RU2384620C2 - RECOMBINANT PLASMID DNA pYfi-gfp CODING PRODUCTION OF FLUORESCENT PROTEIN GFPaav AND STRAIN OF BACTERIA Escherichia coli JM109-pYfi PRODUCING FLUORESCENT PROTEIN GFPaav IN PRESENCE OF TOXIC AGENTS - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: there is designed recombinant plasmid DNA pYfi-gfp enabling production of chimeric fluorescent protein GFPaav with five modified amino acids, corresponding to the first five amino acids of protein YfiA with controlling a promotor of gene YfiA in presence of toxic agents. Plasmid has size 3730 base pairs. Recombinant strain Escherichia coli JM109-pYfi contains a genetic design under given invention and produces fluorescent protein GFPaav in presence of toxic agents damaging a cell.

EFFECT: invention allows registering the presence of toxic agents in a medium with increasing the fluorescence level of cells of produced strain.

2 cl, 4 dwg, 4 ex

Description

The invention relates to biotechnology, protein and genetic engineering, specifically to the production of gene sensors, and is a recombinant plasmid DNA pYfi-gfp containing a gene encoding a chimeric fluorescent protein GFPaav, as well as a recombinant strain of Escherichia coli JM109 [pYfi] - producer of chimeric fluorescent protein in the presence of toxic agents.

The development and creation of gene-sensor constructs is an important task for a number of reasons. Firstly, they are of great applied importance as indicators of various aspects in increasingly deteriorating environmental conditions, and secondly, they allow fundamental, experimental studies of both the stability and adaptation of the biological system to specific influences and the mechanisms of their implementation.

A genosensor is an artificial genetic system, the sensitive element of which is a gene promoter, which is activated naturally in response to one or another stressful (metabolic) effect. In gene-sensory constructs, such promoters are associated with the reporter gene [1, 2]. As reporter genes, genes encoding fluorescent or luminescent proteins are used [3]. To date, a number of fairly effective sensory constructs have been developed that can detect only one group of toxic factors, mainly oxidative stress sensors [4, 5], DNA damaging agents [5, 6], proteins or membranes [5, 7], and sensors detecting the presence of heavy metals [8, 9].

The prototype closest to the claimed technical solution is pYfi-gfp plasmid DNA containing, under the control of the YfiA (raiA) promoter Escherichia coli, a gene encoding a fluorescent protein green fluorescent protein (GFPaav) and an Escherichia coli strain producing GFPaav protein in the presence of hydrogen peroxide ( et al .: Database GenSensor as informational source for design of biosensors. Experimental development of biosensor based on yfiA gene. // Proceedings of the fifth international conference on bioinformatics of genome regulation and structure (BGRS'2006), v. 2, pp. 93-96).

The disadvantages of the known prototype are the low sensitivity of recombinant cells to a toxic agent and activation by only one agent, namely hydrogen peroxide.

An object of the invention is to obtain recombinant plasmid DNA pYfi-gfp encoding a chimeric fluorescent protein GFPaav, and a strain producing a chimeric fluorescent protein GFPaav, using a strain of Escherichia coli.

The technical task is solved:

- constructing, based on the first identified potential promoter of the yfiA (raiA) gene of Escherichia coli, plasmid DNA pYfi-gfp, containing, under the control of the promoter of the yfiA gene, a gene encoding a chimeric fluorescent protein green fluorescent protein (GFPaav) with five altered amino acids corresponding to the first five amino acids of the YfiA protein (RaiA);

- obtaining, by transformation, a recombinant plasmid DNA pYfi-gfp of a bacterial strain Escherichia coli capable of increasing the production of a chimeric fluorescent protein GFPaav, with five altered amino acids corresponding to the first five amino acids of YfiA protein (RaiA), in the presence of toxic agents of various nature. Registration of increased fluorescence of cells of the obtained strain indicates the presence of toxic agents in the medium.

