KR101598907B1 - Artificial biosensor for non-degradable harmful aromatic compound detection using remodeled sensing protein and manufacturing method thereof - Google Patents

Abstract

The present invention relates to a method for detecting a degradable harmful aromatic compound comprising a promoter of tod ST gene derived from Pseudomonas putida , a simplified tod S * and tod T gene in which the HK2 domain of the wild type tod S gene is directly linked to the PAS1 domain The redesigned protein expression vector is linked to the promoter of the tod X gene derived from Pseudomonas putida . The marker protein expression cassette is inserted into the chromosome of the host cell, and the recombinant strain expressing the marker protein is transformed into a recombinant strain, An artificial biosensor for detecting a harmful aromatic compound is easier than conventional methods for detecting a harmful aromatic compound and is excellent in its specificity and sensitivity, and thus can be easily used for detecting a harmful aromatic compound.

Description

TECHNICAL FIELD The present invention relates to an artificial biosensor for detecting a harmful aromatic compound using a redesigned sensing protein and a method for manufacturing the same,

TECHNICAL FIELD The present invention relates to an artificial biosensor for detecting degradable harmful aromatic compounds using a redesigned sensing protein and a method for producing the same.

When a degradable aromatic compound is released into the body through a food chain or other pathway, it usually reacts with a polymer such as DNA or protein in its structural similarity and high reactivity to act as a carcinogen or an environmental hormone. Examples are dioxins emitted from automobile emissions and waste burning processes, which not only cause cancer but also cause reproductive and immune system abnormalities. Therefore, refractory aromatics introduced into nature are classified as environmental toxic substances which should be removed in advanced countries. In order to measure such a degradable aromatic compound, an instrumental chemical method is utilized, but it takes a long time due to a high cost due to an enormous amount of equipment and complicated treatment, and it is not easy for anyone to utilize it. to be. Also, these heavy equipment can not be used in the field. Therefore, it is important to develop technologies to detect degradation aromatic compounds more quickly, simply, and inexpensively, in terms of the national social aspect, which requires implementation of the Stockholm environmental conventions, and the economic and environmental technological aspects of solving problems at high cost and field applications , A biodegradable aromatic compound measurement biosensor development, 2004).

BTEX compounds, which are representative of volatile organic compounds (VOCs), refer to benzene, toluene, ethylbenzene and xylene. Recently, due to the rapid growth of industrial activities, Substances are being released into the natural environment, especially those leaks and accidents in the oil reservoirs of BTEX compounds, and environmental pollution due to widespread use in industry. Most of the VOCs have been found to be toxic organic chemicals that cause carcinogenesis. Therefore, the pollution caused by volatile organic substances in drinking water Guidelines and legislation have been strengthened. In order to measure such BTEX, conventionally, chromatographic-mass spectrometry (GC-MS) has been utilized by an instrumental chemical method. However, such a method is costly, takes a long time due to complicated processing, Is not easy to use and requires a heavy equipment and there is a limitation in usage that can not be utilized in the field (Korean Application No. 10-2003-0011554). Therefore, it has been found that 2,4,6-trinitrotoluene (TNT) and 2,4-dinitrotoluene (DNT), which are toluene-based compounds derived from explosives and BTEX compounds (benzene, toluene, ethylbenzene, xylene) ) Efforts to develop technologies for efficiently detecting and removing harmful aromatic compounds have been continuing.

A biosensor is a device capable of selectively sensing a substance to be analyzed by converting a biological receptor having a recognition function for a specific substance into an electric or optical signal by combining with an electric or optical transducer to convert a biological interaction and a recognition reaction into an electric or optical signal Is an analytical technique that can quickly and accurately detect substances in a variety of environments at low concentrations. Biosensors are largely divided into protein-based and cell-based methods. Cell-based whole-cell biosensors are used in terms of biological applications, selectivity, convenience, and measurement sensitivity. A lot of research is being done. The whole-cell biosensor is composed of a promoter capable of specifically reacting with toxicities caused by environmental pollutants, a gene consisting of a labeled protein system such as beta-galactosidase or firefly luciferase, It is a state-of-the-art bio-monitoring technology that can be applied to the measurement of environmental pollution of rivers, lakes, and sewage, sewage, and soil using engineered modified recombinant cells.

In addition, some microorganisms including Pseudomonas putida have been reported to have the ability to adapt to toxic substances such as harmful aromatic compounds and decompose them (Ramos-Gonzalez, Olson et al. 2002) . The TodST 2-signaling system, a signal transduction system that regulates the expression of genes involved in the detection of toxic aromatic compounds such as Pseudomonas putida, is composed of TodS sensing protein and TodT regulatory protein. Toluene sensing and signaling Complex multiphase phosphate transfer reaction. Finally, the phosphorylated TodT protein attaches to the target gene promoter (for example, the tod X gene promoter) and regulates its expression. Recently, a biosensor for detecting degradation-resistant harmful aromatic compounds has been produced by using the TodST 2 -character signal transduction system of Pseudomonas putida (Japanese Patent Laid-Open No. 10-2013-0054669). However, the wild-type TodS detection protein can not recognize o-xylene and 1,2,4-trimethylbenzene. In particular, o-xylene and 1,2,4-trimethylbenzene are frequently used as raw materials for industrial purposes, and biosensors capable of detecting these substances are required because they exhibit toxicity to humans.

Therefore, the inventors of the present invention have developed a simplified TodS (PAS1) domain that directly connects the HK2 domain, which is the last domain for transferring a phosphate group from TodS to TodT, into the PAS1 domain that recognizes an aromatic compound in five TodS domains (PAS1, HK1, RR1, PAS2 and HK2) (TodS *), and the artificial biosensor fabricated using TodS * was able to detect the presence of o-xylene and 1,2,4-trimethylbenzene ) And effectively transmits the signal to TodT to induce the expression of the marker protein gene linked to the target promoter, thereby completing the present invention.

Bagdasarian, M., et al., Specific-purpose plasmid cloning vectors. II. Broad host range, high copy number, RSF1010-derived vectors, and a host-vector system for gene cloning in Pseudomonas. Gene, 1981, 16 (1-3): 237-247. Vick, J. E., et al., Optimized compatible set of BioBrick vectors for metabolic pathway engineering. Appl Microbiol Biotechnol, 2011. 92 (6): p. 1275-86. Dykxhoorn, D. M., R. St Pierre, and T. Linn, A set of compatible tac promoter expression vectors. Gene, 1996. 177 (1-2): 133-136. H. Silva-Jimenez, J.L. Ramos, T. Krell, Construction of a prototype two-component system from the phosphorelay system todS / todT. PEDS, 2012. 25: 159-169.

An object of the present invention is to provide an artificial biosensor for detecting a degradable harmful aromatic compound and a method for producing the artificial biosensor, wherein the signaling protein domain derived from Pseudomonas putida is redesigned and introduced into a recombinant strain expressing a labeled protein using a regulated target promoter .

