CN113604495B

CN113604495B - Explosive molecule biosensor synthesized by utilizing regulatory element and preparation method and application thereof

Info

Publication number: CN113604495B
Application number: CN202110891338.0A
Authority: CN
Inventors: 杨建明; 王兆宝; 马冉; 汤若昊; 李美洁; 梁波; 罗明
Original assignee: Qingdao Agricultural University
Current assignee: Qingdao Agricultural University
Priority date: 2021-08-04
Filing date: 2021-08-04
Publication date: 2023-07-25
Anticipated expiration: 2041-08-04
Also published as: CN113604495A

Abstract

The invention discloses an explosive molecule biosensor synthesized by utilizing a regulating element, a preparation method and application thereof, wherein the explosive molecule biosensor comprises a self-luminous operon luxABCDE operon report element, a promoter nahR induction element, rsrR regulating protein and a downstream tetH promoter regulated by the same; the explosive molecule biosensor allows the nahR promoter to sense the signal of the explosive molecule through RsrR-P _tetH The method and the biosensor for detecting the explosive molecule signals through the cascade amplification of the regulatory protein regulatory element and the promoter are established, and the sensor has the advantages of wide detection range, high sensitivity, simple and convenient method, low cost, strong safety and the like, and can be applied to the fields of environmental protection, national safety maintenance and the like.

Description

Explosive molecule biosensor synthesized by utilizing regulatory element and preparation method and application thereof

Technical Field

The invention relates to the technical fields of genetic engineering and molecular biology, in particular to an explosive molecular biosensor synthesized by utilizing a regulatory element, and a preparation method and application thereof.

Background

The biological induction technology is to modify bacterial strain by genetic engineering means, so that the microorganism can be detected to change after inducing specific compounds or metabolites of the specific compounds in the microorganism, thereby achieving the purpose of detecting the specific compounds. The biosensor mainly comprises a sensing element and a reporting element, wherein the sensing element can specifically sense target compounds, and comprises a gene transcription promoter, a ribosome binding site, a terminator, a transcription regulatory factor and the like; the report element can generate a sensing signal under the action of the sensing element, and commonly used report elements include Green Fluorescent Protein (GFP), yellow Fluorescent Protein (YFP), red Fluorescent Protein (RFP) and luciferase, which respectively generate sensing signals of corresponding colors that can be detected, such as fluorescence and self-luminescence. These more common reporting elements are characterized by mature technology and easy operation, but the detection of fluorescence and self-luminescence requires the help of analytical instruments, and the quantitative and qualitative analysis of fluorescence signals and self-luminescence signals.

The effective component of explosive (such as mine) is 2,4, 6-trinitrotoluene (TNT), TNT can be naturally decomposed into various compounds such as 1, 3-dinitrobenzene (1, 3-DNB) and 2, 4-dinitrotoluene (2, 4-DNT), wherein the 2,4-DNT has the highest stability and can exist in natural environment for a long time. The ismmshon Belkin reported in 2014 that the sensing element for explosive molecules 2,4-DNT, namely yqjF promoter, utilizes GFP as a reporting element, constructs a biosensing system for detecting 2,4-DNT, and the detection limit reaches 0.01mg/L (New Biotechnology,2020,59,65-73) and is at an internationally leading level. The biosensing system needs to use an instrument to perform ultraviolet excitation with specific wavelength and collect green fluorescent signals. In addition, many non-GFP materials fluoresce green under uv excitation, producing interfering signals. Therefore, the sensor has poor specificity, and the application of the sensor in a complex environment is greatly limited.

Disclosure of Invention

The invention aims to provide an explosive molecule inductor synthesized by utilizing a regulating element, a preparation method and application thereof, so as to solve the problems in the prior art.

In order to achieve the above object, the present invention provides the following solutions:

the invention provides a preparation method of an explosive molecule biosensor synthesized by using a regulatory element, which comprises the following steps:

(1) Amplifying a self-luminous operon luxABCDE operon gene fragment, purifying and recovering, carrying out double enzyme digestion with a plasmid pACYCDuet-1 by using Not I and Kpn I at the same time, connecting the luxABCDE operon gene fragment with a plasmid enzyme section in a molar ratio of 2-5:1, transforming the connection product into escherichia coli competent cells, screening positive clones on an LB solid plate containing antibiotics, and obtaining a recombinant plasmid p-luxPLEIO after verification and sequencing are correct;

(2) Amplifying a promoter nahR gene fragment, purifying and recovering, carrying out single enzyme digestion on the amplified promoter nahR gene fragment and a recombinant plasmid p-luxPleio by using PstI, connecting the plasmid enzyme digestion fragment and the nahR gene fragment in a molar ratio of 2-5:1, transforming a connection product into escherichia coli competent cells, screening positive clones on an LB solid plate containing antibiotics, and obtaining the recombinant plasmid p-nahR-luxPleio after verification and sequencing are correct;

(3) Amplifying regulatory protein RsrR and tetH promoter gene fragment, purifying and recovering, and then carrying out single enzyme digestion with recombinant plasmid P-nahR-luxpleio by using NotI, and carrying out plasmid enzyme digestion fragment and RsrR-P _tetH The gene fragments are connected in a molar ratio of 2-5:1, the connection products are transformed into competent cells of the escherichia coli, positive clones are screened on an LB solid plate containing antibiotics, and recombinant plasmids P-nahR-RsrR-P are obtained _tetH -luxpleio；

(4) Recombinant plasmid P-nahR-RsrR-P _tetH -luxpleio transformed escherichia coli competent cells, screening positive clones on an LB solid plate containing antibiotics to obtain an engineering strain MR-12;

(5) Culturing and activating the engineering strain MR-12 in LB liquid culture medium containing antibiotics, and then transferring to M9 liquid culture medium which takes glucose as a carbon source and contains magnesium ions for culture, thus obtaining the explosive molecule biosensor synthesized by utilizing the regulatory element.

After the step (2), the method further comprises the step (2-1) of transforming the recombinant plasmid p-nahR-luxPLeio into escherichia coli competent cells, and screening positive clones on an LB solid plate containing chloramphenicol to obtain an engineering strain MR-11;

and step (2-2), culturing and activating the engineering strain MR-11 in an LB liquid culture medium containing antibiotics, transferring to an M9 liquid culture medium taking glucose as a carbon source and containing magnesium ions for culture, and primarily obtaining the explosive molecular biosensor.

Further, in the step (2-2), the engineering strain MR-11 is cultured and activated in LB liquid medium containing chloramphenicol, and then transferred to M9 liquid medium added with 60% glucose and 1M magnesium sulfate solution for culture and growth to OD ₆₀₀ =0.2, a primary explosives molecular biosensor was obtained.

Further, the self-luminous operon luxABCDE operon is derived from: is Protobacter fish.

Further, the self-luminescent operon luxABCDE operon has one of the following nucleotide sequences:

a nucleotide sequence shown as SEQ ID No. 1;

or a nucleotide sequence which has more than 90% homology with the nucleotide sequence shown in SEQ ID No.1 and is capable of encoding a self-luminous phenotype.

Further, the nucleotide sequence of the promoter nahR is shown as SEQ ID No. 2.

Further, the nucleotide sequences of the regulatory proteins RsrR and tetH promoter are shown in SEQ ID No. 3.

