CN107746850B - A kind of Polyphosphate kinase gene and the application in sewage dephosphorization - Google Patents

Abstract

The present invention relates to a kind of Polyphosphate kinase gene and the applications in sewage dephosphorization, more particularly to three novel Polyphosphate kinase gene ppk33, ppk44, ppk73, it is respectively provided with the nucleotide sequence as shown in SEQ NO 1, SEQ NO 2 and SEQ NO 3.Engineering bacteria prepared by Polyphosphate kinase gene ppk33, ppk44, ppk73 of the present invention can be used for removing the P elements in sewage, and wherein bacterial strain M15/pQE30a ppk44 are that it corresponds to 7 times of control strain dephosphorization amount, and the poly- phosphorus rates of 10h are up to 70%.

Description

A kind of Polyphosphate kinase gene and the application in sewage dephosphorization

Technical field

The invention belongs to genetic engineering fields, and in particular to a kind of Polyphosphate kinase gene and in sewage dephosphorization Using.

Background technology

Body eutrophication has become global problems and deteriorates increasingly, and in recent years, the elements such as a large amount of nitrogen, phosphorus, potassium are arranged The speed for entering various water bodys is consumed speed considerably beyond it, and the organic matter of water body constantly accumulates, and aquatic ecological balance is broken, Body eutrophication has become global problems and deteriorates (Yang X.E, Wu X., Hao H.L., He increasingly Z.l.Mechanisms and assessment of water eutrophication[J].Journal of Zhejiang University B,2008,3(3):197-209).In all nutrients, phosphorus is particularly important to algal grown, with phosphorus For restriction factor, when total phosphorus concentration is more than 0.1mg/L, algae will excessive multiplication (woods dawn, Liu dragonfly, the thick female eutrophic waters of Xu Control method pre-test [J] urban water supplies of phosphorus, 2003,2 (1) in body:29-30；Abell J.M., Hamilton D.P.Nitrogen and phosphorus limitation of phytoplankton growth in New Zealand lakes:implicatios for eutrophication control[J].Ecosystems,2010, 13(7):966-977).However, after the phosphorus without limiting emission enters water ecosystem, it also occur that complicated adsorbs and fixes Process is discharged again, makes polluted-water is more difficult to that (Zheng Jinwei, Ran Wei, Zhong Zengtao, what enhanced biological phosphate-eliminating mistake of strong administered Progress [J] Chinese Journal of Applied Ecologies of Quadrafos accumulation microorganism, 2004,15 (8), 1487-1490 in journey).Phosphorus is to draw An important factor for playing body eutrophication removes the critical issue that the phosphorus gathered in water body is urgently to be resolved hurrily in water remediation.

It is vital that being found to be of polyP bacteria solves the problems, such as that the enrichment of Phos in water body plays the role of, and learns both at home and abroad Person has screened much microorganisms with poly- phosphorus ability in succession, typically from the deposit or activity of height eutrophication water Screening obtains in mud, and Cai Tianming etc. is detached from municipal sewage plant's aerobic tank activated sludge and obtained one plant Pseudomonas grimontii C18, after aerobic culture for 24 hours dephosphorizing rate up to 94.1% (Cai Tianming, Chen Liwei, Wu Shouzhong, Qian Lihua appoints screening and its characteristic research [J] environmental sciences of pretty .1 plants of denitrification and dephosphorization bacterial, 2010,31 (10):2487- 2492).Village will just isolates 1 plant height effect polyP bacteria-during grade goes into the street the town villages Gao Qi sewage draining exit mud from Fuzhou City's Minhou County Alcaligenes sp.ZGED-12, after optimized condition of culture to the removal ability of phosphorus up to 80% (Zhuan Zhigang, Han Yonghe, The separation of the efficient polyP bacteria Alcaligenes sp.ED-12 bacterial strains of Zhang Wenxian, Zhou Zhihua, Chen Jiaxing, Li Min is identified and its is removed Phosphorus characteristic [J] ACTA Scientiae Circumstantiaes, 2014,34 (3):678-687).But it is fresh to the research of mangrove forest soil polyP bacteria at present Appear in the newspapers, mangrove is tidal beach wetland biocoene, is flooded for a long time by seawater periodically leaching, ecological environment and polyP bacteria it is poly- Phosphorus process Aerobic-anaerobic alternate environment is highly consistent, and be richly stored with poly- phosphorus microbial resources.Present inventor adopts at random 134 parts of pedotheques of the stockaded villages Ji Liaodong port mangrove obtain 185 plants of primary dcreening operation bacterial strains, have the poly- phosphorus ability of 42 plants of bacterial strains to reach in total 20% or more, the wherein poly- phosphorus rate of Acinetobacter.tandoii SC36 highests can reach 70%, these bacterial strains can be rich battalion Quick, the efficient process of fosterization water body provide effective microorganism resource.

Invention content

The 16S rRNA gene orders of polyP bacteria strain Acinetobacter.tandoii SC36 are by inventing in the present invention People is submitted in GenBank data, Serial No. KU353550 (GenBank:KU353550.1).

The present invention provides three novel Polyphosphate kinase gene ppk33, ppk44, ppk73, it is characterised in that The DNA sequence dna of ppk33, ppk44, ppk73 are respectively provided with the nucleotides sequence as shown in SEQ NO 1, SEQ NO 2 and SEQ NO 3 Row.

Another embodiment of the present invention provides the amino acid sequence of three protein, it is characterised in that the amino acid sequence Row are respectively provided with the amino acid sequence as shown in SEQ NO 4, SEQ NO 5, SEQ NO 6；The amino acid sequence successively by SEQ NO1, SEQ NO 2 and SEQ NO 3 are encoded.

Another embodiment of the present invention provide it is a kind of prepare the novel Polyphosphate kinase gene ppk33 of above three, The method of ppk44, ppk73, it is characterised in that described method includes following steps：

Using strains A cinetobacter.tandoii SC36 genomes as template, obtained using the method for PCR complete Genetic fragment ppk33, ppk44 and ppk73.