In order to achieve the above object,

The present invention is the Pseudomonas footage is (Pseudomonas putida) derived tod ST operon promoter, redesigned protein for detection including a tod S * and tod T gene simplified by directly connecting the PAS1 domain and HK2 domain of tod S gene of the vector to provide.

Also, the present invention provides a recombinant strain expressing a marker protein in which a marker protein expression cassette linked to the promoter of the tod X gene derived from Pseudomonas putida is inserted into the chromosome of the host cell.

Also, the present invention provides an artificial biosensor strain for detecting a degradable harmful aromatic compound, which is obtained by transforming a protein expression vector for detection into a recombinant strain expressing a marker protein.

In addition,

1) preparing an artificial biosensor strain transformed with the redesigned protein expression vector for the detection protein recombinant strain; And

2) measuring the expression level of the labeled protein of the artificial biosensor strain treated with the test sample; And

3) a step of judging that a harmful aromatic compound is contained in the test sample when the expression level of the labeled protein of step 2) is increased as compared with that of the control sample.

I material for detecting decomposable harmful aromatics containing Pseudomonas footage is tod S * and tod T gene simplified one (Pseudomonas putida) direct PAS1 domain and HK2 domain of the promoter, tod S gene derived from the tod ST operon of the present invention The design protein expression vector is linked to the promoter of the tod X gene derived from Pseudomonas putida . The marker protein expression cassette is inserted into the genome of the host cell. The recombinant strain expressing the marker protein contains the transformed strain and the degradable harmful aromatic compound The artificial biosensor for detection is easier to detect than the conventional method for detecting harmful aromatic compounds, and has excellent specificity and sensitivity, so that it can be easily used for the detection of harmful aromatic compounds.

FIG. 1A is a schematic diagram showing a pBBRBB-proTodST vector. FIG.
1B is a diagram showing a structure of a U2 vector.
FIG. 2A shows sfGFP fluorescence measurement of a U2 vector or a control vector transformant in the presence of o-xylene. FIG.
FIG. 2B is a diagram showing sfGFP fluorescence measurement of a U2 vector or a control vector transformant in the presence of 1,2,4-TMB.

Hereinafter, the present invention will be described in detail.

The present invention provides Pseudomonas footage is (Pseudomonas putida) derived tod ST operon promoter, redesigned protein expression vector comprising a tod S * and tod T gene simplified by directly connecting the PAS1 domain and HK2 domain of tod S gene of .

Specifically, the promoter of the tod ST operon is not limited to those having the nucleotide sequence of SEQ ID NO: 18.

Specifically, the todS gene has a nucleotide sequence of SEQ ID NO: 19, but is not limited thereto.

The tod S * gene simplified by directly connecting the PAS1 domain and HK2 domain of the S gene would tod having the nucleotide sequence of SEQ ID NO: 20 Specifically, the present invention is not limited thereto.

Specifically, the tod T gene has a nucleotide sequence of SEQ ID NO: 21, but is not limited thereto.

The tod promoter of ST operon, tod S gene simplified tod S * gene is connected directly to the PAS1 domain and HK2 domain of, and tod T gene is the same in the base sequences of SEQ ID NO: 18, SEQ ID NO: 20, and SEQ ID NO: 21 As long as it has activity, one or several bases may be composed of base sequences added, deleted or substituted.

The tod ST operon promoter, tod S tod the PAS1 domain and directly to a simplification of the HK2 domain of the gene of S * gene, and tod T gene are shown in SEQ ID No. 18, SEQ ID NO: 20, and the nucleotide sequence 80 of SEQ ID NO: 21 But is not limited to, a nucleotide sequence having at least 90% homology, more particularly 90% homology, and most particularly 95%, 96%, 97%, 98%, 99% or 99.5% .

The redesigned protein expression vector may be an expression vector represented by the cleavage map shown in FIG. 1B, but is not limited thereto. The tod T gene, the promoter of the tod ST operon, and the PAS1 domain and the HK2 domain of the tod S gene, May be all other vectors at the insertion point of the simplified tod S * gene.

The redesigned protein expression vector may be a U2 vector or an expression vector represented by the nucleotide sequence of SEQ ID NO: 23, but may be composed of a base sequence in which one or several bases are added, deleted, or substituted as long as they have the same activity, is inserted tod T gene, ST tod operon promoter and the S gene of the tod PAS1 the location of the domain and the tod genes S * a simplified direct HK2 domain can be any other vector.

In addition, the present invention provides a recombinant strain expressing a marker protein, wherein the redesigned protein expression vector is linked to a promoter of a tod X gene derived from Pseudomonas putida into a chromosome of a host cell, An artificial biosensor for detecting a harmful aromatic compound is provided.

The promoter of the tod X gene derived from Pseudomonas putida is specifically but not limited to those having the nucleotide sequence of SEQ ID NO: 22.

The promoter of the tod X gene derived from Pseudomonas putida may be composed of a nucleotide sequence in which one or several bases are added, deleted or substituted as long as they have the same activity in the nucleotide sequence of SEQ ID NO: 22.

The promoter of the Pseudomonas putida- derived tod X gene has 80% or more homology, more specifically 90% or more homology, most specifically 95%, 96%, 97%, 98% or more homology to the nucleotide sequence of SEQ ID NO: , 99% or 99.5% homology with the nucleotide sequence shown in SEQ ID NO.

The labeling protein specifically includes a fluorescent protein (GFP), a superfolding fluorescent protein (sfGFP), an alkaline phosphatase, a firefly luciferase, a bioluminescent microorganism ( Vibrio , Nord Havre Douce (Xenorhabdus), picture Le Havre Douce (Photorhabdus), and photo tumefaciens (Photobacterium), etc.] derived from a light emitting enzyme, and beta-galactosidase will be selected from the group consisting of (β-galactosidase), and more particularly (GFP), or superfolding fluorescent protein (sfGFP), but are not limited thereto.

The recalcitrant harmful aromatic compound is a BTEX compound [benzene, toluene, ethylbenzene, xylene] and specifically includes o-xylene and 1, But is not limited to, 2,4-trimethylbenzene.

The host cell may be a prokaryotic microorganism or a eukaryotic microorganism. Specifically, the prokaryotic microorganism may be E. coli or Pseudomonas putida , but is not limited thereto.