Further, in the step (5), the engineering strain MR-12 is cultured and activated in LB liquid medium containing chloramphenicol, and then transferred to M9 liquid medium added with 60% glucose and 1M magnesium sulfate solution for culture and growth until OD ₆₀₀ =0.2, an explosive molecule biosensor synthesized using regulatory elements was obtained.

The invention also provides the explosive molecule biosensor synthesized by the regulatory element, which is prepared by the preparation method of the explosive molecule biosensor synthesized by the regulatory element.

The invention also provides an application of the explosive molecule biosensor synthesized by using the regulating element in real-time detection of the explosive molecules.

The invention also provides a method for detecting the explosive molecules in real time by using the explosive molecule biosensor synthesized by the regulating element, which comprises the following steps:

uniformly mixing an explosive molecular biological sensor and a sample to be detected in a volume ratio of 9:1, adding a black ELISA plate, and sealing, wherein on one hand, a scientific research-grade CCD camera is used for photographing and detecting exposure for 30 seconds; on the other hand, the fluorescence intensity RLU value is monitored in real time at constant temperature by using an enzyme-labeled instrument, and the monitoring is carried out every 10-20min for 15-25h.

Further, the concentration of the explosive molecules which can be sensed by the explosive molecule biosensor is 10 mug/L, and the explosive molecules are 2,4-DNT.

Furthermore, the explosive molecule biological sensor can sense explosive molecules with different concentrations, so that the explosive molecules emit self-luminescence with different intensities, and the aim of monitoring the explosive molecules in real time is fulfilled by coupling the concentration of the explosive molecules with the self-luminescence value.

The invention discloses the following technical effects:

1. the invention takes a reporter plasmid containing the lux operon of the leiognathus luminous bacilli as a basic plasmid, and the recombinant plasmid is obtained by connecting a promoter capable of inducing 2,4-DNT, and then is transferred into escherichia coli cells to initially obtain a biosensor capable of inducing explosive molecules, and then the acidophilic mesophilic bacteria regulatory protein RsrR and a tetH promoter regulated and controlled by the downstream thereof are connected into the recombinant plasmid constructed before, and the recombinant plasmid with RsrR-P is obtained _tetH The recombinant plasmid of (2) is transferred into escherichia coli cells to finally obtain a biosensor for sensing explosive molecules by using a regulating system, and the biosensor can sense explosive molecules with different concentrations so as to generate different concentrationsThe fluorescent signal of the degree can reach the purpose of detecting the explosive molecules by detecting the intensity of fluorescence, the detection result is accurate and efficient, and the use is simple.

2. The invention constructs and utilizes RsrR-P _tetH The explosive molecule biosensor synthesized by the regulatory element can start transcription of regulatory protein RsrR after the nahR promoter senses explosive molecules, the RsrR regulatory protein acts on the TetH promoter again to start expression of luxABCDE reporter gene, so that the nahR promoter senses signals of the explosive molecules through RsrR-P _tetH The cascade amplification is regulated, the fluorescent signal generated after the sensing of the explosive molecules is enhanced, the detection sensitivity is improved, and the method has a great application prospect in the field of explosive detection.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a plasmid map of the constructed vector p-luxpleio.

FIG. 2 is a plasmid map of the constructed vector p-nahR-luxpleio.

FIG. 3 shows the constructed vector P-nahR-RsrR-P _tetH Plasmid map of luxpleio.

FIG. 4 shows the detection result of the constructed engineering strain MR-11 enzyme-labeled instrument.

FIG. 5 shows the detection result of the constructed engineering strain MR-11 enzyme-labeled instrument.

FIG. 6 shows the detection results of the constructed engineering strains MR-11 and MR-12 by a camera.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples of the present invention are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.

In organisms, the regulatory proteins can amplify signals such as environmental stimulus and the like in cascade through regulatory action, and finally embody in transcription and expression of downstream structural genes, and finally realize response and coordination of various physiological activities of the organisms. The study shows that the acidophilic thiobacillus caldus (Acidithiobacillus caldus, abbreviated as A.caldus) has a tetH gene cluster responsible for thiosulfate and tetrathionate metabolism, and a RsrR regulatory protein exists in front of the gene cluster and can act on a promoter of the tetH gene to activate transcription and expression of the tetH gene cluster, so that environmental signals are cascade amplified, and finally physiological metabolic activities of the thiosulfate and the tetrathionate are realized.

Therefore, the invention utilizes the RsrR-Pteth regulation system element to construct the explosive molecule biosensor, which can start the transcriptional expression of the regulatory protein RsrR after the nahR promoter senses the explosive molecule, the RsrR regulatory protein acts on the tetH promoter again to start the expression of the luxABCDE reporter gene, so that the nahR promoter senses the signal of the explosive molecule through the RsrR-P _tetH The regulatory element is amplified in cascade, and the fluorescent signal generated after the induction of the explosive molecules is enhanced, so that the fluorescent signal is detected by an instrument, thereby completing the invention.

Example 1 Gene acquisition and vector construction

1. Gene acquisition

The nucleotide sequence of the luxABCDE operon derived from the Protobacter lewisii (Photobacterium leiognathi) is shown as SEQ ID No.1, and the luxABCDE operon is chemically synthesized on a pUC-57 vector by Huada gene company to obtain a pUC-lumPleio vector.

The nucleotide sequence of the nahR promoter gene from pseudomonas putida (Pseudomonas putida) is shown as SEQ ID No.2, and the nucleotide sequence is chemically synthesized on a pUC-57 vector by Huada gene company to obtain the pUC-nahR vector.

The nucleotide sequence of the RsrR regulatory protein TetH promoter derived from acidophilic thiobacillus caldus (Acidithiobacillus caldus) MTH-04 is shown as SEQ ID No.3, and the nucleotide sequence is chemically synthesized on a pUC-57 vector by Hua Dain Co., ltd. To obtain pUC-RsrR-P _tetH A carrier.

Wherein SEQ ID No.1:

ATGATTAAGAAGATCCCAATGATTATTGGGGGTGTAGTTCAAAACACGTCTGGATATGGCATGCGTGAACTAACGCTCAACAATAATAAAGTGAATATCCCTATCATCACCCAAAGTGATGTTGAAGCTATTCAATCACTAAATATAGAAAACAAATTGACTATAAATCAGATAGTTAATTTCTTATATACAGTGGGACAAAAATGGAAGAGCGAAACTTACAGCCGACGACTCACTTATATTCGAGATCTTATTAAGTTCCTCGGTTACTCACAAGAGATGGCAAAACTTGAAGCTAACTGGATCTCAATGATTCTGTGTAGCAAAAGTGCGTTGTACGATATTGTTGAGAATGATCTTAGCTCACGGCATATTATTGATGAGTGGATCCCCCAAGGTGAATGTTATGTCAAAGCGCTCCCAAAAGGAAAATCTGTACACCTATTAGCTGGTAACGTACCACTATCTGGTGTGACTTCTATTCTTCGTGCGATTTTGACCAAAAACGAGTGCATCATAAAAACGTCATCAGCTGATCCTTTTACAGCTACTGCGCTAGTTAATAGTTTTATCGATGTAGATGCAGAACACCCGATCACACGTTCAATCTCAGTTATGTATTGGTCACATAGCGAGGATCTTGCTATTCCAAAACAAATAATGAGCTGTGCTGATGTGGTTATTGCATGGGGTGGTGATGATGCAATTAAATGGGCTACAGAACATGCACCATCACACGCAGATATTCTAAAATTTGGTCCCAAAAAGAGTATATCCATTGTTGACAACCCAACAGATATTAAGGCTGCTGCTATCGGTGTAGCACATGATATCTGTTTTTACGATCAGCAAGCATGTTTCTCCACCCAAGATATTTATTATATTGGCGATAGCATAGACATATTTTTTGATGAATTAGCTCAGCAATTAAATAAATATAAAGACATATTGCCTAAAGGTGAGCGGAATTTTGATGAAAAAGCAGCTTTTTCTTTAACGGAAAGAGAATGTTTGTTTGCCAAATATAAAGTTCAAAAAGGTGAAAGCCAATCTTGGTTATTAACGCAATCACCTGCGGGATCATTTGGTAATCAGCCGTTATCACGCTCGGCTTATATTCATCAAGTAAATGACATTTCAGAAGTCATTCCATTCGTGCATAAGGCGGTAACGCAAACCGTCGCAATAGCGCCGTGGGAGTCGTCTTTCAAATATAGAGATATATTAGCAGAACATGGTGCAGAACGAATTATAGAAGCCGGAATGAATAATATATTTCGAGTAGGTGGCGCCCATGATGGGATGCGTCCCCTTCAACGGCTTGTTAACTATATATCACATGAAAGGCCGTCAACATATACCACTAAAGATGTCTCGGTGAAAATCGAACAGACTCGTTATCTTGAGGAAGATAAGTTCCTCGTATTTGTACCGTAGAAAGAGATATATCATGGAAAATACACAACATTCATTACCTATTGATCACGTAATTGATATTGGTGATAACCGTTATATTCGAGTATGGGAAACCAAGCCGAAAAATAAAGAAACCAAGCGTAATAATACCATCGTTATCGCCTCAGGCTTTGCTCGACGCATGGATCATTTTGCTGGTCTTGCCGAATATTTAGCAAATAATGGTTTTCGTGTTATTCGTTATGATTCGTTAAATCATGTCGGTCTTAGTAGCGGAGAGATCAAACAGTTCTCGATGTCAGTAGGTAAACACAGTTTGCTAACTGTTATTGATTGGCTAAAAGAACGAAATATTAACAATATAGGTCTTATTGCTTCGAGTCTTTCTGCTCGAATTGCTTATGAAGTGGCAGCAGAAATTGATTTGTCATTTTTAATTACCGCCGTCGGTGTTGTCAATTTAAGAAGTACGCTAGAAAAAGCACTGAAATATGATTATCTACAAATGGAAGTAAATACTATTCCTGAAGATTTAATTTTTGAAGGACACAATCTAGGTTCAAAAGTCTTTGTGACAGATTGTTTTGAAAATAATTGGGACTCATTAGATTCGACAATAAATAAAATTTGTGAACTAGATATTCCATTTATTGCTTTCACTTCAGATGGCGATGATTGGGTTTGCCAACATGAAGTAAAACATTTAGTCAGTAACGTTAAATCTGACAAAAAGAAAATTTACTCACTCGTTGGCTCATCTCATGATTTGGGCGAAAACCTAGTGGTGCTTCGTAACTTCTATCAATCAATGACGAAAGCTGCTGTGAGCTTAGATCGTCAATTAGTAGAGCTTGTTGATGAAATTATTGAACCAAATTTTGAAGACCTAACAGTTATTACGGTAAATGAACGGCGCCTCAAAAATAAAATCGAAAATGAAATTATTAATAGATTAGCTGATCGCGTATTGGCTAGTGTCTAAATAGTACTTACCTAAGTACAGCCAAAAGGAAGAAATAATGAAAATTAGTAATATCTGTTTCTCATACCAACCACCAGGTGAATCACATCAAGAGGTAATGGAGCGCTTTATTCGTTTAGGCGTTGCATCAGAAGAGCTCAACTTTGATGGTTTCTATACACTTGAACACCATTTCACTGAGTTTGGTATTACAGGTAACCTTTATATTGCCTGTGCCAATATTCTTGGTCGAACCAAAAGGATCCAAGTCGGTACCATGGGGATAGTGTTACCGACAGAGCACCCAGCACGACATGTAGAAAGTCTTCTCGTTTTAGATCAACTGTCTAAAGGGCGCTTTAACTACGGTACTGTTCGCGGACTCTACCATAAAGATTTTCGTGTTTTTGGTACATCACAGGAAGATTCTCGTAAGACCGCAGAAAATTTCTACTCTATGATCTTGGATGCATCAAAAACAGGTGTGCTACATACTGACGGTGAAGTAGTAGAGTTCCCAGATGTCAATGTTTATCCAGAAGCTTACAGCAAAAAACAACCCACCTGCATGACAGCCGAATCATCCGAGACCATCACTTATTTAGCTGAACGTGGTTTACCAATGGTGTTAAGTTGGATTATTCCGGTCAGTGAGAAAGTCTCACAAATGGAATTGTACAATGAAGTTGCGGCAGAGCATGGTCATGACATTAACAACATTGAACATATCCTAACTTTCATTTGCTCTGTAAATGAAGACGGTGAAAAAGCAGACAGCGTATGCCGTAATTTCCTAGAAAATTGGTACGACTCTTACAAAAATGCAACCAACATCTTCAACGACAGTAACCAAACTCGTGGCTACGATTACCTCAAAGCTCAGTGGCGTGAGTGGGTAATGAAGGGGTTGGCTGATCCTCGTCGCCGACTTGATTACAGTAACGAATTAAACCCTGTCGGCACGCCAGAACGATGCATTGAGATCATTCAAAGTAATATTGATGCCACTGGAATTAAGCATATTACTGTTGGATTTGAAGCGAATGGTTCTGAACAAGAAATTCGTGAATCCATGGAGCTATTTATGGAAAAAGTAGCGCCACACTTAAAAGATCCTCAGTAAGCTGTTCTTTTTAAACTATTCAATATCAAGGCATAAGGAATAAAATATGAATTTCGGGTTATTTTTCCTAAATTTCCAGCCTGAAGGTATGACTTCAGAAATGGTTTTAGACAACATGGTAGATACTGTCGCATTAGTGGATAAAGATGATTACCACTTTAAAAGAGTGCTCGTCAGCGAGCATCATTTTTCTAAAAACGGCATTATCGGAGAACCTTTGACAGCGATTAGCTTCTTACTTGGTTTGACTAAACGTATAGAAATTGGTTCTTTAAATCAAGTGATTACCACCCATCATCCTGTACGTATCGGAGAACAAACGGGCTTACTTGATCAAATGTCTTACGGTCGTTTCGTTTTAGGCTTAAGTGACTGTGTCAATGACTTCGAAATGGATTTCTTTAAGAGAAAACGTAGCTCTCAACAGCAACAATTCGAAGCATGTTACGAAATTTTAAATGAAGCGCTGACGACAAACTATTGTCAGGCAGATGATGACTTCTTTAACTTCCCACGTATTTCTGTTAACCCGCATTGTATTAGCGAAGTAAAACAATATATTTTAGCTTCAAGCATGGGCGTGGTTGAATGGGCAGCAAGAAAAGGATTGCCACTCACTTACCGCTGGAGTGACAGCCTAGCAGAAAAAGAAAAATACTATCAGCGTTATCTCGCTGTTGCTAAAGAGAATAATATTGATGTATCAAATATTGACCACCAATTCCCACTGCTCGTTAATATCAATGAAAATCGTCGTATTGCTCGAGATGAAGTAAGGGAGTATATACAAAGTTATGTGAGTGAAGCCTACCCTACTGACCCCAACATTGAGCTAAGAGTAGAAGAGCTTATTGAGCAGCATGCTGTCGGCAAAGTGGATGAGTACTACGACTCAACAATGCACGCAGTAAAAGTTACAGGTTCAAAAAATTTATTACTCTCTTTTGAATCAATGAAAAATAAAGACGATGTTACCAAGCTTATAAATATGTTTAATCAAAAAATCAAAGATAACCTTATTAAATAATTTAATTACGGATAGATATTTTCGATATATCTAAGTCTTACTACCATTTATATAAACTATTTATACAGATAACGTTTCATTTGATTAAGTCAGTAAATAATTGCCATTAATTAATGGCAGTGCAGATCCTTACACTGCCATTTATAAATTAAATAAGGGTTAACATGTCAACATTATTAAATATAGATGCAACTGAAATTAAGGTGAGTACAGAAATAGATGATATTATTTTTACATCATCACCGCTAACGTTACTATTTGAAGATCAAGAAAAAATACAGAAAGAACTTATTTTGGAGTCTTTCCATTATCATTACAATCATAATAAAGATTATAAGTACTATTGTAATATACAAGGCGTAGATGAGAATATACAGTCCATTGACGATATTCCTGTTTTTCCTACTTCAATGTTCAAGTACTCAAGATTACATACTGCTGATGAATCAAATATTGAAAATTGGTTTACTAGTAGTGGTACAAAGGGAGTCAAAAGTCATATAGCTCGAGATCGGCAGAGTATTGAACGCTTGCTAGGTTCTGTTAATTACGGCATGAAATACTTGGGTGAATTTCACGAGCATCAATTAGAACTAGTGAATATGGGGCCAGATCGTTTCAGTGCGTCAAATGTTTGGTTTAAATATGTAATGAGCTTAGTTCAATTACTTTACCCAACAACATTTACCGTTGAAAACGATGAAATCGATTTTGAACAAACCATCTTAGCGTTAAAAGCAATTCAGCGTAAAGGAAAAGGAATTTGTTTAATTGGCCCTCCGTATTTTATTTATTTGTTATGCCACTACATGAAAGAGCATAATATCGAATTTAATGCTGGTGCACATATGTTTATCATTACAGGTGGGGGATGGAAAACCAAACAAAAAGAAGCGCTAAACCGACAAGATTTCAATCAACTATTGATGGAGACTTTTAGCCTTTTCCATGAAAGTCAAATTCGAGATATCTTTAACCAAGTAGAGCTAAACACTTGTTTCTTTGAAGACAGCCTACAGCGTAAACATGTACCACCGTGGGTATATGCTCGTGCGCTTGATCCTGTCACTTTAACGCCCGTAGAAGATGGCCAAGAGGGCTTGATGAGTTATATGGATGCCTCATCTACCAGCTACCCGACATTTATTGTTACCGACGATATTGGTATTGTTCGCCATCTAAAAGAACCAGATCCATTCCAAGGAACAACGGTTGAAATTGTTCGTCGTTTAAATACGCGAGAACAAAAAGGATGTTCACTCTCAATGGCCACGAGCCTGAAATAAAAGCAGGGCTTAATCATGATTTTTAATTGCAAGGTTAAAAAAGTCGAAGCATCTGACAGCCATATTTACAAAGTGTTTATTAAGCCTGACAAATGCTTTGATTTTAAAGCGGGTCAATATGTAATTGTGTATCTCAATGGAAAAAATTTGCCGTTTTCTATTGCTAACTGCCCAACTTGTAATGAGCTCCTTGAATTACATGTAGGAGGTTCGGTAAAAGAATCCGCCATTGAAGCTATTTCGCACTTTATTAATGCATTTATTTATCAAAAAGAATTTACAATCGATGCACCACACGGTGATGCATGGCTGAGAGATGAAAGCCAATCACCTTTACTACTTATAGCAGGAGGGACAGGTTTATCATATATCAATAGCATTTTAAGTTGTTGTATTAGTAAACAGTTATCTCAGCCTATCTATCTTTATTGGGGAGTAAATAACTGTAATTTACTCTATGCTGATCAACAACTAAAAACACTCGCCGCACAATACAGAAATATAAATTATATTCCTGTGGTAGAGAATTTAAATACTGACTGGCAGGGAAAAATTGGTAATGTTATTGACGCGGTTATTGAAGATTTTTCAGATTTATCTGACTTTGATATCTATGTCTGCGGGCCATTTGGTATGAGCCGGACTGCGAAAGATATTCTGATCTCACAGAAAAAGGCGAATATAGGAAAAATGTATTCTGATGCATTTAGCTATACGTAA；