The primer that above-mentioned PCR is used and restriction enzyme are as follows：

Ppk33 primers Fs:CCATGGAAAATTTTCAACATTCATC, restriction enzyme Nco I

R:GCTCGAGGATTTTCTGTAGACTCTTGTTCATC, restriction enzyme Xho I

Ppk44 primers Fs:TGGATCCATGAATACGGCGGCACAGA, restriction enzyme BamH I

R:TGTCGACTTATTTAATCATTTCCAACAAAGTC, restriction enzyme Sal I

Ppk73 primers Fs:TGGATCCTTGTCAATTTTAGATTTTAATTTACG, restriction enzyme BamH I

R:TCTGCAGTTACTTTATAACGCTTAACAAAAAG, restriction enzyme Pst I

Another embodiment of the present invention provides following pair of primers in preparing Polyphosphate kinase gene ppk33 Using, it is characterised in that the primer is as follows：

F:CCATGGAAAATTTTCAACATTCATC

R:GCTCGAGGATTTTCTGTAGACTCTTGTTCATC。

Another embodiment of the present invention provides following pair of primers in preparing Polyphosphate kinase gene ppk44 Using, it is characterised in that the primer is as follows：

F:TGGATCCATGAATACGGCGGCACAGA

R:TGTCGACTTATTTAATCATTTCCAACAAAGTC。

Another embodiment of the present invention provides following pair of primers in preparing Polyphosphate kinase gene ppk73 Using, it is characterised in that the primer is as follows：

F:TGGATCCTTGTCAATTTTAGATTTTAATTTACG

R:TCTGCAGTTACTTTATAACGCTTAACAAAAAG。

Another embodiment of the present invention provides three kinds of colibacillus engineerings, it is characterised in that the engineering bacteria is respectively BL21(DE3)/pET28a-ppk33、M15/pQE30a-ppk73、M15/pQE30a-ppk44。

Another embodiment of the present invention provides application of the above-mentioned three kinds of engineering bacterias in sewage dephosphorization.

The novel Polyphosphate kinase gene ppk33, ppk44 of another embodiment of the present invention offer above three, Ppk73 is preparing above-mentioned engineering bacteria BL21 (DE3)/pET28a-ppk33, M15/pQE30a-ppk73, M15/pQE30a-ppk44 In application.

The general scheme of the present invention is as follows：

Further to parse the dephosphorization mechanism of bacterial strain SC36, completed using 2000 sequencing technologies of Illumina Hiseq high The genome scanning sequencing of polyP bacteria strain Acinetobacter.tandoii SC36 is imitated, the libraries structure 300bp utilize SOAPdenovo v2.04 splicing softwares carry out optimization the splicing of multiple Kmer parameters, obtain optimal assembling result Afterwards, then hole filling and base in part is carried out to assembling result with GapCloser v1.12 softwares to correct.According to splicing sequence The technical indicators such as overall length, the quantity of scaffold and scaffold N50, the assembling result of multiple Kmer is integrated Evaluation, final SC36 gene order-checkings analysis obtain 56 scaffold, G/C content 41.98%.

Using 3.02 softwares of Glimmer carry out bacterium predictive genes, by the protein sequence of predicted gene respectively with Nr, Genes, string and GO database carry out blastp comparisons (BLAST 2.2.28+), and identification bacterial strain SC36 contains 3 ppk bases Cause is named as ppk33 (SEQ NO 1), ppk44 (SEQ NO 2) and ppk73 (SEQ NO 3), open reading frame (ORF) size Respectively 2061bp, 2082bp and 2010bp are separately encoded 686 (SEQ NO 4), 693 (SEQ NO 5) and 669 (SEQ NO 6) a amino acid.

Utilize ProtParam (http://web.expasy.org/protparam/) predict the amino acid sequence of protein It arranging (i.e. primary structure), the molecular size range of 3 PPK of discovery is respectively 78071.0Da, 78869.5Da and 76645.3Da, etc. The theoretical value of electric point (pI) is respectively 6.34,6.37 and 7.76.Utilize SOPMA (http://npsa-pbil.ibcp.fr/cgi- bin/npsa_automat.plPage=npsa_sopma.html) online tool, by the amino acid of known ppk gene codes Sequence carries out secondary structure prediction.The secondary structure of 3 PPK is similar in main structure (Fig. 1), but PPK33 and PPK44 and PPK73 has bigger difference at N-terminal 0-100,200-250 and 350-400 amino acids, and PPK44 and PPK73 only exists Larger difference is showed at 0-50 amino acids, illustrates that there are larger differences between the secondary structure of PPK33 and PPK44 and PPK73 It is anisotropic.α spirals and random coil proportion are larger in 3 PPK secondary structures, and α spirals proportion is less than in wherein PPK33 PPK44 and PPK73, and random coil proportion is then higher than PPK44 and PPK73, and β-bend proportion is less, only 8% Left and right.Utilize SWISS-MODEL (http://swissmodel.expasy.org/) 3 PPK of homology method pair three-level knot Structure is predicted, it is found that 3 protein models are substantially the same, only variant (Fig. 2) in regional area.

Using strains A cinetobacter.tandoii SC36 genomes as template, obtained using the method for PCR complete Genetic fragment ppk33, ppk44 and ppk73,3 target fragments are consistent with expected results in 2.0kb or so.Purifying is recycled PCR product afterwards carries out enzyme company with pMD 18-T Vector respectively, in Transformed E .coli JM109, is spread evenly across containing Amp On the LB tablets of (100 μ g/mL), picked clones extracts the plasmid of clone and carries out digestion verification.Digestion verification is correct Clone and expression vector carry out a large amount of digestions with corresponding enzyme respectively, after agar electrophoresis, cut respectively under ultraviolet light poly- Phosphorus gene and vector gene band carry out glue recycling, then two recovery products are linked together composition with T4DNA Ligase Expression vector.The multiple cloning sites of pQE-30a carriers contain the digestion of restriction enzyme BamH I, Sal I, Hind III and Pst I Site, the then restriction enzyme site containing Nco I and Xho I in pET-28a carriers.So by gene ppk44 and ppk73 respectively with pQE- 30a enzymes connect, and constitute expression vector pQE30a-ppk44 and pQE30a-ppk73, and the enzyme of gene ppk33 and pET-28a are connected structure At expression vector pET28a-ppk33.Picking expressor is distinguished after conversion, extracts plasmid and is verified.It will the correct sun of verification Property recombinant plasmid bacterial strain be sent to Shanghai Sangon Biotech Company's sequencing, sequencing result proves that the expression vector of 3 genes is built correctly.