The present invention also provides a method for producing an artificial biosensor for detecting a harmful aromatic compound as described below.

i) securing a promoter fragment of the todST operon of P. putida F1;

ii) cloning the ensured Ptodst fragment of step i) into a vector;

iii) securing the tod S * and tod T genes to translate the simplified TodS * sense protein and the TodT regulatory protein directly linked to the PAS1 domain and the HK2 domain;

iv) cloning the obtained tod S * T gene of step iii) into a vector containing tod ST operon promoter;

v) securing the promoter sequence of the tod X gene whose expression is regulated by the TodS * T system;

vi) constructing a labeled protein expression cassette by ligating to the labeled protein using the obtained sequence of step v);

vii) inserting a labeled protein expression cassette of step vi) into a specific site on the chromosome in a single copy to prepare a stable recombinant expression vector for a labeled protein; And

viii) a method for producing an artificial biosensor for detecting a malodorous aromatic compound, which comprises the step of transforming a redesigned redesigned harmful aromatic compound detection compound of step iv) into a recombinant strain expressing a labeled protein of step vii) to provide.

In addition,

1) measuring the expression level of the labeled protein of the artificial biosensor for detecting the degradable harmful aromatic compound treated with the test sample; And

2) a step of judging that a harmful aromatic compound is contained in the test sample when the level of expression of the marker protein of step 1) is increased as compared with that of the control sample.

In the above detection method, the test sample in step 1) is a substance derived specifically from the environment, but is not limited thereto.

In this method, the level of expression in step 2) is specifically determined by photomultipliers, charge coupled devices, luminometers, photometers, fiber optic cables and liquid scintillation counter scintillation counter), but the present invention is not limited thereto.

As a result of measuring the expression of the labeled protein in the culturing conditions containing the harmful aromatic compounds having various concentrations of the transformed microorganism of the present invention, it was confirmed that the corresponding aromatic compound can be detected with high sensitivity, The simplified tod S * gene and the Pseudomonas putida-derived tod T gene, which are directly linked to the PAS1 domain and the HK2 domain of the Pseudomonas putida- derived tod S gene of the present invention, The redesigned protein expression vector linked to the promoter of the multi-derived tod ST operon is linked to the promoter of the tod X gene derived from Pseudomonas putida. The transformant transformed into the recombinant strain expressing the tagged protein in which the cassette is inserted into the chromosome is the degradable Artificial Biosensor for Detecting Aromatic Compounds It can be effectively used.

In a specific embodiment of the present invention, in order to prepare a control vector (pBBRBB-proTODST), the promoter of the tod ST gene was amplified by PCR using a primer pair, treated with a restriction enzyme, and ligated with a vector treated with the same restriction enzyme lt; / RTI > Then, the vector (pBBRBB-PtodST) in which the promoter was inserted was treated with a restriction enzyme and ligated to the tod ST gene treated with the same restriction enzyme to prepare pBBRBB-proTodST (FIG. 1A).

In a specific embodiment of the present invention, in order to produce a U2 vector used in the artificial biosensor production of the present invention, pEXT20-TodST (Patent No. 10-2013-0054669) The gene sequences containing the simplified tod S * and tod T genes directly linked to the domains were amplified and self-ligated by restriction enzyme treatment. Then, the constructed vector was treated with a restriction enzyme to isolate and purify the tod S * T (insert) gene portion. The vector (pBBRBB-PtodST) inserted with the promoter was treated with a restriction enzyme and ligated to produce U2 Respectively.

Also, in a specific embodiment of the present invention, in order to bind the marker protein gene to the promoter of Pseudomonas putida tod X gene, the tod X promoter region and the marker protein gene are respectively amplified by PCR amplification, fusion) PCR to construct a P tod X :: tagged gene expression cassette and cloned into a vector for chromosome insertion. The vector was then transformed into P. putida KT2440. Body from the transformed transition P tod X :: marker protein gene expression cassette in a single copy stably introduced into the chromosome of the host cell recombinant strain P. putida KT2440 Δ mex C :: P tod X (LS) :: sfgfp the strain Respectively.

Also in a particular embodiment of the invention, the cloning of pBBRBB-proTodST and U2 P tod X :: marker protein gene expression cassette that is inserted into the chromosome of Pseudomonas footage (Pseudomonas putida) KT2440 Δ mex C :: P tod X ( LS) :: sfgfp , the detection ability of the degradable aromatic compound was confirmed, and the detection ability of the degradable aromatic compound in the U2 vector transformant was remarkably stronger than that of the control group (Figs. 2a and 2b).

Hereinafter, the present invention will be described in detail with reference to examples.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

≪ Example 1 >

1. pBBRBB-proTODST

In order to clone the promoter of the todST operon of P. putida F1 ( tod ST promoter) into the pBBRBB-eGFP vector, first, the genomic DNA of P. putida F1 was used as a template and the pair of primers PtodST-F and PtodST -R, PCR amplification (PCR conditions: 94 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 30 seconds, 30 cycles) of the promoter of the tod ST gene was performed and the cells were treated with Nsi I and Xba I restriction enzymes , Purified pure with gel purification, treated with the same restriction enzyme, and ligated with gel-purified pBBRBB-eGFP vector. The vector was transformed into Escherichia coli DH5α and a positive clone was selected by PCR using a pair of PCR primers PtodST-F and PtodST-R in a transformant to obtain pBBRBB-PtodST Respectively. Then, the tod ST operon (3.6 kb) fragment was treated with Sac I and Hind III restriction enzymes in pEXT20-todST (Patent No. 10-2013-0054669), and purified by gel purification, and the same restriction enzyme-treated pBBRBB -PtodST vector to transform E. coli DH5α and then positive clone was selected by confirmation PCR using primer pair PtodST-F and todST-R in a transformant. To obtain pBBRBB-proTODST (Fig. 1A).

Primer sequence primer The primer sequence (5'to 3') Target todSe-D (SEQ ID NO: 1) ATA AGATCT CAGCAACAACTTGTGTACGTT ( Bgl II)
pEXT20-U2 todSe-U2 (SEQ ID NO: 2) ATA AGATCT CTGCTCCAATTCCTGGTTCTT ( Bgl II)
pEXT20-U2 PtodST-F (SEQ ID NO: 3) TAT ATGCAT CTCGAGAAACGAGCCCAGTAC ( Nsi I)
P. putida F1 PtodST-R (SEQ ID NO: 4) CCC TCTAGA AGCTTGCTATTACCTCTCTTCCACC ( Xba I)
P. putida F1 todST-R (SEQ ID NO: 5) TAT AAGCTT CTATTCCAGGCTATCCTT ( Hind III)
P. putida F1

* Underlined sequences indicate the restriction site of each restriction enzyme

2. U2

2-1. pEXT20-U2

Except for the sequence corresponding to the HK1, RR1, and PAS2 domains of TodS using primers pDT20-todST (Patent No. 10-2013-0054669) as primers and todSe-D and todSe-U2 as primers, PCR conditions: 94 ° C. for 30 seconds, 53 ° C. for 30 seconds, and 72 ° C. for 7 minutes for 30 cycles), followed by gel purification and self-ligation with Bgl II restriction enzyme. Subsequently, a positive clone was selected by transformation into E. coli DH5α, and a pSET20-U2 vector expressing the TodS * mutant protein directly linked to the PAS1 domain and the HK2 domain of TodS through the base sequence analysis was obtained Respectively.