SEQ ID No.2：

CGCATACCTCGCCTTTGTGAACCTCTAATTACCACTGACTCTATCCGGGCTTTGCCCGTTAGACCATCAGTGGGCATTAATAGTCGACATGCTTGTCATCGATTGGGCACCTGACTTTCCCTGCGATTGGTCCCCCTAAACCCGTGCAGGGTAACAGCCTTTGGCCTTAAGATTCACCTCTGCCCCACATTAGGCGAAGCGCACCG；

SEQ ID No.3：

ATGGAAATCAAATCTTCCGCACACATTCTGGTGGTTGACGACGATTTACGGCTACGGAGTCTGGTGGAAGCACACCTCCGTCAGGTGGGGTTTACTGTCGACGGAGTGCGTGATGGCCAAGGACTCGATCATAAACTTCACGGGGGGGAGGTAGATTTGATCATACTCGATTTGGGCTTGCCCGATGAGGATGGTCTTCAGATTTGTCAGCGCCTACGCCTGACATACGATACCCCTATCCTGATACTGACGGCCCGTGGGGATGAGGTGGATCGCATACTTGGGTTGGAGATGGGCGCCGACGATTACCTATCAAAACCTTTTCATCCACGGGAGTTAATCGCTCGTGTTCAGGCTATACTGCGAAGAACAAAGCCCATGAACAGGGGTCGCCAGCACGCCGATGAGCCAGAAATATGTATGAAGGGCGCTTTTGTGGTGGACACGCGCCGTCAAAAAATTCTGTGGCGGGGAGAACCGTTAGAGTTATCACAAGCCGATTTTCAGACACTTTCTACGCTTATCAAGCACGAGGGACAACCGCTCAGTCGGGAACGGCTCATGCTTCTGAGTCGGGGCCGAACCTATGCGTCGGATGACCGAACCATAGACATGCAGATCTCGCGATTACGAAAGCTACTCGATTCCAAAACCGACGGTGCTCAGCACATTCGCACAGTATGGGGTAGCGGATACATGTTTCTCTCCGAACCATGAAGGTCCGGTTTCTTCTTGTTGATCGTGGTACGCATCTCGAAGCGCCGATTGTGTACAGAATGAACAGTGGCGAGTCTGCTCGGCAACCCGGACATGGGATGGGAATCGGGTTGATGATTTGTCATCGCATCATGGCATTGCACAAGGGCTCTTTGCATTTCACATCAGAGGATGGGCTGGCGGCAACCATTTGCCTTCCGAGAGTACAAGATGGAGTAACATCGGCACAGAGACAGGAATTCAACGCACGTAAATTGTAACACCTGTTACACCTGTTACAACTTGTTACATAAGCTAAAACTTATATGCAATTGTCTCCTATGGGCCCCGAGTATACTATCCGAAGCGCGGCGTAGTTATGCCCCTAGACAACGTATTAGCGATTCGGAGATTATATATC。