To ensure the effective expression of recombinant plasmid, the plasmid of pET28a-ppk33 is transferred in BL21 (DE3), engineering is obtained Bacterial strain BL21 (DE3)/pET28a-ppk33；And pQE30a-ppk44 and pQE30a-ppk73 are transferred to respectively in M15, obtain phase The engineered strain M15/pQE30a-ppk44 and M15/pQE30a-ppk73 answered.IPTG is the analog of lactose, can with check egg It is combined into compound in vain, and aporepressor conformation is made to change, aporepressor cannot be combined with O gene again, to promote Gene expression.IPTG derivants are widely used in inducible expression, but there is also certain toxicity.The content of derivant and Inducing temperature has different degrees of influence to the expression of target gene.In order to make the destination protein expression quantity of recombinant expression most Bigization, and soluble protein is obtained, devise multigroup different inducing temperatures and IPTG concentration gradients.

SDS-PAGE electrophoretic analysis shows that 3 expression bacterial strains can be big under IPTG concentration 0.8mM, 37 DEG C of condition of culture Amount expression.Keep IPTG concentration constant, it is 16 DEG C, 20 DEG C and 28 DEG C to change inducing temperature, and bacterium solution is taken to extract albumen, profit between timesharing With SDS-PAGE electrophoresis detections, compared to the expression structure of pQE-30a zero load bacterial strains, M15/ when Fiber differentiation 18h at 16 DEG C PQE30a-ppk44 and M15/pQE30a-ppk73 has apparent protein band to occur in 75kDa or so, shows 3 expression bacterium Strain can at low temperature express destination protein into supernatant, be soluble protein.

It is control with the E.coli bacterial strains containing pET-28a or pQE-30a, expression bacterial strain is inoculated in synthetic wastewater training respectively It supports in base, 37 DEG C of good support are cultivated, and are acquired bacterium solution after IPTG derivants 10h is added, are measured the bacterium solution of expression bacterial strain and control strain Supernatant phosphorus content, and the dephosphorization amount of each bacterial strain and poly- phosphorus rate, results expression bacterial strain BL21 (DE3)/pET28a- are counted respectively The dephosphorization amount of ppk33 is 3.3 times of its corresponding control strain, and expression bacterial strain M15/pQE30a-ppk44 is that it corresponds to control strain 7 times of dephosphorization amount, the poly- phosphorus rates of 10h are up to 70%, and the poly- phosphorus rate of control strain is only 10%.Show that corresponding ppk genes exist Overexpression in E.coli causes thalline to gather poly P, to make a large amount of phosphate in culture medium be effectively removed.

Description of the drawings

Fig. 1 PPK Protein secondary structures

a:PPK33 Protein secondary structures；b:PPK44 Protein secondary structures；c:PPK73 Protein secondary structures

Fig. 2 PPK albumen tertiary structures

a:PPK33 protein three-dimensional space structures；b:PPK44 protein three-dimensional space structures；c:It ties in PPK73 protein three-dimensionals space Structure

Fig. 3 PPK protein gene pcr amplification product agarose electrophoretic analysis

a:Ppk33 gene PCR amplified productions；b:Ppk44 gene PCR amplified productions；c:Ppk73 gene PCR amplified productions

Fig. 4 ppk gene expression protein SDS-PAGE electrophoretic analysis

Duct PM：Standard protein；Duct 1:M15/pQE30a；Duct 2：BL21(DE3)/pET28a-ppk33；Duct 3： M15/pQE30a-ppk73；Duct 4：M15/pQE30a-ppk44

Specific implementation mode

For the ease of a further understanding of the present invention, examples provided below has done more detailed description to it.But It is that these embodiments are only not supposed to be a limitation to the present invention or implementation principle for being better understood from invention, reality of the invention The mode of applying is not limited to the following contents.

Whole genome sequence data analysis

1) genomic DNA fragment：Genomic DNA is resolved into the piece of about size 300-500bp with Covaris M220 Duan Ruogan；

2) library construction：A＆B connectors are connected at DNA fragmentation both ends, then screen removal connector from section in flakes, utilize agarose Gel electrophoresis carries out segment screening, and it is the segments that A connectors, one end are B connectors to retain one end, finally so that DNA is become with sodium hydroxide Property, generate Single-stranded DNA fragments；

3) bridge-type PCR：One end of DNA fragmentation and primer base is complementary, it is fixed on chip, the other end is at random near Another Primers complementary, be also fixed, formed " bridge (bridge) ", PCR amplification, generate DNA clusters, by DNA cloning son Linearisation becomes single-stranded.

4) Illumina Hiseq 2000 are sequenced：The archaeal dna polymerase be transformed is added and with 4 kinds of fluorescent markers DNTP, only incorporation single base is read every template sequence first round and is reacted institute cycle with laser scanning reaction plate surface every time The nucleotide type of polymerization up, will " fluorophor " and " terminate group " chemical cleavage, restore 3 ' and hold sticky, continue polymerization the Two nucleotide finally count and often take turns the fluorescence signal being collected into as a result, knowing the sequence of template DNA segment；

5) genome splices：Multiple Kmer parameters are carried out to optimization using SOAPdenovo v2.04 splicing softwares Splicing obtains optimal assembling as a result, carrying out hole filling and alkali in part to assembling result with GapCloser v1.12 softwares Base corrects.

6) 3.02 (http of Glimmer are utilized://www.cbcb.umd.edu/software/glimmer/) software progress The protein sequence of predicted gene is carried out blastp by the predictive genes of bacterium with Nr, genes, string and GO database respectively It compares (BLAST2.2.28+), obtains the annotation information of predicted gene.

7) it is compared by carrying out blastp (BLAST 2.2.28+) with string databases, obtains the COG corresponding to gene Annotation according to COG as a result, and annotate result to albumen progress function classification.With BLAST algorithm (blastx/blastp 2.2.28+) predicted gene obtained is compared with the gene database (Genes) of KEGG, the KO obtained according to comparison Number can obtain the specific biological pathways of corresponding gene participation.GO has been carried out to blast results by blast2go softwares Annotation analysis.