2-2. U2

The pEXT20-U2 constructed above was treated with Sac I and Hind III restriction enzymes to separate the tod S * T operon fragment from the agarose gel and purified pure. The thus-obtained DNA fragment was treated with Sac I and Hind III restriction enzymes, ligated with pBBRBB-PtodST vector fragment isolated and purified from agarose gel, and transformed into E. coli DH5α to obtain a positive clone ). Then, U2 vector expressing TodS * protein and TodT protein was obtained using the tod ST promoter through sequencing (FIG. 1b).

≪ Example 2 > P. putida  Expression of superfolding GFP (sfGFP) in KT2440

The present inventors constructed a vector to insert a marker protein expression cassette into the chromosome of P. putida KT2440.

Specifically, the first P. putida KT2440 genome (genomic) DNA of the template in order to insert a marker protein expression cassette on mex C locus of P. putida KT2440 <Table 2> primer pairs mexCn-u and a-d and the mexCn mexCc-u and d, respectively mexCc-PCR amplify the N- terminus and the C- terminal fragment of 0.5 kb mex C gene using (PCR conditions: 94 ℃ 30 cho, 55 ℃ 30 cho, 72 ℃ 30 cho, 30 cycle) Respectively. After purification of the PCR product, the N-terminal fragment was treated with Eco RI and Bam HI restriction enzymes, and the c-terminal fragment was gel-eluted with Bam HI and Sph I restriction enzymes. These purified fragments were treated with Eco RI and Sph I restriction enzymes and inserted into gel purified pBR322 vector to obtain pSYK124. Then, a P tod X (LS) :: sfgfp gene cassette containing an artificial non-translational leader sequence promoting protein translation was prepared by fusion PCR. That is, the promoter region of the tod X (LS) gene was amplified by PCR using the primer pair NPtodX-F and NPtodX-R in Table 2. The sfgfp gene was amplified by PCR using the primer pair PXsfGFP-F and sfGFP-rrnB- Respectively. Then, the PCR products were purified using a PCR purification kit. Fusion PCR was performed using the purified PCR products as a template and primer pairs NPtodX-F and sfGFP-rrnB-R. The PCR product was purified, treated with Bgl II restriction enzyme, and then gel eluted. The P tod X (LS) :: sfgfp fusion cassette was inserted into pSYK124 vector treated with Bam HI restriction enzyme and dephosphorylated to obtain pSYK138 (6.538 kb) vector. The above pSYK138 was amplified by PCR using primer pair mexC-F and mexC-R as a template to obtain a mex C :: P tod X (LS) :: sfgfp :: mex C insertion cassette. The PCR products were purified, treated with Bgl II restriction enzyme, gel eluted, and then treated with Bam HI restriction enzyme and inserted into the deoxyphosphorylated pK18mobsacB vector to obtain pSYK139 (8.460 kb) . After pSYK139 was transformed into P. putida KT2440, the primer pairs ID_mexC-F and N-PtodX-R, and PtodX-sfGFP-F and ID_mexC-N were used as a diagnostic (diagnostic ) PCR was performed to obtain the labeled protein The expression cassette P tod X (LS) :: sfgfp was inserted into the chromosome mex C gene position.

Primer sequence primer Primer sequence (5 'to 3') ^a Target mexCn-u
(SEQ ID NO: 6) AAA GAATTC GCAAGACAGGTTCGATAAGGGTG ( Eco RI) P. putida KT2440 mexCn-d
(SEQ ID NO: 7) AAA GGATCC AATGCGCCCGGAGATCGG (Bam HI) P. putida KT2440 mexCc-u
(SEQ ID NO: 8) AAA GGATCC GATATCCAGCAACTCGACCCG (Bam HI) P. putida KT2440 mexCc-d
(SEQ ID NO: 9) TTT GCATGC GTTTCTGCGCAGGCGCAACG ( Sph I) P. putida KT2440 NPtodX-F
(SEQ ID NO: 10) GA AGATCT CAGGTTATCAACCTGCTCGTGG ( Bgl II) pEXT21-todST-PtodX-lacZ NPtodX-R
(SEQ ID NO: 11) AGCTGTTTCCTGTGTGATAAAGAAAGTTAAAATGCC pEXT21-todST-PtodX-lacZ PXsfGFP-F
(SEQ ID NO: 12) ATCACACAGGAAACAGCTATGAGCAAAGGTGAAGAACTGTTTACC pHCEIIB sfGFP sfGFP-RRnB-R
(SEQ ID NO: 13) GA AGATCT AGAGTTTGTAGAAACGCAAAAAGG ( Bgl II) pHCEIIB sfGFP ID_mexC-F
(SEQ ID NO: 14) TTCGTTGCACGCCTTCCTGG recombinant P. putida KT2440 ID_mexC-N
(SEQ ID NO: 15) ACTGCTGGTAGATCACCCCC recombinant P. putida KT2440 mexC-F
(SEQ ID NO: 16) GA AGATCT GCAAGACAGGTTCGATAAGGGTG ( Bgl II) pSYK138 mexC-R
(SEQ ID NO: 17) GA AGATCT GTTTCTGCGCAGGCGCAACG ( Bgl II) pSYK138

* Underlined sequences indicate the restriction site of each restriction enzyme

Example 3 Detection of Hazardous Aromatic Compounds with Artificial Biosensors

The present inventors have succeeded in transforming the cloned pBBRBB-proTODST and U2 into Pseudomonas putida KT2440? MexC :: P tod X (LS) :: sfgfp and then transformed into o-xylene or 1 , And 2,4-trimethylbenzene (1,2,4-TMB).

Specifically, Luria-Bertani (LB) medium (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L) before the cultured Pseudomonas footage or more in 30 ℃ 18 hours using KT2440 Δ mex C :: P tod X (LS) :: sfgfp culture was centrifuged to remove the supernatant, followed by washing with 10% glycerol in the same volume as the culture medium, and then concentrated to 10% glycerol in 1/100 volume To prepare a competent cell for transfection. The recipient cells were transformed with pBBRBB-proTODST or U2 vector by electroporation and cultured on LB plate medium containing 50 μg / ml kanamycin (Km). Each single transformant was isolated and inoculated into LB liquid medium containing 50 μg / ml kanamycin (Km) at a final concentration, pre-cultured at 30 ° C. for 12 hours or more, -xylene or 1,2,4-TMB was added to the LB-Km liquid medium, and cultured at 30 ° C for 6 hours, followed by centrifugation to recover the cells. Thereafter, the cells were washed with PBS (phosphate buffered saline; NaCl 8 g / l, KCl 0.2 g / l, Na ₂ HPO ₄ 1.44 g / l, KH ₂ PO ₄ 0.24 g / l pH 7.4) The cells were suspended in PBS so as to have the same cell amount and then excited with an excitation wavelength of 485 nm and an emission wavelength of 535 nm using a multiplate reader (SpectraMax i3, Molecular Devices; Sunnyvale, CA) Fluorescence was confirmed.