2. construction of p-lumPleio expression vector

The primers lumPleio-F and lumPleio-R were used as templates to perform the Polymerase Chain Reaction (PCR) to amplify lumPleio fragments, and the PCR amplification system is shown in the following table:

the PCR procedure was: 3min at 95 ℃;30 cycles X (95 ℃ C. 15s,58 ℃ C. 15s,72 ℃ C. 6 min); 72 ℃ for 5min;16 ℃ infinity.

The primer sequences are shown below:

lumPleio-F(SEQ ID No.4)：

5’-TCGACAAGCTTGCGGCCGCATGATTAAGAAGATCCCAATG-3’；

lumPleio-R(SEQ ID No.5)：

5’-TACCAGACTCGAGGGTACCTTACGTATAGCTAAATGCATCA-3’。

the PCR product was subjected to gel recovery and purification using gel recovery and purification kit (Vazyme, cat. DC 301-01).

The plasmid pACYCDuet-1 was digested simultaneously with restriction enzyme 1Not I (TaKaRa, cat. No. 1611) and restriction enzyme 2Kpn I (TaKaRa, cat. No. 1615), and the digestion system was as follows:

the enzyme digestion system is incubated for 1h at 37 ℃ for gel recovery and purification.

The luxpleio fragment was cloned into the pacycdat-1 plasmid using seamless cloning, the system of which is as follows:

the ligation system was incubated at 50℃for 30min. The ligation product was transformed into E.coli DH 5. Alpha. Competent, spread on LB solid plates containing 34mg/L chloramphenicol, PCR screened positive clones, recombinant plasmid p-luxpleio (FIG. 1) was extracted from positive clones, and identified by restriction enzyme digestion and sequencing.

Construction of 3.p-nahR-luxpleio expression vector

Using pUC-nahR as template, primer nahR-F and primer nahR-R, making Polymerase Chain Reaction (PCR), amplifying nahR fragment, its PCR amplification system is shown as follows:

the PCR procedure was: 3min at 95 ℃;30 cycles X (95 ℃ 15s,55 ℃ 15s,72 ℃ 30 s); 72 ℃ for 5min;16 ℃ infinity. The primer sequences are shown below:

nahR-F(SEQ ID No.6)：

5’-GAGCTCGGCGCGCCTGCAGCGCATACCTCGCCTTTGTGAA-3’；

nahR-R(SEQ ID No.7)：

5’-CAAGCTTGTCGACCTGCAGCGGTGCGCTTCGCCTAATGT-3’。

The p-luxpleio plasmid was digested with the restriction enzyme Pst I (TaKaRa, cat 1073) in the following system:

The nahR fragment was cloned on the p-luxpleio plasmid using seamless cloning, the system of which is as follows:

the ligation system was incubated at 50℃for 30min. The ligation product was transformed into E.coli DH 5. Alpha. Competent, plated on LB solid plates containing 34mg/L kanamycin, and positive clones were PCR screened, recombinant plasmid p-nahR-luxpleio (FIG. 2) was extracted from the positive clones, and then identified by restriction enzyme digestion and sequencing.

3、p-nahR-RsrR-P _tetH -luxpleio expression vectorConstruction of (3)

With pUC-RsrR-P _tetH As templates, primers RsrR-Pteth-F and RsrR-Pteth-R were subjected to Polymerase Chain Reaction (PCR), and nahR fragments were amplified, and the PCR amplification system was as follows:

the PCR procedure was: 3min at 95 ℃;30 cycles X (95 ℃ C. 15s,55 ℃ C. 15s,72 ℃ C. 1 min); 72 ℃ for 2min;16 ℃ infinity. The primer sequences are shown below:

RsrR-PtetH-F(SEQ ID No.8)：

5’-TCGACAAGCTTGCGGCCGCATGGAAATCAAATCTTCCGC-3’；

RsrR-PtetH-R(SEQ ID No.9)：

5’-TTCTTAATCATGCGGCCGCGATATATAATCTCCGAATCG-3’。

The p-nahR-luxpleio plasmid was digested with restriction enzyme Not I (TaKaRa, cat. No. 1611), the digestion system was:

RsrR-P Using seamless cloning _tetH Fragment cloning was performed on the p-nahR-luxpleio plasmid, the system of which is as follows:

the ligation system was incubated at 50℃for 30min. Ligation product conversion E.coli DH 5. Alpha. CompetentCoating on LB solid plate containing 34mg/L kanamycin, PCR screening positive clone, extracting recombinant plasmid P-nahR-RsrR-P from positive clone _tetH Luxpleio (fig. 3), and then identified by restriction and sequencing.

Example 2 construction of a biosensor

The P-nahR-luxpleio and P-nahR-RsrR-P _tetH Two recombinant plasmids of-luxpleio were transformed into Escherichia coli BW25113 competent cells (purchased from Weidi Biotechnology, cat. Number DL 2050), plated on LB solid plates containing 34mg/L chloramphenicol, and positive clones were obtained by PCR screening, thereby obtaining an engineering strain MR-11 containing the vector P-nahR-luxpleio and an engineering strain MR-11 containing the vector P-nahR-RsrR-P _tetH -an engineered strain MR-12 of luxpleio.

Example 3 use of a biosensor to detect explosives molecules

1. Strain activation and culture

Engineering strains MR-11 and MR-12 with correct sequencing are respectively transferred into LB liquid medium containing 34mg/L chloramphenicol, and cultured overnight at 37 ℃. 200. Mu.L of the overnight activated bacterial liquid is transferred to 10mL of M9 liquid medium, 10. Mu.L of 34mg/mL chloramphenicol, 330. Mu.L of 60% glucose and 10. Mu.L of 1M magnesium sulfate stock solution are added to the M9 liquid medium, and shake culture is performed at 37 ℃ until OD ₆₀₀ =0.2 or so.

2. Preparation of 2,4-DNT solution

Preparing 20mg/mL mother liquor 2,4-DNT (100 mg 2,4-DNT dissolved in 5mL absolute ethanol);

the diluted 2,4-DNT solution was prepared in the following proportions:

50mg/L: 2.5. Mu.L of mother liquor +980. Mu. L M9 Medium +17.5. Mu.L of absolute ethanol;

10mg/L: 0.5. Mu.L of mother liquor +980. Mu. L M9 Medium +19.5. Mu.L of absolute ethanol;

0mg/L: 980. Mu. L M9 Medium+20. Mu.L absolute ethanol.