Using 3.02 softwares of Glimmer carry out bacterium predictive genes, by the protein sequence of predicted gene respectively with Nr, Genes, string and GO database carry out blastp comparisons (BLAST 2.2.28+), and identification bacterial strain SC36 contains 3 ppk bases Cause is named as ppk33, ppk44 and ppk73, and open reading frame (ORF) size is respectively 2061bp, 2082bp and 2010bp, is divided It Bian Ma not 686,693 and 669 amino acid.Utilize ProtParam (http://web.expasy.org/protparam/) come Predict protein amino acid sequence (i.e. primary structure), discovery 3 PPK molecular size range be respectively 78071.0Da, The theoretical value of 78869.5Da and 76645.3Da, isoelectric point (pI) are respectively 6.34,6.37 and 7.76.

Ppk identified for genes and its protein structure prediction

Utilize SOPMA (http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.plPage= The amino acid sequence of known ppk gene codes is carried out secondary structure prediction, 3 PPK by npsa_sopma.html) online tool The secondary structure analysis of albumen finds that the secondary structure of 3 PPK is similar in main structure, but PPK33 and PPK44 and PPK73 There is bigger difference at N-terminal 0-100,200-250 and 350-400 amino acids, and PPK44 and PPK73 is only in 0-50 Larger difference is showed at amino acids, illustrates that there are larger othernesses between the secondary structure of PPK33 and PPK44 and PPK73. α spirals and random coil proportion are larger in 3 PPK secondary structures, and α spirals proportion is less than PPK44 in wherein PPK33 And PPK73, and random coil proportion is then higher than PPK44 and PPK73, and β-bend proportion is less, only 8% or so. Utilize SWISS-MODEL (http://swissmodel.expasy.org/) 3 PPK of homology method pair tertiary structure into Row prediction finds that 3 protein models are substantially the same, only variant in regional area.

1.ppk gene order PCR amplifications are cloned

It is designed and is expanded according to ppk gene orders from genome identification ppk genes according to genome-wide screening sequencing result The primer of gene complete sequence.

PCR reaction conditions are that annealing temperature is changed to 50 DEG C, 56 DEG C, 53 DEG C, 53 DEG C successively, and extension of time is changed to 4min. Respectively with the 3 ppk gene total orders for coming from Acinetobacter.tandoii SC36 row for stencil design amplimer, 3 It is as follows to primer sequence and corresponding restriction enzyme.With strains A cinetobacter.tandoii SC36 genomes For template, complete genetic fragment ppk33, ppk44 and ppk73 are obtained using the method for PCR, 3 target fragments are in 2.0kb Left and right (Fig. 3), is consistent with expected results.

Expand the primer information of ppk gene orders

ppk33F:CCATGGAAAATTTTCAACATTCATC(NcoⅠ)

R:GCTCGAGGATTTTCTGTAGACTCTTGTTCATC(XhoⅠ)

ppk44F:TGGATCCATGAATACGGCGGCACAGA(BamHⅠ)

R:TGTCGACTTATTTAATCATTTCCAACAAAGTC(SalⅠ)

ppk73F:TGGATCCTTGTCAATTTTAGATTTTAATTTACG(BamHⅠ)

R:TCTGCAGTTACTTTATAACGCTTAACAAAAAG(PstⅠ)

2. recon is built

It is prepared by Competent cell

1) picking E.coil freezes bacterium and is cultivated on LB tablets, and then picking single bacterium is fallen in the LB liquid medium of 5mL, 200

Rpm, 37 DEG C are incubated overnight；

2) it is transferred to by 1% amount in the triangular flask for the LB liquid medium for filling 250mL, is trained under the same conditions It supports；

3) OD600 of about 2.5h, culture medium are about 0.6 or so；

4) it by triangular flask ice bath 30min, goes in ice-cold 100mL centrifuge tubes, 4 DEG C, 4,000rpm centrifugation 10min；

5) operation below carries out in super-clean bench, keeps ice bath, 4 DEG C of centrifugations are soft to blow and beat, and mix well bacterium solution and (press 250mL bacterium solutions carry out)：

6) the careful supernatant that inclines, is resuspended in the 0.1mol/L MgCl2 of ice-cold 50mL, and gently turned upside down is mixed It is even；

7) ice bath 30min；

8) 4 DEG C, 4,000rpm centrifugation 10min, carefully incline supernatant, places on ice；

9) it is resuspended in the ice-cold 0.1mol/L CaCl2-15%glycerol of 4mL, gently blows and beats mixing；

10) 150 μ L be dispensed into the centrifuge tube of the 1.5mL of precooling；

11) it is placed on spare in -80 DEG C of refrigerators.

Thermal shock converts

1) E.coil competent cells are taken out from -80 DEG C of refrigerators, thaw about 15min on ice；

2) connection product of 10 μ L or 1 μ L plasmids are added in 150 μ L competent cells, place 30min on ice；

3) heat-shock transformed, 42 DEG C of water-bath 1.5min, at once ice bath 3min；

4) the fresh LB liquid mediums of 1mL are added；

5) 37 DEG C, 200rpm cultivates 1h；

6) of short duration centrifugation absorbs part supernatant and stays 400 μ L, and pipette tips piping and druming is uniform, then absorbs 200 μ L conversion fluids to containing On corresponding antibiotic LB culture medium flat plates, coated plate to tablet is dried；

7) tablet is inverted in 37 DEG C of constant incubators and cultivates 14h-16h.