Using the GenSensor database [10], the yfiA (raiA) Escherichia coli gene was detected, which is activated when the optimal cell growth conditions are violated [11] and when various agents damaging DNA, RNA, and proteins are present in the medium [1, 2, 12]. The use of the promoter of such a gene in sensory constructs provides the creation of a multifunctional gene sensor, the activation of which will reflect the metabolic dysfunction of the cell. Information on the existence of an independent promoter in the yfiA (raiA) Escherichia coli gene was not found, but indirect data indicated this possibility [13, 14]. Analysis of the nucleotide sequence between the ectD (b2595) and yfiA (b2597) genes revealed the presence of a canonical Rho-independent transcription terminator at a distance of 30 nucleotides from the end of the open reading frame of the ectD gene, the structure of which (Fig. 1) allows the formation of a potential hairpin with an energy of 16, 7 kcal / mol. This value agrees quite well with the energy of the most common, experimentally identified Rho-independent transcription terminators in E. coli [15] and, together with the data [14], suggests the lack of regulation of the yfiA (raiA) gene from the side of the anterior ectD gene (b2595) . Thus, the potential promoter region of the yfiA gene (raiA) was identified, which from the end of the transcription termination site of the ectD gene to the ATG of the codon of the yfiA gene (raiA) is 223 nucleotide pairs (Fig. 1).

The cloned sequence of the potential promoter region of the yfiA (raiA) E. coli gene is 270 bp and includes a portion of the Rho-independent potential transcriptional terminator in front of the ectD gene and the ATG codon.

Based on the first identified yfiA gene promoter (raiA), the pYfi-gfp plasmid is constructed containing the gfp gene encoding a fluorescent green fluorescent protein (GFPaav) protein with a shortened half-life [16] containing the first 5 codons of the yfiA gene. To do this, in the polymerase chain reaction (PCR) using oligonucleotide primers 5'-CCTCGGGCCCCAGAAACCTGAAACACAAAAACGG and 5'-AAGG GCATGC ATAAATTTTACCTCTTGTCTTCCCGTC, as well as the Escherichia coli DNA fragment with the AA1 gene fragment that contains the 1A gene that contains the A1 gene for the gene number i H1. Using the 5'-CGC GCATGC CAATGAACATTCGTAAAGGAGAAGAACTTTTCACT and 5'-CGCG AAGCTT ATTAAACTGCTGCAGCG primers, a DNA fragment encoding a chimeric fluorescent protein GFPaav with five altered amino acids corresponding to the first five A amino acids of the Y protein A if is available. This DNA fragment is combined in a ligation reaction with the vector plasmid pRS2 [17], hydrolyzed by the endonucleases KpnI and HindIII. The intermediate vector thus obtained is hydrolyzed with ApaI and SphI endonucleases and combined in a ligation reaction with a PNR fragment containing the yfiA gene promoter (raiA) treated with the same endonucleases. The result is the plasmid pYfi-gfp, the correctness of the insertion sites in which is confirmed by restriction analysis and sequencing. The determination of nucleotide sequences is carried out in both directions using an automatic sequencer CEQ ™ 2000XL DNA Analysis System ("Beckman") and sets "F" CEQ DTCS Kit.

Based on the results of determination of the nucleotide sequences of the inserted fragments and restriction analysis of the plasmid, a plasmid scheme is constructed containing, under the control of the yfiA (raiA) Escherichia coli gene promoter, a gene encoding a chimeric fluorescent protein GFPaav with five altered amino acids corresponding to the first five amino acids of the YfiA protein (FIG. 2) .

The obtained recombinant plasmid DNA pYfi-gfp, the structure of which is presented in figure 2, is characterized by the following features:

- has a molecular weight of 2.46 MDa and a size of 3730 bp;

- contains an artificial gene encoding a chimeric fluorescent protein GFPaav with five altered amino acids corresponding to the first five amino acids of the YfiA protein (RaiA), under the control of the promoter of the yfiA Escherichia coli gene, producing chimeric fluorescent protein GFPaav with five altered amino acids corresponding to the first five amino acids of the Yfi protein in the presence of toxic factors;

consists of the following elements:

- ApaI / HindIII, a vector fragment of plasmid pRS2 [17], 2688 bp in size, containing the replication initiation site of plasmid pUC18, ori E. coli, beta-lactamase gene (bla);

- ApaI / HindIII - 927 bp fragment containing the promoter of the yfiA (raiA) Escherichia coli gene and a gene encoding the fluorescent protein GFPaav;

contains:

- genetic marker: beta-lactamase (bla) gene, which determines the resistance of ampicillin to transformed pYfi-gfp E. coli cells;

- Unique recognition sites by restriction endonucleases having the following coordinates: HindIII - 442, Ncol - 1034, Apal - 1383.