Preparing 0.2mg/mL of 2,4-DNT dilution mother liquor (10 mu L of 20mg/mL of 2,4-DNT mother liquor and 990 mu L of absolute ethanol);

the diluted 2,4-DNT solution was prepared in the following proportions:

1mg/L: 5. Mu.L of diluted mother solution +980. Mu. L M9 medium +15. Mu.L of absolute ethanol;

the concentration of ethanol in each DNT solution was 2%, and the final concentration of ethanol after 10-fold dilution was 0.2%.

3. Explosive molecule detection

Mixing 90 μL of bacterial liquid with 10 μL of 2,4-DNT mother liquor with each concentration (0 mg/L, 0.1mg/L, 1mg/L, 10mg/L, 100 mg/L), adding into 96-well black ELISA plate (costar, product No. 3603) to make the final concentration of 2,4-DNT be 0mg/L, 0.01mg/L, 0.1mg/L, 1mg/L, 10mg/L,

and (3) detection by an enzyme-labeled instrument: the fluorescence intensities (RLU) of the two strains MR-11 and MR-12 were monitored in real time at a constant temperature of 30℃using a microplate reader (Biotek), once every 10min for a total of 12h.

As shown in FIGS. 4 and 5, the luminescence intensity of the engineering strains MR-11 and MR-12 at different concentrations of explosive molecules shows a tendency of increasing with time and gradually decreasing with time after reaching the highest value. The time to reach the highest value is around 6h, but with P-nahR-RsrR-P _tetH The maximum value of the luminescence intensity of the engineering strain MR-12 with the luxpleio plasmid is about 2 times that of the engineering strain MR-11 with the p-nahR-luxpleio plasmid.

And (3) camera detection: and (3) placing the black ELISA plate engineering strain into a constant temperature 30 ℃ environment for culturing for 6 hours, then placing the cultured engineering strain into a darkroom, and using a scientific research grade CCD camera for photographing detection, wherein the exposure time is 30s.

As shown in FIG. 6, the luminous intensity of the engineering strain MR-12 is obviously improved compared with that of the engineering strain MR-11 after the engineering strain MR-12 is cultured for 6 hours.

The result shows that the luminous intensity of the engineering strain MR-12 prepared by the invention is more than 2 times higher than that of the engineering strain MR-11 when the engineering strain MR-12 senses explosive molecules, the fluorescent signal of the engineering strain when the engineering strain detects explosive molecules with low concentration is effectively enlarged, and the accuracy and reliability of the detection result are improved.

The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Sequence listing

<110> Qingdao university of agriculture

<120> an explosive molecular biosensor synthesized by using regulatory elements, and preparation method and application thereof

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 6533

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atgattaaga agatcccaat gattattggg ggtgtagttc aaaacacgtc tggatatggc 60