As a result, it was observed that fluorescence intensity of o-xylene and 1,2,4-TMB added to the U2 vector transformant was remarkably stronger than that of the control (Figs. 2a and 2b).

<110> Korea Research Institute of Bioscience and Biotechnology <120> Artificial biosensor for non-degradable harmful aromatic compound          detection using remodeled sensing protein and manufacturing          method thereof <130> 2014p-05-010 <160> 23 <170> Kopatentin 2.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> todSe-D <400> 1 ataagatctc agcaacaact tgtgtacgtt 30 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> todSe-U2 <400> 2 ataagatctc tgctccaatt cctggttctt 30 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> PtodST-F <400> 3 tatatgcatc tcgagaaacg agcccagtac 30 <210> 4 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> PtodST-R <400> 4 ccctctagaa gcttgctatt acctctcttc cacc 34 <210> 5 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> todST-R <400> 5 tataagcttc tattccaggc tatcctt 27 <210> 6 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> mexCn-u <400> 6 aaagaattcg caagacaggt tcgataaggg tg 32 <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> mexCn-d <400> 7 aaaggatcca atgcgcccgg agatcgg 27 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> mexCc-u <400> 8 aaaggatccg atatccagca actcgacccg 30 <210> 9 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> mexCc-d <400> 9 tttgcatgcg tttctgcgca ggcgcaacg 29 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> NPtodX-F <400> 10 gaagatctca ggttatcaac ctgctcgtgg 30 <210> 11 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> NPtodX-R <400> 11 agctgtttcc tgtgtgataa agaaagttaa aatgcc 36 <210> 12 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> PXsfGFP-F <400> 12 atacacacagg aaacagctat gagcaaaggt gaagaactgt ttacc 45 <210> 13 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> sfGFP-rrnB-R <400> 13 gaagatctag agtttgtaga aacgcaaaaa gg 32 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > ID_mexC-F <400> 14 ttcgttgcac gccttcctgg 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ID_mexC-N <400> 15 actgctggta gatcaccccc 20 <210> 16 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> mexC-F <400> 16 gaagatctgc aagacaggtt cgataagggt g 31 <210> 17 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> mexC-R <400> 17 gaagatctgt ttctgcgcag gcgcaacg 28 <210> 18 <211> 124 <212> DNA <213> todST promoter <400> 18 ctcgagaaac gagcccagta ctatttcagg tcgtccgtag ttgctcatca aaaaagtatt 60 ctcaggatga tacgagggcg tatgatctat aatgaatccg tcagaatctt gtgagtcatt 120 aaag 124 <210> 19 <211> 2937 <212> DNA <213> todS <400> 19 atgagctcct tggatagaaa aaagcctcaa aatagatcga aaaataatta ttataatatc 60 tgcctcaagg agaaaggatc tgaagagctg acgtgtgaag aacatgcacg catcatattt 120 gatgggctct acgagtttgt gggccttctt gatgctcatg gaaatgtgct tgaagtgaac 180 caggtcgcat tggagggggg cgggattact ctggaagaaa tacgagggaa gccattctgg 240 aaggcgcgtt ggtggcaaat ttcaaaaaaa accgaggcga cccaaaagcg acttgttgaa 300 actgcatcat ccggtgaatt tgttcgctgt gatgttgaga ttcttggaaa atcaggtgga 360 agagaggtaa tagccgtcga tttttcattg ctgccaattt gcaatgaaga agggagcatt 420 gtttaccttc ttgcggaagg gcgcaatatt accgataaga agaaagccga ggccatgctg 480 gcgttgaaga accaggaatt ggagcagtcg gttgagtgta tccgaaaact cgataatgcg 540 aagagtgatt tctttgccaa ggtgagccat gagttgcgca ctccgctgtc tttgattcta 600 gggccactgg aagccgttat ggcggcagag gctgggcgtg aatcgccgta ttggaagcag 660 tttgaggtca ttcagcgtaa tgcaatgacc ctgttgaaac aggttaacac gctgcttgac 720 ttggcgaaaa tggacgcccg gcagatgggg ctttcctatc ggcgagccaa tcttagtcag 780 ctcacccgta ctattagctc gaattttgaa ggaatagccc agcaaaaatc aataacgttc 840 gatacaaaac tgcctgtaca gatggtcgct gaggtggatt gtgagaaata cgaacgcatt 900 atccttaact tgctttccaa tgcgtttaaa ttcacccctg acggggggct tatccgttgc 960 tgtcttagtt tgagtcgacc aaattatgcc ttggttactg tatctgatag cgggccgggt 1020 attcctcctg cactgcgtaa agaaatattt gaacgtttcc accagctaag ccaggaaggt 1080 caacaagcta cgcggggtac aggcttgggg ctttccattg tgaaagaatt cgttgaattg 1140 caccgtggaa caatttctgt aagtgatgcc ccgggcgggg gggcgctttt tcaggtaaag 1200 ctgccgctga atgctcctga aggtgcttat gttgcgagta acaccgcgcc gcgaagagat 1260 aatcctcagg tcgtggatac ggatgagtac cttttgctgg cgcccaatgc ggaaaatgaa 1320 gccgaggtgc ttccatttca atccgaccag cctcgggtgc taatcgttga agataaccct 1380 gatatgcgtg gttttataaa ggactgtctc agtagcgact atcaagttta tgttgcaccc 1440 gacggtgcaa aggcattgga gttgatgtca aacatgccgc cagacctgtt gattacagac 1500 ctgataatgc ctgttatgag cggcgatatg ctggttcacc aagtgcgtaa gaaaaatgaa 1560 ctttcacata tcccgatcat ggtgctgtcg gccaagtcag acgcagaact gcgtgtgaaa 1620 ttgctctccg agtcggtgca ggactttctt cttaagccat tttctgctca tgagctacga 1680 gcgcgtgtaa gcaatctggt atccatgaag gtggcaggcg atgcgttgcg taaggagctt 1740 tccgatcagg gggatgatat tgcgatactt actcaccgtc tgatcaaaag tcgccatcgt 1800 cttcagcaga gtaacatcgc attatccgcc tcggaagcgc gttggaaagc agtgtatgaa 1860 aactctgcgg ccggtattgt actgaccgac ccggaaaacc gaatactcaa cgccaatcct 1920 gcatttcaac gcattaccgg atatggggaa aaggatttgg agggactttc catggagcaa 1980 ttgactccat ctgacgaaag cccacagata aagcagcgtc tggccaattt gcttcagggt 2040 gggggagcgg aatacagtgt ggagcgctcc tatctatgca aaaatggttc tacgatttgg 2100 gccaatgcga gtgtctcgct gatgcctcaa cgtgtcggtg aatctccagt tatactgcag 2160 atcatcgatg acatcactga gaagaaacaa gcacaggaaa atcttaacca attgcagcaa 2220 caacttgtgt acgtttcccg atcagctacg atgggtgaat ttgcagccta tattgcacac 2280 gagataaacc aaccgctctc