The extraction of bacterial plasmid

Picking single bacterium is fallen in 5ml LB liquid mediums, 220rpm, and 37 DEG C are incubated overnight.Reference《Molecular Cloning: A Laboratory Guide》Alkaline lysis extract Plasmid DNA in a small amount, and its experimental procedure and related reagent are improved, the specific method is as follows：

1) 1.5mL thalline are collected by centrifugation in 10,000rpm, 2min, and extra culture medium is absorbed in then of short duration centrifugation；

2) thalline is fully blown and beaten with pipette tips again is suspended in 150 μ L Solution I (with RNase)；

3) 300 μ L Solution II, gently turned upside down mixing 5 times or so are added, until liquid becomes as clear as crystal；

4) 250 μ L Solution III are added, gently turned upside down 5 times or so, place 10min on ice at once；

5) 12,000rpm centrifuges 15min, and then supernatant is transferred in the centrifuge tube of the heart；

6) isometric isopropanol, turned upside down mixing is added；

7) 12,000rpm centrifuges 5min, and carefully incline supernatant；

8) 700 μ L, 70% ethyl alcohol (not acutely concussion) is added, 12,000rpm centrifugation 2min, carefully incline supernatant；

9) 8) step operation is repeated；

10) of short duration centrifugation carefully sucks extra ethyl alcohol with pipette tips；

11) 30min or so is spontaneously dried, 50 μ L TE dissolving DNAs are added；

12) be vortexed dissolving, and -20 DEG C save backup.

Ppk gene PCRs purified product and pMD 18-T carrier enzymes are connected.Enzyme connects reaction system：Takara SolutionⅠ5 0.5 μ L, PCR purified products of μ L, pMD 18-T 4.5 μ L, 10 μ L of total volume.Connection product is placed in 4 DEG C, 16h.Digestion recycling production Object connects reaction system with expression vector pET-28a or pQE-30a enzyme：Insert DNA 5 μ L, pQE-30 3 μ L, T4DNA 1 μ L, Ligase Buffer of Ligase 1 μ L, 10 μ L of total volume.Connection product is placed in 16 DEG C, and 4 DEG C of refrigerator mistakes are placed into after 1h Night.

PCR product after recycling is subjected to enzyme company with pMD 18-T Vector respectively, in Transformed E .coli JM109, It is even to be coated on the LB tablets containing Amp (100 μ g/mL), picked clones.It extracts the plasmid of clone and carries out double digestion and test Card takes carrier pET-28a plasmids, pQE-30a plasmids and ppk genes and pMD 18-T enzymes to connect plasmid, carries out double digestion.Double digestion Reaction system：20 μ L Plasmid DNA, 10 μ 10 × buffer of L, enzyme 1 and enzyme 2 each 0.5 μ L, 100 μ L of total volume.In 37 DEG C of overnight enzymes It cuts., it can be seen that segment and gene (about 2.0kb) and pMD 18-T carrier segments (about 2.7kb) are big obtained by 4 recombinant plasmid digestions It is small to be consistent, it is identified as correct recon.

3.ppk gene expressions

Clone and expression vector are subjected to a large amount of digestions with corresponding enzyme respectively, after agar electrophoresis, divided under ultraviolet light Poly- phosphorus gene and vector gene band are not cut, carry out glue recycling, then be connected to two recovery products with T4DNA Ligase Expression vector is constituted together.The restriction enzyme site of 4 genes of control design design, the multiple cloning sites of pQE-30a carriers are containing limited The restriction enzyme site of property restriction endonuclease BamH I processed, Sal I, Hind III and Pst I, the then enzyme containing Nco I and Xho I in pET-28a carriers Enzyme site.So gene ppk44, ppk73 are connected with pQE-30a enzymes respectively, composition expression vector pQE30a-ppk44, PQE30a-ppk73, and the enzyme of gene ppk33 and pET-28a are even constituted into expression vector pET28a-ppk33.After conversion respectively Picking expressor extracts plasmid and is verified.Correct positive recombinant plasmid bacterial strain will be verified and be sent to Shanghai Sangon Biotech Company's survey Sequence, sequencing result prove that the expression vector of 3 genes is built correctly.

IPTG induced expressions

1) picking expressor single bacterium is fallen in the LB liquid medium that 5mL contains corresponding antibiotic, 200rpm, and 37 DEG C overnight Culture；

2) it is forwarded in the fresh LB culture mediums containing identical antibiotic of 5mL by 1% amount within second day, culture 2h is extremely OD₆₀₀About 0.6 or so；

3) IPTG (500mg/mL) that 8 μ L are added in each culture bottle makes the IPTG final concentrations in culture medium reach 0.8 μ g/ ML, 200rpm, 37 DEG C of culture 18h；

4) 10,000rpm centrifuges 2min, collects the thalline of 5mL；

5) the PBS buffer solutions of 1mol/L wash 2 times to remove LB culture mediums to thalline, are then separately added into 1mL's again The abundant suspension thalline of ddH2O buffer solutions；

6) ultrasonic disruption, 200w, total time 3min, the intervals 10s；

7) 12,000rpm centrifuges 5min, collects supernatant precipitation respectively, and precipitation is resuspended in the ddH of 1mL₂O bufferings are molten It is washed 2 times in liquid；

8) ddH of 500 μ L is added in the precipitation washed₂O buffer solutions, supernatant precipitation are placed in -20 DEG C of preservations.

PAGE gel electrophoresis

SDS- gel electrophoresises are carried out using 10% vertical electrophoresis system, experimental procedure is as follows：

1) two pieces of glass offset plates are cleaned up, illustratively by offset plate assembly on gum-making rack after drying；

2) polyacrylamide gel is prepared

Separation gel composition is as follows：ddH₂12 8 μ of μ L, TEMED of O 3mL, RGB 1.5mL, Acrylamide 1.5mL, APS L。

After separation gel solidification, it is immediately ready for spacer gel, composition is as follows：500 μ L of ddH2O 1.17mL, SGB, 55 μ L of μ L, TEMED of Acrylamide333 μ L, APS.

After spacer gel is added, it is inserted into comb at once, comb is removed after solidification is put into electrophoresis tank and carry out electrophoresis.

3) broken precipitation or 20 μ L of supernatant are taken, 2 × Sample Buffer, boiling water boiling 5min, 12,000rpm is added Centrifuge 5min, take 10 μ L sample loadings, after fully entering separation gel to sample with 80V voltage constant pressure electrophoresis, adjust voltage to 110V, constant pressure electrophoresis is until the bromophenol blue of instruction reaches gel bottom；

4) electrophoresis terminates, and carefully strips gel, gel is put into Stain Buffer after distilled water cleaning, 60rpm dyes Color 40min；

5) after dyeing, distilled water cleans gel, and 50mL quick decolorization liquid, 60rpm oscillation decolorations 30min is added；

6) quick decolorization liquid is outwelled, 50mL destainers at a slow speed, 60rpm oscillation decolorations, until can be observed clearly is added Protein band；

7) gel is eluted with water, uses Bio-Rad GS-800 Calibrated Densitometer scanning systems pair Protein gel is taken a picture, and is analyzed protein band image and its concentration using Quantity One softwares.

