAP1 has certain application value in diagnosis, prevention and treatment of gastric cancer.

The above embodiments are not to be taken as limiting the scope of the invention, and any alternatives or modifications to the embodiments of the invention will be apparent to those skilled in the art and fall within the scope of the invention.

The present invention is not described in detail in the present application, and is well known to those skilled in the art.

Claims (6)

1. The application of the reagent for detecting the HAP1 expression quantity in the preparation of products for early diagnosis of gastric cancer is characterized in that the reagent comprises a primer for specifically amplifying HAP1, wherein the primer comprises an upstream primer shown as SEQ ID NO.1 and a downstream primer shown as SEQ ID NO.2.

2. Use of an agent that overexpresses HAP1 in the preparation of a product for the treatment of gastric cancer.

3. The use according to claim 2, wherein the product is a pharmaceutical in any pharmaceutically acceptable form targeted to HAP 1.

4. The use according to claim 3, wherein the medicament is in the form of a powder, injection, capsule, tablet or oral liquid.

5. The use according to claim 3, wherein the medicament comprises an expression vector constructed from the oncogene HAP1 and pLVX-Puro vectors.

6. The use according to claim 5, wherein the construction method of the expression vector comprises the following operation steps:

(1) Obtaining cDNA: the open reading frame of the full-length HAP1 gene is obtained from total RNA of normal stomach tissues by adopting an RT-PCR method, and then amplified; the forward primer HAP1-cF for amplification is shown as SEQ ID NO.3, and the reverse primer HAP1-cR for amplification is shown as SEQ ID NO. 4;

(2) Connecting DNA to pLVX-Puro vector, transforming competent bacteria, culturing in ampicillin-containing LB plate, selecting positive clone for culturing, and selecting correct clone by sequencing;

(3) Construction of an expression vector for the tumor suppressor Gene HAP1

Extracting correctly cloned plasmid, cutting with restriction enzymes XhoI and EcoRI, separating by 1% agarose gel electrophoresis, recovering target fragment, connecting into linearized pLVX-Puro vector, transforming competent bacteria, culturing in LB plate containing ampicillin, selecting positive clone for culturing, cutting and sequencing, identifying, preserving correct clone, extracting plasmid.