ggcgatcatg accaatgcca atgctggcac acgttggtta 2340 ggtaatgagc catctaacat cccagaggct aaagaggcac tggctcgcat tatccgagat 2400 tccgaccgcg ctgcagaaat tatccgtatg gtacgctcct tcctgaagcg tcaagaaacg 2460 gtgctgaaac cgattgatct aaaagcactg gtaactgata caagcctgat acttaaggcc 2520 cctagtcaga ataacagtgt caatttggat gttgttgcgg atgatgaact ccctgagata 2580 tggggggatg gtgtacagat ccagcagttg ataataaatc tggctatgaa cgctattgaa 2640 gcgatcagcc aagccgactg tgaaaccagg cagctaaccc tgtcattctc aggcaatgat 2700 acaggtgatg cgcttgttat ctcagtgaaa gatacaggtc caggtatttc agagaggcag 2760 atggcgcagt tgttcaacgc attctacacc acaaaaaaag aagggcttgg tatgggattg 2820 gcaatctgtc ttacaatcac ggaagtgcat aacggtaaaa tatgggttga gtgcccgccc 2880 gctgggggtg cttgtttcct ggtaagtatc cctgccagac agggctccgg cacatga 2937 <210> 20 <211> 1236 <212> DNA <213> Artificial Sequence <220> <223> todS * <400> 20 atgagctcct tggatagaaa aaagcctcaa aatagatcga aaaataatta ttataatatc 60 tgcctcaagg agaaaggatc tgaagagctg acgtgtgaag aacatgcacg catcatattt 120 gatgggctct acgagtttgt gggccttctt gatgctcatg gaaatgtgct tgaagtgaac 180 caggtcgcat tggagggggg cgggattact ctggaagaaa tacgagggaa gccattctgg 240 aaggcgcgtt ggtggcaaat ttcaaaaaaa accgaggcga cccaaaagcg acttgttgaa 300 actgcatcat ccggtgaatt tgttcgctgt gatgttgaga ttcttggaaa atcaggtgga 360 agagaggtaa tagccgtcga tttttcattg ctgccaattt gcaatgaaga agggagcatt 420 gtttaccttc ttgcggaagg gcgcaatatt accgataaga agaaagccga ggccatgctg 480 gcgttgaaga accaggaatt ggagcagaga tctcagcaac aacttgtgta cgtttcccga 540 tcagctacga tgggtgaatt tgcagcctat attgcacacg agataaacca accgctctcg 600 gcgatcatga ccaatgccaa tgctggcaca cgttggttag gtaatgagcc atctaacatc 660 ccagaggcta aagaggcact ggctcgcatt atccgagatt ccgaccgcgc tgcagaaatt 720 atccgtatgg tacgctcctt cctgaagcgt caagaaacgg tgctgaaacc gattgatcta 780 aaagcactgg taactgatac aagcctgata cttaaggccc ctagtcagaa taacagtgtc 840 aatttggatg ttgttgcgga tgatgaactc cctgagatat ggggggatgg tgtacagatc 900 cagcagttga taataaatct ggctatgaac gctattgaag cgatcagcca agccgactgt 960 gaaaccaggc agctaaccct gtcattctca ggcaatgata caggtgatgc gcttgttatc 1020 tcagtgaaag atacaggtcc aggtatttca gagaggcaga tggcgcagtt gttcaacgca 1080 ttctacacca caaaaaaaga agggcttggt atgggattgg caatctgtct tacaatcacg 1140 gaagtgcata acggtaaaat atgggttgag tgcccgcccg ctgggggtgc ttgtttcctg 1200 gtaagtatcc ctgccagaca gggctccggc acatga 1236 <210> 21 <211> 621 <212> DNA <213> todT <400> 21 atgagtgatc gggcatctgt tatctatatc ctcgatgacg acaatgcagt actggaagca 60 ctgagcagct tggtgcgttc aatcggcctg agtgtcgagt gtttttcatc cgctagcgta 120 ttcctgaacg atgtcaatcg ctctgcctgt ggctgtctaa ttttggatgt ccgtatgccc 180 gagatgagcg ggttggatgt gcaacgacaa ctgaaagagc ttggcgagca aatccccatt 240 atttttatca gcggccacgg tgatattccg atggcagtca aagcgatcaa ggcgggtgcg 300 gtagacttct tcactaaacc ttttcgagaa gaggagctgc ttggcgctat tcgcgccgcg 360 ctgaagttgg cgccccagca gagatcaaac gctccccgag tcagcgagct taaagagaat 420 tacgaaagcc tcagcaaacg cgagcaacag gtgcttaagt tcgtcttgcg aggatatcta 480 aacaagcaga cggctctaga gcttgatata tcggaagcaa cagtgaaagt gcaccgccat 540 aatatcatga ggaaaatgaa agtatcttca atccaggatc tggttcgagt aactgagcgg 600 ctcaaggata gcctggaata g 621 <210> 22 <211> 366 <212> DNA <213> todX promoter <400> 22 ccgggatcaa cgcattgagc gccaccagca tgttcaggtc tgaggttttc atcgacatca 60 ggttatcaac ctgctcgtgg acctgaggga aactgccgtg gcggcgacgg ggcttgcgcg 120 taagcccccg ctatacgacc agcctgttcg aaagccgcaa agtgcttagg tttgggtgca 180 tatccatcag aagcggcata aaccatcgtt tatcacagtt aaactttggt tttctaagtt 240 gcgatagcca tataaaccca taagccaaaa aacaatattt cccagggcgt gattgtaata 300 ctgtgcgtgc tctaaggcgg tgtttgccta cttcacttta taaaaaaaat aagatgtgga 360 aggaga 366 <210> 23 <211> 5972 <212> DNA <213> Artificial Sequence <220> <223> U2 <400> 23 atgcatctcg agaaacgagc ccagtactat ttcaggtcgt ccgtagttgc tcatcaaaaa 60 agtattctca ggatgatacg agggcgtatg atctataatg aatccgtcag aatcttgtga 120 gtcattaaag atgagctcct tggatagaaa aaagcctcaa aatagatcga aaaataatta 180 ttataatatc tgcctcaagg agaaaggatc tgaagagctg acgtgtgaag aacatgcacg 240 catcatattt gatgggctct acgagtttgt gggccttctt gatgctcatg gaaatgtgct 300 tgaagtgaac caggtcgcat tggagggggg cgggattact ctggaagaaa tacgagggaa 360 gccattctgg aaggcgcgtt ggtggcaaat ttcaaaaaaa accgaggcga cccaaaagcg 420 acttgttgaa actgcatcat ccggtgaatt tgttcgctgt gatgttgaga ttcttggaaa 480 atcaggtgga agagaggtaa tagccgtcga tttttcattg ctgccaattt gcaatgaaga 540 agggagcatt gtttaccttc ttgcggaagg gcgcaatatt accgataaga agaaagccga 600 ggccatgctg gcgttgaaga accaggaatt ggagcagaga tctcagcaac aacttgtgta 660 cgtttcccga tcagctacga tgggtgaatt tgcagcctat attgcacacg agataaacca 720 accgctctcg gcgatcatga ccaatgccaa tgctggcaca cgttggttag gtaatgagcc 780 atctaacatc ccagaggcta aagaggcact ggctcgcatt atccgagatt ccgaccgcgc 840 tgcagaaatt atccgtatgg tacgctcctt cctgaagcgt caagaaacgg tgctgaaacc 900 gattgatcta aaagcactgg taactgatac aagcctgata cttaaggccc ctagtcagaa 960 taacagtgtc aatttggatg ttgttgcgga tgatgaactc cctgagatat ggggggatgg 1020 tgtacagatc cagcagttga taataaatct ggctatgaac gctattgaag cgatcagcca 1080 agccgactgt gaaaccaggc agctaaccct gtcattctca ggcaatgata caggtgatgc 1140 gcttgttatc tcagtgaaag atacaggtcc aggtatttca gagaggcaga tggcgcagtt 1200 gttcaacgca ttctacacca caaaaaaaga agggcttggt atgggattgg caatctgtct 1260 tacaatcacg gaagtgcata acggtaaaat atgggttgag tgcccgcccg ctgggggtgc 1320 ttgtttcctg gtaagtatcc ctgccagaca gggctccggc acatgagtga tcgggcatct 1380 gttatctata tcctcgatga cgacaatgca gtactggaag cactgagcag cttggtgcgt 1440 tcaatcggcc tgagtgtcga