SDS-PAGE electrophoretic analysis show express bacterial strain can under IPTG concentration 0.8mM, 37 DEG C of condition of culture big scale It reaches, albumen size is consistent with prediction result.Keep IPTG concentration constant, it is 16 DEG C, 20 DEG C and 28 DEG C to change inducing temperature, timesharing Between take bacterium solution extract albumen, using SDS-PAGE electrophoresis detections, at 16 DEG C when Fiber differentiation 18h albumen supernatant detection, phase Than in the expression structure of pQE-30a zero load bacterial strains, M15/pQE30a-ppk44, M15/pQE30a-ppk73 and BL21 (DE3)/ PET28a-ppk33 has apparent protein band (Fig. 4) occur in 75kDa or so, shows that 3 expression bacterial strains can be at low temperature Destination protein is expressed into supernatant, is soluble protein.

4. molybdenum-antimony anti-spectrophotometric method

1) Specification Curve of Increasing

It prepares phosphorus standard and uses solution.Take 0 respectively, 0.2,0.4,0.8,1.2,1.6,2,3,4,5mL phosphorus standard solution it is (dense Degree be 2 μ g/mL) in test tube with cover, be added distilled water to total volume be 10mL, be added 1.6mL potassium peroxydisulfates, mixing, 120 DEG C Clear up 30min.After cooling, 0.4mL ascorbic acid solutions, mixing is added；After 30s, addition 0.8mL molybdate mixed liquors, mixing, It is stored at room temperature 15min.Under 700nm wavelength, with No. 1 for blank reference, its absorbance is measured, and draw standard curve.

2) total phosphorus content in bacterium solution measures

1.5mL bacterium solutions are taken to be placed in sterilized centrifuge tube, 4 DEG C, 6000rpm centrifuges 15min.After taking 1mL to centrifuge respectively Supernatant, the culture solution, the distilled water that do not connect bacterium be placed in test tube with cover, it is 10mL that distilled water to total volume, which is added, is added 1.6mL potassium peroxydisulfate, mixing, 120 DEG C of resolution 30min.After cooling, 0.4mL ascorbic acid solutions, mixing is added；After 30s, add Enter 0.8mL molybdate mixed liquors, mixing is stored at room temperature 15min.Under 700nm wavelength, to distill water pipe as blank reference, respectively Measure its absorbance.

It is control with the E.coli bacterial strains containing pET-28a or pQE-30a, expression bacterial strain is inoculated in synthetic wastewater training respectively It supports in base, 37 DEG C of good support are cultivated, and are acquired bacterium solution after IPTG derivants 10h is added, are measured the bacterium solution of expression bacterial strain and control strain Supernatant phosphorus content, and the dephosphorization amount and poly- phosphorus rate (table 1) of each bacterial strain are counted respectively, expression bacterial strain BL21 (DE3)/pET28a- The dephosphorization amount of ppk33 is 3.3 times of its corresponding control strain, and expression bacterial strain M15/pQE30a-ppk44 is that it corresponds to control strain 7 times of dephosphorization amount, the poly- phosphorus rates of 10h are up to 70%, show corresponding ppk genes overexpression in E.coli, thalline is caused to accumulate Poly- poly P, to make a large amount of phosphate in culture medium be effectively removed.

Table 1 expresses the poly- phosphorus ability of bacterial strain and measures (the initial concentration of synthetic wastewater phosphorus：10.11μmol/L)

Sequence table

<110>Hainan Normal University

<120>Three Polyphosphate kinase genes and the application in sewage dephosphorization