atgcgtgaac taacgctcaa caataataaa gtgaatatcc ctatcatcac ccaaagtgat 120

gttgaagcta ttcaatcact aaatatagaa aacaaattga ctataaatca gatagttaat 180

ttcttatata cagtgggaca aaaatggaag agcgaaactt acagccgacg actcacttat 240

attcgagatc ttattaagtt cctcggttac tcacaagaga tggcaaaact tgaagctaac 300

tggatctcaa tgattctgtg tagcaaaagt gcgttgtacg atattgttga gaatgatctt 360

agctcacggc atattattga tgagtggatc ccccaaggtg aatgttatgt caaagcgctc 420

ccaaaaggaa aatctgtaca cctattagct ggtaacgtac cactatctgg tgtgacttct 480

attcttcgtg cgattttgac caaaaacgag tgcatcataa aaacgtcatc agctgatcct 540

tttacagcta ctgcgctagt taatagtttt atcgatgtag atgcagaaca cccgatcaca 600

cgttcaatct cagttatgta ttggtcacat agcgaggatc ttgctattcc aaaacaaata 660

atgagctgtg ctgatgtggt tattgcatgg ggtggtgatg atgcaattaa atgggctaca 720

gaacatgcac catcacacgc agatattcta aaatttggtc ccaaaaagag tatatccatt 780

gttgacaacc caacagatat taaggctgct gctatcggtg tagcacatga tatctgtttt 840

tacgatcagc aagcatgttt ctccacccaa gatatttatt atattggcga tagcatagac 900

atattttttg atgaattagc tcagcaatta aataaatata aagacatatt gcctaaaggt 960

gagcggaatt ttgatgaaaa agcagctttt tctttaacgg aaagagaatg tttgtttgcc 1020

aaatataaag ttcaaaaagg tgaaagccaa tcttggttat taacgcaatc acctgcggga 1080

tcatttggta atcagccgtt atcacgctcg gcttatattc atcaagtaaa tgacatttca 1140

gaagtcattc cattcgtgca taaggcggta acgcaaaccg tcgcaatagc gccgtgggag 1200

tcgtctttca aatatagaga tatattagca gaacatggtg cagaacgaat tatagaagcc 1260

ggaatgaata atatatttcg agtaggtggc gcccatgatg ggatgcgtcc ccttcaacgg 1320

cttgttaact atatatcaca tgaaaggccg tcaacatata ccactaaaga tgtctcggtg 1380

aaaatcgaac agactcgtta tcttgaggaa gataagttcc tcgtatttgt accgtagaaa 1440

gagatatatc atggaaaata cacaacattc attacctatt gatcacgtaa ttgatattgg 1500

tgataaccgt tatattcgag tatgggaaac caagccgaaa aataaagaaa ccaagcgtaa 1560

taataccatc gttatcgcct caggctttgc tcgacgcatg gatcattttg ctggtcttgc 1620

cgaatattta gcaaataatg gttttcgtgt tattcgttat gattcgttaa atcatgtcgg 1680

tcttagtagc ggagagatca aacagttctc gatgtcagta ggtaaacaca gtttgctaac 1740

tgttattgat tggctaaaag aacgaaatat taacaatata ggtcttattg cttcgagtct 1800

ttctgctcga attgcttatg aagtggcagc agaaattgat ttgtcatttt taattaccgc 1860

cgtcggtgtt gtcaatttaa gaagtacgct agaaaaagca ctgaaatatg attatctaca 1920

aatggaagta aatactattc ctgaagattt aatttttgaa ggacacaatc taggttcaaa 1980

agtctttgtg acagattgtt ttgaaaataa ttgggactca ttagattcga caataaataa 2040

aatttgtgaa ctagatattc catttattgc tttcacttca gatggcgatg attgggtttg 2100

ccaacatgaa gtaaaacatt tagtcagtaa cgttaaatct gacaaaaaga aaatttactc 2160

actcgttggc tcatctcatg atttgggcga aaacctagtg gtgcttcgta acttctatca 2220

atcaatgacg aaagctgctg tgagcttaga tcgtcaatta gtagagcttg ttgatgaaat 2280

tattgaacca aattttgaag acctaacagt tattacggta aatgaacggc gcctcaaaaa 2340

taaaatcgaa aatgaaatta ttaatagatt agctgatcgc gtattggcta gtgtctaaat 2400

agtacttacc taagtacagc caaaaggaag aaataatgaa aattagtaat atctgtttct 2460

cataccaacc accaggtgaa tcacatcaag aggtaatgga gcgctttatt cgtttaggcg 2520

ttgcatcaga agagctcaac tttgatggtt tctatacact tgaacaccat ttcactgagt 2580

ttggtattac aggtaacctt tatattgcct gtgccaatat tcttggtcga accaaaagga 2640

tccaagtcgg taccatgggg atagtgttac cgacagagca cccagcacga catgtagaaa 2700

gtcttctcgt tttagatcaa ctgtctaaag ggcgctttaa ctacggtact gttcgcggac 2760

tctaccataa agattttcgt gtttttggta catcacagga agattctcgt aagaccgcag 2820

aaaatttcta ctctatgatc ttggatgcat caaaaacagg tgtgctacat actgacggtg 2880

aagtagtaga gttcccagat gtcaatgttt atccagaagc ttacagcaaa aaacaaccca 2940

cctgcatgac agccgaatca tccgagacca tcacttattt agctgaacgt ggtttaccaa 3000

tggtgttaag ttggattatt ccggtcagtg agaaagtctc acaaatggaa ttgtacaatg 3060

aagttgcggc agagcatggt catgacatta acaacattga acatatccta actttcattt 3120

gctctgtaaa tgaagacggt gaaaaagcag acagcgtatg ccgtaatttc ctagaaaatt 3180

ggtacgactc ttacaaaaat gcaaccaaca tcttcaacga cagtaaccaa actcgtggct 3240

acgattacct caaagctcag tggcgtgagt gggtaatgaa ggggttggct gatcctcgtc 3300

gccgacttga ttacagtaac gaattaaacc ctgtcggcac gccagaacga tgcattgaga 3360

tcattcaaag taatattgat gccactggaa ttaagcatat tactgttgga tttgaagcga 3420

atggttctga acaagaaatt cgtgaatcca tggagctatt tatggaaaaa gtagcgccac 3480

acttaaaaga tcctcagtaa gctgttcttt ttaaactatt caatatcaag gcataaggaa 3540

taaaatatga atttcgggtt atttttccta aatttccagc ctgaaggtat gacttcagaa 3600

atggttttag acaacatggt agatactgtc gcattagtgg ataaagatga ttaccacttt 3660

aaaagagtgc tcgtcagcga gcatcatttt tctaaaaacg gcattatcgg agaacctttg 3720

acagcgatta gcttcttact tggtttgact aaacgtatag aaattggttc tttaaatcaa 3780

gtgattacca cccatcatcc tgtacgtatc ggagaacaaa cgggcttact tgatcaaatg 3840

tcttacggtc gtttcgtttt aggcttaagt gactgtgtca atgacttcga aatggatttc 3900

tttaagagaa aacgtagctc tcaacagcaa caattcgaag catgttacga aattttaaat 3960

gaagcgctga cgacaaacta ttgtcaggca gatgatgact tctttaactt cccacgtatt 4020

tctgttaacc cgcattgtat tagcgaagta aaacaatata ttttagcttc aagcatgggc 4080

gtggttgaat gggcagcaag aaaaggattg ccactcactt accgctggag tgacagccta 4140

gcagaaaaag aaaaatacta tcagcgttat ctcgctgttg ctaaagagaa taatattgat 4200

gtatcaaata ttgaccacca attcccactg ctcgttaata tcaatgaaaa tcgtcgtatt 4260

gctcgagatg aagtaaggga gtatatacaa agttatgtga gtgaagccta ccctactgac 4320

cccaacattg agctaagagt agaagagctt attgagcagc atgctgtcgg caaagtggat 4380

gagtactacg actcaacaat gcacgcagta aaagttacag gttcaaaaaa tttattactc 4440

tcttttgaat caatgaaaaa taaagacgat gttaccaagc ttataaatat gtttaatcaa 4500

aaaatcaaag ataaccttat taaataattt aattacggat agatattttc gatatatcta 4560

agtcttacta ccatttatat aaactattta tacagataac gtttcatttg attaagtcag 4620

taaataattg ccattaatta atggcagtgc agatccttac actgccattt ataaattaaa 4680

taagggttaa catgtcaaca ttattaaata tagatgcaac tgaaattaag gtgagtacag 4740

aaatagatga tattattttt acatcatcac cgctaacgtt actatttgaa gatcaagaaa 4800

aaatacagaa agaacttatt ttggagtctt tccattatca ttacaatcat aataaagatt 4860

ataagtacta ttgtaatata caaggcgtag atgagaatat acagtccatt gacgatattc 4920

ctgtttttcc tacttcaatg ttcaagtact caagattaca tactgctgat gaatcaaata 4980

ttgaaaattg gtttactagt agtggtacaa agggagtcaa aagtcatata gctcgagatc 5040

ggcagagtat tgaacgcttg ctaggttctg ttaattacgg catgaaatac ttgggtgaat 5100

ttcacgagca tcaattagaa ctagtgaata tggggccaga tcgtttcagt gcgtcaaatg 5160

tttggtttaa atatgtaatg agcttagttc aattacttta cccaacaaca tttaccgttg 5220

aaaacgatga aatcgatttt gaacaaacca tcttagcgtt aaaagcaatt cagcgtaaag 5280

gaaaaggaat ttgtttaatt ggccctccgt attttattta tttgttatgc cactacatga 5340

aagagcataa tatcgaattt aatgctggtg cacatatgtt tatcattaca ggtgggggat 5400

ggaaaaccaa acaaaaagaa gcgctaaacc gacaagattt caatcaacta ttgatggaga 5460

cttttagcct tttccatgaa agtcaaattc gagatatctt taaccaagta gagctaaaca 5520

cttgtttctt tgaagacagc ctacagcgta aacatgtacc accgtgggta tatgctcgtg 5580

cgcttgatcc tgtcacttta acgcccgtag aagatggcca agagggcttg atgagttata 5640

tggatgcctc atctaccagc tacccgacat ttattgttac cgacgatatt ggtattgttc 5700

gccatctaaa agaaccagat ccattccaag gaacaacggt tgaaattgtt cgtcgtttaa 5760

atacgcgaga acaaaaagga tgttcactct caatggccac gagcctgaaa taaaagcagg 5820

gcttaatcat gatttttaat tgcaaggtta aaaaagtcga agcatctgac agccatattt 5880

acaaagtgtt tattaagcct gacaaatgct ttgattttaa agcgggtcaa tatgtaattg 5940

tgtatctcaa tggaaaaaat ttgccgtttt ctattgctaa ctgcccaact tgtaatgagc 6000

tccttgaatt acatgtagga ggttcggtaa aagaatccgc cattgaagct atttcgcact 6060

ttattaatgc atttatttat caaaaagaat ttacaatcga tgcaccacac ggtgatgcat 6120

ggctgagaga tgaaagccaa tcacctttac tacttatagc aggagggaca ggtttatcat 6180

atatcaatag cattttaagt tgttgtatta gtaaacagtt atctcagcct atctatcttt 6240

attggggagt aaataactgt aatttactct atgctgatca acaactaaaa acactcgccg 6300

cacaatacag aaatataaat tatattcctg tggtagagaa tttaaatact gactggcagg 6360

gaaaaattgg taatgttatt gacgcggtta ttgaagattt ttcagattta tctgactttg 6420

atatctatgt ctgcgggcca tttggtatga gccggactgc gaaagatatt ctgatctcac 6480

agaaaaaggc gaatatagga aaaatgtatt ctgatgcatt tagctatacg taa 6533

<210> 2

<211> 206

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

cgcatacctc gcctttgtga acctctaatt accactgact ctatccgggc tttgcccgtt 60

agaccatcag tgggcattaa tagtcgacat gcttgtcatc gattgggcac ctgactttcc 120

ctgcgattgg tccccctaaa cccgtgcagg gtaacagcct ttggccttaa gattcacctc 180

tgccccacat taggcgaagc gcaccg 206

<210> 3

<211> 1117

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atggaaatca aatcttccgc acacattctg gtggttgacg acgatttacg gctacggagt 60