gtgtttttca tccgctagcg tattcctgaa cgatgtcaat 1500 cgctctgcct gtggctgtct aattttggat gtccgtatgc ccgagatgag cgggttggat 1560 gtgcaacgac aactgaaaga gcttggcgag caaatcccca ttatttttat cagcggccac 1620 ggtgatattc cgatggcagt caaagcgatc aaggcgggtg cggtagactt cttcactaaa 1680 ccttttcgag aagaggagct gcttggcgct attcgcgccg cgctgaagtt ggcgccccag 1740 cagagatcaa acgctccccg agtcagcgag cttaaagaga attacgaaag cctcagcaaa 1800 cgcgagcaac aggtgcttaa gttcgtcttg cgaggatatc taaacaagca gacggctcta 1860 gagcttgata tatcggaagc aacagtgaaa gtgcaccgcc ataatatcat gaggaaaatg 1920 aaagtatctt caatccagga tctggttcga gtaactgagc ggctcaagga tagcctggaa 1980 tagaagcttc tagataagtt caggatgaat tctctagtcc aacctttcat agaaggcggc 2040 ggtggaatcg aaatctcgtg atggcaggtt gggcgtcgct tggtcggtca tttcgaaccc 2100 cagagtcccg ctcagaagaa ctcgtcaaga aggcgataga aggcgatgcg ctgcgaatcg 2160 ggagcggcga taccgtaaag cacgaggaag cggtcagccc attcgccgcc aagctcttca 2220 gcaatatcac gggtagccaa cgctatgtcc tgatagcggt ccgccacacc cagccggcca 2280 cagtcgatga atccagaaaa gcggccattt tccaccatga tattcggcaa gcaggcatcg 2340 ccatgggtca cgacgagatc ctcgccgtcg ggcatgcgcg ccttgagcct ggcgaacagt 2400 tcggctggcg cgagcccctg atgctcttcg tccagatcat cctgatcgac aagaccggct 2460 tccatccgag tacgtgctcg ctcgatgcga tgtttcgctt ggtggtcgaa tgggcaggta 2520 gccggatcaa gcgtatgcag ccgccgcatt gcatcagcca tgatggatac tttctcggca 2580 ggagcaaggt gagatgacag gagatcctgc cccggcactt cgcccaatag cagccagtcc 2640 cttcccgctt cagtgacaac gtcgagcaca gctgcgcaag gaacgcccgt cgtggccagc 2700 cacgatagcc gcgctgcctc gtcctgtagt tcattcaggg caccggacag gtcggtcttg 2760 acaaaaagaa ccgggcgccc ctgcgctgac agccggaaca cggcggcatc agagcagccg 2820 attgtctgtt gtgcccagtc atagccgaat agcctctcca cccaagcggc cggagaacct 2880 gcgtgcaatc catcttgttc aatcatgcga aacgatcctc atcctgtctc ttgatcaaat 2940 cttgatcccc tgcgccatca gatccttggc ggcaagaaag ccatccagtt tactttgcag 3000 ggcttcccaa ccttaccaga gggcgcccca gctggcaatt ccggttcgct tgctgtccat 3060 aaaaccgccc agtctagcta tcgccatgta agcccactgc aagctacctg ctttctcttt 3120 gcgcttgcgt tttcccttgt ccagatagcc cagtagctga cattcatccc aggtggcact 3180 tttcggggaa atgtgcgcgc ccgcgttcct gctggcgctg ggcctgtttc tggcgctgga 3240 cttcccgctg ttccgtcagc agcttttcgc ccacggcctt gatgatcgcg gcggccttgg 3300 cctgcatatc ccgattcaac ggccccaggg cgtccagaac gggcttcagg cgctcccgaa 3360 ggtctcgggc cgtctcttgg gcttgatcgg ccttcttgcg catctcacgc gctcctgcgg 3420 cggcctgtag ggcaggctca tacccctgcc gaaccgcttt tgtcagccgg tcggccacgg 3480 cttccggcgt ctcaacgcgc tttgagattc ccagcttttc ggccaatccc tgcggtgcat 3540 aggcgcgtgg ctcgaccgct tgcgggctga tggtgacgtg gcccactggt ggccgctcca 3600 gggcctcgta gaacgcctga atgcgcgtgt gacgtgcctt gctgccctcg atgccccgtt 3660 gcagccctag atcggccaca gcagccgcaa acgtggtctg gtcgcgggtc atctgcgctt 3720 tgttgccgat gaactccttg gccgacagcc tgccgtcctg cgtcagcggc accacgaacg 3780 cggtcatgtg cgggctggtt tcgtcacggt ggatgctggc cgtcacgatg cgatccgccc 3840 cgtacttgtc cgccagccac ttgtgcgcct tctcgaagaa cgccgcctgc tgttcttggc 3900 tggccgactt ccaccattcc gggctggccg tcatgacgta ctcgaccgcc aacacagcgt 3960 ccttgcgccg cttctctggc agcaactcgc gcagtcggcc catcgcttca tcggtgctgc 4020 tggccgccca gtgctcgttc tctggcgtcc tgctggcgtc agcgttgggc gtctcgcgct 4080 cgcggtaggc gtgcttgaga ctggccgcca cgttgcccat tttcgccagc ttcttgcatc 4140 gcatgatcgc gtatgccgcc atgcctgccc ctcccttttg gtgtccaacc ggctcgacgg 4200 gggcagcgca aggcggtgcc tccggcgggc cactcaatgc ttgagtatac tcactagact 4260 ttgcttcgca aagtcgtgac cgcctacggc ggctgcggcg ccctacgggc ttgctctccg 4320 ggcttcgccc tgcgcggtcg ctgcgctccc ttgccagccc gtggatatgt ggacgatggc 4380 cgcgagcggc caccggctgg ctcgcttcgc tcggcccgtg gacaaccctg ctggacaagc 4440 tgatggacag gctgcgcctg cccacgagct tgaccacagg gattgcccac cggctaccca 4500 gccttcgacc acatacccac cggctccaac tgcgcggcct gcggccttgc cccatcaatt 4560 tttttaattt tctctgggga aaagcctccg gcctgcggcc tgcgcgcttc gcttgccggt 4620 tggacaccaa gtggaaggcg ggtcaaggct cgcgcagcga ccgcgcagcg gcttggcctt 4680 gacgcgcctg gaacgaccca agcctatgcg agtgggggca gtcgaaggcg aagcccgccc 4740 gcctgccccc cgagcctcac ggcggcgagt gcgggggttc caagggggca gcgccacctt 4800 gggcaaggcc gaaggccgcg cagtcgatca acaagccccg gaggggccac tttttgccgg 4860 agggggagcc gcgccgaagg cgtgggggaa ccccgcaggg gtgcccttct ttgggcacca 4920 aagaactaga tatagggcga aatgcgaaag acttaaaaat caacaactta aaaaaggggg 4980 gtacgcaaca gctcattgcg gcaccccccg caatagctca ttgcgtaggt taaagaaaat 5040 ctgtaattga ctgccacttt tacgcaacgc ataattgttg tcgcgctgcc gaaaagttgc 5100 agctgattgc gcatggtgcc gcaaccgtgc ggcaccctac cgcatggaga taagcatggc 5160 cacgcagtcc agagaaatcg gcattcaagc caagaacaag cccggtcact gggtgcaaac 5220 ggaacgcaaa gcgcatgagg cgtgggccgg gcttattgcg aggaaaccca cggcggcaat 5280 gctgctgcat cacctcgtgg cgcagatggg ccaccagaac gccgtggtgg tcagccagaa 5340 gacactttcc aagctcatcg gacgttcttt gcggacggtc caatacgcag tcaaggactt 5400 ggtggccgag cgctggatct ccgtcgtgaa gctcaacggc cccggcaccg tgtcggccta 5460 cgtggtcaat gaccgcgtgg cgtggggcca gccccgcgac cagttgcgcc tgtcggtgtt 5520 cagtgccgcc gtggtggttg atcacgacga ccaggacgaa tcgctgttgg ggcatggcga 5580 cctgcgccgc atcccgaccc tgtatccggg cgagcagcaa ctaccgaccg gccccggcga 5640 ggagccgccc agccagcccg gcattccggg catggaacca gacctgccag ccttgaccga 5700 aacggaggaa tgggaacggc gcgggcagca gcgcctgccg atgcccgatg agccgtgttt 5760 tctggacgat ggcgagccgt tggagccgcc gacacgggtc acgctgccgc gccggtagca 5820 cttgggttgc gcagcaaccc gtaagtgcgc tgttccagac tatactagac tgcaggtcct 5880 gaagttaact agtacatgcg gtgtgaaata ccgcacagat gcgtaaggag aatcagtgat 5940 ggtgatggtg atgctcgagg cggccgccat gg 5972