<130> 1

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2061

<212> DNA

<213> Acinetobacter. tandoii

<400> 1

atggaaaatt ttcaacattc atcagaaact tattttaatc gtgaattggc attactggag 60

tttaaccgac gcgtcttggc gcaagcacgc aataccgatt taccgctttt agaacggctc 120

aactttctca ttattttctc ccgcaacttg gacgagtttt ttgaaattcg tgttgcgggt 180

ttaatgaagc aacaggattt aaatgcgctg acgcgtatgc ctgatgccat tccgaccgat 240

gtggtgctag cagaactgtc acaacgggta catcaggcgg tacaggaaca gtacgatatt 300

ttgaatcatg ccatcctgcc gcagttacag gggctgggta ttcattttat tcagtaccaa 360

gacattttgg aaaagcataa agcgtggatc gctgcttatt ttgccaagca agttcaacca 420

gtcttgaccc cgattagcct tgatccatca catccttttc cgcgcttggt gaataaaagc 480

ctgaatttta ttgtcagttt ggaaggtaaa gatgcctttg ggcgcgagat agaactggca 540

attgtgcctg caccgcggtc attaccacgt ttaatcagtt tgcctgaaag cgtggaagga 600

caagaagaac aaatctttct gaccgcgatt attcagcaac atatcagtga cttgtttcca 660

gggatgaaag ccacaggctg ctatgccttc cgtgtaaccc gcaatgccga tttaatttta 720

tcggaagatg ttgatgattt ggcggtggcg ttaaaagatg aattgtcttc acgccgtttt 780

gggcgtgcgg tacgtttgga aattgaagat gattgcccgc gtagtattgt ggattattta 840

ttgaatgaat ttgatctcga tcaacaacat ttgtattcga tttcgggtcc gatcaattta 900

tcgcgcttga ccacgcattt taagcgtcca gatttaaaat atccggtctt taatcctgtt 960

attccgaagc cttttcgtaa gcagcagtcc atctttgagc ttttgaaaaa agaagatgtg 1020

ttgttgcatc atccttttga ttctttccag cctgtgatta gcctgttacg tgaagccgcg 1080

aaagatccaa atgtattggc gattaaacag accttgtatc gtagcggacc tgattccgag 1140

attgtgcaag tactggcaga agcggcacgc aatggtaaag aagtcactgc ggtgattgaa 1200

ctccgcgcac gttttgatga agagtccaat attaccgtgg ccaatgtttt gcaagaagca 1260

ggtgctgtgg tggtgtatgg cattgtgggc tataaaaccc atgccaaaat gattttgatc 1320

gtgcgccgag aagagcagca gttggtgcgt tatgtgcatt taggcacagg caattatcat 1380

gcgggcaatg ccaaactcta taccgattat agtttgatga ccacccagcc cgatatctgt 1440

gaagatgtgc atcgcatgtt ccaagaactg acgggcatgg gaaaaatggc aaaattaaaa 1500

accttgctgc atgcaccgtt taccttacat gctgaattac tcaagctgat tgagcaggaa 1560

atagaatatg cgcaagcggg caaaactgca cggattatca ttaaggtcaa tgccctgacc 1620

gaaccgcagt tgattgctgc tttatatcgg gcctcacagg ctggggtaaa gattgacctg 1680

attatccgtt ctatttgttg cttagtgccg caattggcag ggctatccga taatattcgg 1740

gtgcgttcaa ttgtggggcg ctttctggaa catacccgag tctattattt tgagcagggc 1800

ggggaaaaga aactgtactg tgccagtgcc gattggatgg gacgtaattt gttctcacgg 1860

gttgaaacct gtttcccgat tttagatccg aagattaaga agcggatttt acaagatggc 1920

ttacaaaact acttgtctga tcatcacgga acttgggaac tccaagcctc tggcgagtgg 1980

ttgaaagcgc aagcacctga agggcaggtg ccgcattcgg cacaggaatt tttgatgaac 2040

aagagtctac agaaaatcta g 2061

<210> 2

<211> 2082

<212> DNA

<213> Acinetobacter. tandoii

<400> 2

atgaatacgg cggcacagac tcctttagag ccagttgaat atacttataa tgatcgattt 60

attaatcgtg aactttctat tttagatttc catttacgtg ttcttgagca agctgtcgat 120

ccgctgcatc cactcttgga acgcatgaac ttcttgctta ttttctcacg taatttagat 180

gagttttttg aaattcgtgt cgcaggcatg atggaacagc ttgatttggg caatgaaagt 240

cacaccccag atggattgac gccgaaacaa gtgttggaac agatttcgca aactgctcat 300

gcggcgattg aacgtcaata ccgtatttta aatgaagaaa ttttggcgaa actgcgcgaa 360

gaagatatct gcttcttacg ccgtggagag ttgacgccag cccaatcttc ttgggtgaaa 420

aaatacttcc aagaacaggt tgcgcccgtc ttaaccccaa ttagcctaga ccctgcacat 480

ccattcccgc gattagtcaa taaaagctta aactttattg tgacgctaga agggaaggat 540

gcttttggtc gtcagattga cttggccgtt gtacctgcac cacgctcatt gcctcgtgta 600

gtgcgtttac cggatgagct aacggggggt aaagaacatc atgtgatgtt gtctgccatt 660

attcatgagc atgtgtctga cctcttcccg gggatgacag caacgggttg ttatcagttc 720

cgtgtgacgc gtaatgccga tttagcctta aatgaagatg ttgaagactt agccaaagcg 780

ctcaaaggtg aattgaactc tcgccgtttt ggtcgtgcag tacgtttgga agtgactgag 840

aattgtccga aacatattta tgattatttg ctgaatgagt ttgatcttga agaagagcaa 900

ctgtataagg tggatggtcc agtcaacttg gcacgcttac tgtctaattt taagcgcccg 960

catttacgtt atgacacgca tacacctgta attccgaagg tgctaaaaaa gtctgaaaac 1020

attttttctg ctatgcaaaa gcaggacatt ctattacacc atccgtatga atcttttgcg 1080

cctgtgatca atttactgcg tgaagctgca cgtgatccgc aggtattggc aatcaagcaa 1140

accttgtacc gcagtggtgc cgattctgag attgtacaag tattggcaga ggctgcgcgt 1200

aacggtaaag aagtcactgc ggtgatagaa ttgcgtgccc gttttgatga agaatccaat 1260

atcgcggtag cgaatgtgct gcaagaagct ggtgcagtgg tggtgtatgg cattgtaggc 1320

tataaaaccc atgccaaaat gattttggtg gtacgccgtg aaaacaacaa attggtgcgt 1380

tatgtacatt taggtacagg taactaccat gcgggcaatg cacgtatcta taccgactac 1440

ggtttactca cgactgataa ggaactctgt gaagatgtgc atcgcatttt ccaagagtta 1500

acaggcatgg gtaaaatggc taagttgaaa aagctgttgc atgcgccatt taccttgcac 1560

gcacaactcc tcaatttcat tgatgatgag attgccaatg ccaaagcagg caaacctgcg 1620