ctggtggaag cacacctccg tcaggtgggg tttactgtcg acggagtgcg tgatggccaa 120

ggactcgatc ataaacttca cgggggggag gtagatttga tcatactcga tttgggcttg 180

cccgatgagg atggtcttca gatttgtcag cgcctacgcc tgacatacga tacccctatc 240

ctgatactga cggcccgtgg ggatgaggtg gatcgcatac ttgggttgga gatgggcgcc 300

gacgattacc tatcaaaacc ttttcatcca cgggagttaa tcgctcgtgt tcaggctata 360

ctgcgaagaa caaagcccat gaacaggggt cgccagcacg ccgatgagcc agaaatatgt 420

atgaagggcg cttttgtggt ggacacgcgc cgtcaaaaaa ttctgtggcg gggagaaccg 480

ttagagttat cacaagccga ttttcagaca ctttctacgc ttatcaagca cgagggacaa 540

ccgctcagtc gggaacggct catgcttctg agtcggggcc gaacctatgc gtcggatgac 600

cgaaccatag acatgcagat ctcgcgatta cgaaagctac tcgattccaa aaccgacggt 660

gctcagcaca ttcgcacagt atggggtagc ggatacatgt ttctctccga accatgaagg 720

tccggtttct tcttgttgat cgtggtacgc atctcgaagc gccgattgtg tacagaatga 780

acagtggcga gtctgctcgg caacccggac atgggatggg aatcgggttg atgatttgtc 840

atcgcatcat ggcattgcac aagggctctt tgcatttcac atcagaggat gggctggcgg 900

caaccatttg ccttccgaga gtacaagatg gagtaacatc ggcacagaga caggaattca 960

acgcacgtaa attgtaacac ctgttacacc tgttacaact tgttacataa gctaaaactt 1020

atatgcaatt gtctcctatg ggccccgagt atactatccg aagcgcggcg tagttatgcc 1080

cctagacaac gtattagcga ttcggagatt atatatc 1117

<210> 4

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

tcgacaagct tgcggccgca tgattaagaa gatcccaatg 40

<210> 5

<211> 41

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

taccagactc gagggtacct tacgtatagc taaatgcatc a 41

<210> 6

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

gagctcggcg cgcctgcagc gcatacctcg cctttgtgaa 40

<210> 7

<211> 39

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

caagcttgtc gacctgcagc ggtgcgcttc gcctaatgt 39

<210> 8

<211> 39

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

tcgacaagct tgcggccgca tggaaatcaa atcttccgc 39

<210> 9

<211> 39

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

ttcttaatca tgcggccgcg atatataatc tccgaatcg 39

Claims

1. A method for preparing an explosive molecule biosensor synthesized by using a regulatory element, which is characterized by comprising the following steps:

(1) Amplified self-luminous operonluxABCDE After the fragment of the operon gene was purified and recovered, the plasmid pACYCDuet-1 was digested simultaneously with Not I and Kpn I, and then digested simultaneously with Not I and Kpn IluxABCDEThe operon gene fragment and the plasmid enzyme section are connected in a molar ratio of 2-5:1, the connection product is transformed into competent cells of the escherichia coli, positive clones are screened on an LB solid plate containing antibiotics, and recombinant plasmid p-type is obtainedluxPleio；

(2) Amplifying the promoter nahR gene fragment, purifying and recovering, and then mixing with recombinant plasmid p-luxPleioCarrying out single enzyme digestion by using PstI, connecting plasmid enzyme digestion fragments and nahR gene fragments in a molar ratio of 2-5:1, transforming the connection products into competent cells of the escherichia coli, screening positive clones on LB solid plates containing antibiotics, and obtaining recombinant plasmids p-nahR-luxpleio；

(3) Amplification regulatory protein RsrRtetHThe promoter gene fragment is purified and recovered, and then the promoter gene fragment and the recombinant plasmid p-nahR- luxpleioSingle cleavage with NotI, plasmid cleavage fragment with RsrR-P _tetH The gene segments are connected in a molar ratio of 2-5:1, the connection products are transformed into competent cells of the escherichia coli, positive clones are screened on LB solid plates containing antibiotics, and recombinant plasmids p-nahR-RsrR-P _tetH -luxpleio；

(4) Recombinant plasmid p-nahR-RsrR-P _tetH -luxpleioE.coli competent cells are transformed, positive clones are screened on LB solid plates containing antibiotics, and engineering strain MR-12 is obtained;

(5) Culturing and activating the engineering strain MR-12 in LB liquid culture medium containing antibiotics, and then transferring to M9 liquid culture medium which takes glucose as a carbon source and contains magnesium ions for culture to obtain an explosive molecule biosensor synthesized by utilizing a regulatory element;

the self-luminous operatorluxABCDEThe operans originate from: is a Protobacter fabarum;

the self-luminous operatorluxABCDEThe nucleotide sequence of the OPERon is shown as SEQ ID No. 1;

the nucleotide sequence of the promoter nahR is shown as SEQ ID No. 2;

the regulatory protein RsrRtetHThe nucleotide sequence of the promoter is shown as SEQ ID No. 3;

in the step (5), the engineering strain MR-12 is cultured and activated in LB liquid medium containing chloramphenicol, and then transferred to M9 liquid medium added with 60% glucose and 1M magnesium sulfate solution for culture and growth until OD ₆₀₀ =0.2, an explosive molecule biosensor synthesized using regulatory elements was obtained.

2. An explosive molecule biosensor synthesized by a regulatory element prepared by the method for preparing an explosive molecule biosensor synthesized by a regulatory element according to claim 1.

3. Use of an explosives molecular biosensor synthesized with regulatory elements according to claim 2 for real-time detection of explosives molecules.

4. A method for real-time detection of an explosive molecule using the explosive molecule biosensor synthesized using a regulatory element according to claim 2, comprising: uniformly mixing an explosive molecular biological sensor and a sample to be detected in a volume ratio of 9:1, adding a black ELISA plate, and sealing, wherein on one hand, a scientific research-grade CCD camera is used for photographing and detecting exposure 30 s; on the other hand, the fluorescence intensity RLU value is monitored in real time at constant temperature by using an enzyme-labeled instrument, and the monitoring is carried out every 10-20min, and 15-25h are monitored altogether.

5. The method of claim 4, wherein the concentration of the explosive molecules that can be sensed by the explosive molecule biosensor is 10 μg/L and the explosive molecules are 2,4-DNT.