Claims (12)

The tod S operon consisting of the Pseudomonas putida- derived SEQ ID NO: 18, the tod S * construct consisting of the simplified SEQ ID NO: 20 directly linked to the PAS1 domain of the tod S gene consisting of SEQ ID NO: 19 and the HK2 domain, And a tod T gene consisting of SEQ ID NO: 21.
delete 2. The expression vector according to claim 1, wherein the expression vector is represented by the cleavage map as shown in Fig.
The expression vector according to claim 1, wherein the expression vector is represented by the nucleotide sequence of SEQ ID NO: 23.
The method of any one of claims 1 to 4, wherein the marker protein expression cassette linked to the promoter of the tod X gene consisting of Pseudomonas putida- derived SEQ ID NO: 22 is inserted into the chromosome of the host cell An artificial biosensor for detecting a degradable harmful aromatic compound containing a transformant transformed into a recombinant expression vector for a marker protein.
6. The method of claim 5, wherein the labeled protein is selected from the group consisting of a fluorescent protein (GFP), sfGFP, alkaline phosphatase, firefly luciferase, and beta-galactosidase Wherein the biosensor is a biosensor.
The method according to claim 5, wherein the refractory harmful aromatic compound is a BTEX compound [benzene, toluene, ethylbenzene, xylene] Artificial biosensor.
The artificial biosensor according to claim 7, wherein the BTEX compound is o-xylene or 1,2,4-trimethylbenzene.
The artificial biosensor according to claim 5, wherein the host cell is a prokaryotic microorganism or a eukaryotic microorganism.
The artificial biosensor according to claim 9, wherein the prokaryotic microorganism is E. coli or Pseudomonas putida .
The todST operon consisting of the Pseudomonas putida-derived SEQ ID NO: 18, the todS * consisting of the simplified SEQ ID NO: 20 directly linked to the PAS1 domain and the HK2 domain of the todS gene consisting of SEQ ID NO: 19, No. 21 A recombinant protein expression vector for detecting a degradable harmful aromatic compound containing a todT gene comprising a todX gene consisting of Pseudomonas putida and a todX gene consisting of SEQ ID NO: Wherein the transformant is transformed into a recombinant strain expressing a marker protein inserted into the chromosome of the chromosome of the transformant.
1) measuring the expression level of the marker protein of the artificial biosensor for detecting the degradable harmful aromatic compound according to the fifth aspect, wherein the test sample is treated; And
2) A method for detecting a poorly decomposable harmful aromatic compound, comprising the step of judging that a poorly decomposable harmful aromatic compound is included in the test sample when the expression level of the labeled protein of step 1) is increased as compared with the control.

Images