A recombinant bacterial strain is obtained that is capable of producing a chimeric fluorescent GFPaav protein with five altered amino acids corresponding to the first five amino acids of the YfiA protein in the presence of toxic agents, which is easily detected by increasing the fluorescence of the cell suspension of this strain. To obtain such a producer, the strain Escherichia coli JM109 recA1, endA1, gyrA96, thi, hsdR17, supE44, relA1, Δ (lac-proAB) / F '[traD36, proAB ⁺ , lacI ^q , lacZΔM15] is used.

Competent cells of Eschercihia coli JM109 transform the DNA of plasmid pYfi-gfp isolated from the selected clone by alkaline lysis [18]. The recombinant Escherichia coli strain JM109 [pYfi] thus obtained is characterized by the following features:

Morphological signs. Small cells of a thickened rod-shaped, gram-negative, non-spore-bearing.

Cultural signs. Cells grow well on simple nutrient media. When growing on Difco agar, the colonies are round, smooth, pressed, cloudy, shiny, gray, the edge is even. When growing on liquid media (minimal medium or Luria broth) they form an intense smooth turbidity. Cells grow at a temperature of 37 ° C with an optimum pH of 6.8 to 7.0.

Antibiotic resistance. Cells are resistant to ampicillin (100 μg / ml) due to the presence of a plasmid.

The recombinant Escherichia coli strain JM109 [pYfi] provides the synthesis of chimeric fluorescent protein GFPaav with five altered amino acids corresponding to the first five amino acids of the YfiA protein induced by toxic agents (for example, hydrogen peroxide, mitomycin C), which is easily detected by increasing the fluorescence of the cell suspension.

The resulting strain was deposited in the Collection of microorganism cultures of the Federal State Institution Scientific Center of the World Bank "Vector" under the number B-1146.

To assess the sensitivity of the obtained Escherichia coli JM109 [pYfi] cells, an overnight culture of these cells was diluted in fresh Luria broth with 50 μg / ml ampicillin and grown at 37 ° C to medium log phase. The cells are then washed in M9 minimal medium and added to the wells of a 96-well plate containing appropriate dilutions of toxic agents. As toxic agents, 3.2 mM, 1.6 mM, 0.8 mM and 0.4 mM hydrogen peroxide (oxidizing agent) and 1.2 µM, 0.6 µM and 0.3 µM mitomycin C (DNA damage) are used. The sensitivity of Escherichia coli JM109 [pYfi] cells to the presence of toxic agents is assessed by the increase in fluorescence (irradiation - 485 nm, 0.1 s; emission - 535 nm) at a culture temperature of 26 ° C and 32 ° C. Fluorescence is measured using a Perkin Elmer VICTOR ³ fluorometer in fluorescence units, the level of induction is the ratio of the maximum fluorescence in the experiment to the fluorescence at a control point measured over the same period of time. Fluorescence of Escherichia coli JM109 [pYfi] cells not exposed to toxic agents is considered as a negative control (examples 3, 4).

The defining differences of the invention are:

- based on the E. coli yfiA (raiA) gene, selected using the specially created GenSensor database, a pYfi-gfp recombinant plasmid DNA is constructed containing, under the control of the first identified independent yfiA (raiA) E. coli gene promoter, a gene encoding a chimeric fluorescent a green fluorescent protein (GFPaav) protein with five altered amino acids corresponding to the first five amino acids of the YfiA protein;

- by transforming Escherihia coli JM109 cells of the recombinant plasmid DNA pYfi-gfp, a strain of Escherichia coli JM109 [pYfi] is obtained, capable of producing a chimeric fluorescent protein GFPaav with five altered amino acids corresponding to the first five amino acids of the YfiA protein in the presence of toxic agents C, in particular hydrogen, which is easily detected by increasing the fluorescence of the suspension of cells of this strain.

Thus, the resulting construct is a gene sensor that detects the presence of toxic agents in the medium, in particular mitomycin C and hydrogen peroxide.

The invention is illustrated by the following figures:

Figure 1 The structure of the potential regulatory region of the yfiA gene (raiA). The positions of the open reading frames of the ectD, b2596, yfiA, and pheL genes, the potential start of transcription of the yfiA gene [13], the potential Rho-independent terminator of transcription of the ectD gene, and the position of the potential promoter of the yfiA gene in the coordinates of the full E. coli genome (GenBank: U00096) are indicated.

Figure 2 Physical map of the plasmid pYfi-gfp containing, under the control of the yfiA gene promoter Escherihia coli, a gene encoding a chimeric fluorescent protein green fluorescent protein (GFPaav with five altered amino acids corresponding to the first five amino acids of the YfiA protein. HindIII, SfhI restriction endonuclease sites are indicated. ApaI, AvaII and PvuII; yfiA gene promoter; gene encoding a chimeric fluorescent GFPaav protein with five altered amino acids corresponding to the first five amino acids of the YfiA protein (RaiA); ampicillin resistance gene for ampicillin Amp ^r .

Figure 3 The effect of different concentrations of H ₂ O ₂ on the fluorescence of E. coli cells transformed with pYfi-gfp plasmid, compared with control cells at 26 ° C (A) and 32 ° C (B).

Figure 4 The effect of various concentrations of mitomycin C on the fluorescence of E. coli cells transformed with pYfi-gfp plasmid, compared with control cells at 26 ° C (A) and 32 ° C (B).

The invention is illustrated by the following examples of specific performance.

Example 1. Construction of a recombinant plasmid pYfi-gfp containing, under the control of the yfiA gene promoter (raiA), the gfp gene encoding a chimeric fluorescent protein GFPaav with five altered amino acids corresponding to the first five amino acids of the YfiA protein

The DNA fragment containing the promoter region of the yfiA gene (raiA) is obtained in the polymerase chain reaction (PCR) using oligonucleotide primers 5'-CCTCGGGCCCCAGAAACCTGAAACACAAAACGG and 5'-AAGG GCATGC ATAAATTTGTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT promoter region of the yfiA gene (raiA). Then, in a polymerase chain reaction (PCR) using oligonucleotide primers 5'-CGC GCATGC CAATGAACATTCGTAAAGGAGAAGAACTTTTCACT and 5'-CGCG AAGCTTA TTAAACTGCTGCAGCG, a DNA fragment encoding five-amino acid chimeric RNA is available with five different amino acids. This DNA fragment is combined in a ligation reaction with the vector plasmid pRS2 [17], hydrolyzed by the endonucleases KpnI and HindIII. The intermediate vector thus obtained is hydrolyzed with ApaI and SphI endonucleases and combined in a ligation reaction with a PCR fragment containing the yfiA gene promoter (raiA) treated with the same endonucleases. As a result, the genesensory plasmid pYfi-gfp is obtained, the correctness of the insertion sites in which is confirmed by restriction analysis and sequencing. The determination of nucleotide sequences is carried out in both directions using an automatic sequencer CEQ ™ 2000XL DNA Analysis System ("Beckman") and sets "F" CEQ DTCS Kit.

Example 2. The creation of a recombinant strain of Escherichia coli JM109 [pYfi] producing chimeric fluorescent protein GFPaav with five altered amino acids corresponding to the first five amino acids of YfiA protein in the presence of toxic agents for the cell

Cells of the strain Eschercihia coli Escherichia coli JM109 recA1, endA1, gyrA96, thi, hsdR17, supE44, relAl, Δ (lac-proAB) / F '[traD36, proAB ⁺ , lacI ^q , lacZΔM15] are cultured at medium growth to medium and transform with calcium the DNA of the recombinant plasmid pYfi-gfp purified by alkaline lysis [18]. Transformants are plated on LB agar medium containing 50 μg / ml ampicillin. Clones grown in the morning were cultured in Luria broth with 50 μg / ml ampicillin and plasmid DNA was isolated from them by alkaline lysis [18]. The correspondence of the isolated plasmid DNA to the required DNA is confirmed by restriction analysis and sequencing of the insert site. A clone containing the plasmid pYfi-gfp is seeded to individual colonies on LB agar medium containing 50 μg / ml ampicillin. Plasmid DNA from individual clones was isolated by alkaline lysis [16] and all procedures were repeated 2 more times, respectively. The result is a strain of Escherichia coli JM109 [pYfi] containing the recombinant genosensory plasmid pYfi-gfp.

Example 3. Testing the sensitivity of the created recombinant strain of Escherichia coli JM109 [pYfi] to the effects of hydrogen peroxide (oxidizing agent)

The sensitivity of the obtained Escherichia coli JM109 [pYfi] cells was evaluated in model experiments to increase fluorescence at a culture temperature of 26 ° C and 32 ° C. For this, the overnight cell culture is grown in fresh LB medium with 50 μg / ml ampicillin to the mid log stage. Then the cells are washed in M9 medium and aliquots, 50 μl are added to the wells of the tablet containing 6.4, 3.2, 1.6 and 0.8 mm hydrogen peroxide in 50 μl of M9, respectively. The experiment is carried out in repetitions and is repeated at least three times. Cell fluorescence was measured on a Perkin Elmer VICTOR ³ fluorimeter: exposure time 0.1 s, irradiation wavelength 485 nm, emission wavelength 535 nm. Fluorescence of Escherichia coli JM109 [pYfi] cells not exposed to hydrogen peroxide is considered as a negative control. The fluorescence values are shown in the graph (figure 3). Escherichia coli JM109 [pYfi] cells react to the presence of hydrogen peroxide at a concentration of 0.4-3.2 mM with a maximum level of induction after 60-70 min at a temperature of 26 ° C (Fig. 3A) and at a concentration of 0.4-0.8 mM with a maximum level of induction after 60 -80 min at a temperature of 32 ° C (Fig.3B).

Example 4. Testing the sensitivity of the created recombinant strain of Escherichia coli JM109 [pYfi] to the effects of mitomycin C (a toxic agent that damages cell DNA)

The overnight culture of Escherichia coli JM109 [pYfi] cells was grown in fresh LB medium with 50 μg / ml ampicillin to the mid log stage. Then the cells are washed in M9 medium and aliquots of 50 μl are added to the wells containing 2.4 μM, 1.2 μM and 0.6 μM mitomycin C in 50 μl M9. The experiment is carried out in repetitions and is repeated at least three times. Cell fluorescence was measured on a Perkin Elmer VICTOR ³ fluorimeter: (0.1 s / 485 nm / 535 nm). Fluorescence of Escherichia coli JM109 [pYfi] cells not exposed to mitomycin C is considered as a negative control. The fluorescence values are shown in the graph (figure 4). The reaction of Escherichia coli JM109 [pYfi] cells to the presence of mitomycin C reaches a maximum after 90-100 min, while the maximum induction level develops at a concentration of mitomycin C of 0.3 μM at a temperature of 26 ° C (Fig. 4A) and is practically independent of such at a temperature of 32 ° C.

Thus, the promoter of the yfiA (raiA) gene of Escherichia coli was identified and cloned for the first time, a recombinant plasmid pYfi-gfp was constructed, containing, under the control of this promoter, a gene encoding a chimeric fluorescent protein green fluorescent protein GFPaav with five altered amino acids corresponding to the first five amino acids of the Yfi protein RaiA), the production of which increases in the presence of toxic agents of various nature in the medium, leading to the activation of the yfiA {raiA} gene promoter, in particular mitomycin C and hydrogen peroxide; transformation of Escherichia coli JM109 cells results in the production of a recombinant strain of Escherichia coli JM109 [pYfi] capable of producing chimeric fluorescent protein GFPaav with five altered amino acids corresponding to the first five amino acids of YfiA protein in the presence of toxic agents, in particular mitomycin C and hydrogen peroxide. An increase in the fluorescence of the cells of the obtained strain indicates activation of the genosensory construct and, therefore, the presence of toxic agents in the medium.

Claims (2)

1. Recombinant plasmid DNA pYfi-gfp encoding the production of a chimeric fluorescent protein GFPaav with five altered amino acids corresponding to the first five amino acids of the YfiA protein under the control of the YfiA gene promoter in the presence of toxic agents, having a size of 3730 bp and pier. weight 2.46 MDa, containing:
ApaI / HindIII — 2688 bp vector fragment of plasmid pRS2 containing the replication initiation site of plasmid pUC18, ori E. coli, beta-lactamase gene (bla);
Apal / HindIII — 927 bp fragment containing the promoter of the Escherichia coli YfiA (raiA) gene and a gene encoding a chimeric fluorescent GFPaav protein with five altered amino acids corresponding to the first five amino acids of the YfiA protein;
genetic marker: beta-lactamase (bla) gene, which determines the resistance of ampicillin to E. coli transformed with plasmid pYfi-gfp;
unique recognition sites by restriction endonucleases having the following coordinates: HindIII - 442, Ncol - 1034, Apal - 1383. 2. The bacterial strain Escherichia coli JM109 [pYfi], deposited in the Collection of microorganism cultures of the Federal State Institution of Science and Science of the World Bank "Vector", registration number B-1147 producing chimeric fluorescent protein GFPaav with five altered amino acids corresponding to the first five amino acids of the YfiA protein in the presence of toxic agents.

Images