caaatcattg tcaaagtgaa tgcactgact gaactgcaat taattaataa actttatgaa 1680

gcatcacaag ctggcgtgca gattgatctg attattcgtt caatttgttg cttacgtccg 1740

ggtttaccgg gtctgtctga aaatattcgt gtacgttcaa ttgtcggtcg tttcttggaa 1800

catactcgcg tttattattt tagtaataat ggcaatccgc atgtgtactg ctcaagtgca 1860

gactggatgg atcgtaactt gtttaatcga gttgaagcgt gcttcccaat tgaagatcca 1920

gcactgaaaa agcgaattta tcagcaaggt ttatttaatt atttaaaaga caatcaacag 1980

gcatggctat tacaaggtga tggctcatgg gtgcgtgcgc aagtggcaca gggtgaagat 2040

gcttataacg cacaaaggac tttgttggaa atgattaaat aa 2082

<210> 3

<211> 2010

<212> DNA

<213> Acinetobacter. tandoii

<400> 3

ttgtcaattt tagattttaa tttacgtgtc ttagaacaag cggtcgatcc tttaaatcca 60

ctcttagaaa aattgaattt tttattaatt ttttctagaa atttagatga gttttttgaa 120

attcgtgttg caactatgtt ggaacatttt gttcaagagc gagacataca aacggctgat 180

ggtttatccc cacaagaaat tttacatcaa atttcggaga cagcacatgc tgcgattgaa 240

cgccaatatc aaattttaaa tgagcaaatt tttccgcagt taagagaaga aggcatcagc 300

tttttaagac gtggagagtt aactcaagca caatctaatt gggtcaaaaa atattttcag 360

gaacaggttg caccagcctt aacaccaata agtttagatc ctgcgcatcc ctttccacgc 420

ttggtcaaca aatcacttaa tttcattgtg actttggaag gtaaggatgc ctttggccgt 480

cagatcgatt tggcagtggt tcctgcacca cgttcattgc cacgtgtggt gcgtttgcca 540

gatgagttga ccgaaggcaa agagcatcat gtgatgctct cttcaattat tcatactcat 600

gtgtctgatt tatttccggg aatgacggca acgggttgct atcaatttag agtaacccga 660

aatgcagatt taacgttaac tgaagatgtt gaagacttag cggaagcctt aaaagacgaa 720

ctcagttcac gccgttttgg tcgggcagta cgtttggagg tcaataaaaa ttgtccaaca 780

catatttatg aatacttact caaagaattc gatttggata cgcatcaatt gtatcgtgtc 840

gacgggcctg ttaatttggc tcgattggtc tcggatttta aacgcccata tttacgctat 900

gagccacata ctcctgtgat tccaaaaata ctgaaaaaat ctgcaaatat tttcagtgcg 960

atgcagaaac aagatatttt attgcatcat ccttttgaat cattttcccc tgtaattcga 1020

ttattacgtg aagccgcgca agatccgcat gttttggcca ttaaacagac cttgtaccgt 1080

agcggtgcaa attcagaaat tgtgcaaatt ttggctgagg cggcaagaaa tggtaaagaa 1140

gtcaccgcag tgattgaatt acgggcacgg tttgatgaag agtccaatat cgctgttgcc 1200

aatgttttac aggaagcggg tgccgtggtg gtatatggca ttgtcggcta taaaactcat 1260

gccaaaatga ttttggtggt acgccgagaa aatcaaaaac tggtgcgcta cgcacattta 1320

ggtacaggaa attatcatgc tggcaatgcc aaaatttaca ctgattacgg tttattaacg 1380

accaatcaag atttgtgtga agatgtacat cgtatttttc aagaattaac cggtatgggc 1440

aaaatggtga agttaaagaa acttctacat gcaccattta ctttgcatag tcagttgatg 1500

aattttattg aaaacgagat tgtgcttgcg aaagcaggga aaccggcaaa aattatcatt 1560

aaggtcaatg cactaaccga agttcaattg attaataaat tatacgaagc ttctcaagct 1620

ggtgtgcaaa tagaattaat cattcgttct atttgttgtt tacgtccagg cctaattggc 1680

ttatcagaaa atattcgtgt tcgctcaatt gtagggcgtt ttcttgagca tactcgtgtc 1740

tattattttt acaataatgg tgatacacgt gtgtattgtt ctagtgctga ctggatggag 1800

cgtaatttat ttaaacgtgt tgaagtgtgc tttcctattg aaaatactag actcaaaaaa 1860

agaatttatc agcaagggtt agaaaattat ttaatggata atcaacaagc atggctatta 1920

caaagtgatg gtagttggaa gcgtaactca tgcatagaaa atgaaaagcc acataatgcg 1980

cagcactttt tgttaagcgt tataaagtaa 2010

<210> 4

<211> 686

<212> PRT

<213> Acinetobacter. tandoii

<400> 4

Met Glu Asn Phe Gln His Ser Ser Glu Thr Tyr Phe Asn Arg Glu Leu

1 5 10 15

Ala Leu Leu Glu Phe Asn Arg Arg Val Leu Ala Gln Ala Arg Asn Thr

20 25 30

Asp Leu Pro Leu Leu Glu Arg Leu Asn Phe Leu Ile Ile Phe Ser Arg

35 40 45

Asn Leu Asp Glu Phe Phe Glu Ile Arg Val Ala Gly Leu Met Lys Gln

50 55 60

Gln Asp Leu Asn Ala Leu Thr Arg Met Pro Asp Ala Ile Pro Thr Asp

65 70 75 80

Val Val Leu Ala Glu Leu Ser Gln Arg Val His Gln Ala Val Gln Glu

85 90 95

Gln Tyr Asp Ile Leu Asn His Ala Ile Leu Pro Gln Leu Gln Gly Leu

100 105 110

Gly Ile His Phe Ile Gln Tyr Gln Asp Ile Leu Glu Lys His Lys Ala

115 120 125

Trp Ile Ala Ala Tyr Phe Ala Lys Gln Val Gln Pro Val Leu Thr Pro

130 135 140

Ile Ser Leu Asp Pro Ser His Pro Phe Pro Arg Leu Val Asn Lys Ser

145 150 155 160

Leu Asn Phe Ile Val Ser Leu Glu Gly Lys Asp Ala Phe Gly Arg Glu

165 170 175

Ile Glu Leu Ala Ile Val Pro Ala Pro Arg Ser Leu Pro Arg Leu Ile

180 185 190

Ser Leu Pro Glu Ser Val Glu Gly Gln Glu Glu Gln Ile Phe Leu Thr

195 200 205

Ala Ile Ile Gln Gln His Ile Ser Asp Leu Phe Pro Gly Met Lys Ala

210 215 220

Thr Gly Cys Tyr Ala Phe Arg Val Thr Arg Asn Ala Asp Leu Ile Leu

225 230 235 240

Ser Glu Asp Val Asp Asp Leu Ala Val Ala Leu Lys Asp Glu Leu Ser

245 250 255

Ser Arg Arg Phe Gly Arg Ala Val Arg Leu Glu Ile Glu Asp Asp Cys

260 265 270

Pro Arg Ser Ile Val Asp Tyr Leu Leu Asn Glu Phe Asp Leu Asp Gln

275 280 285

Gln His Leu Tyr Ser Ile Ser Gly Pro Ile Asn Leu Ser Arg Leu Thr

290 295 300

Thr His Phe Lys Arg Pro Asp Leu Lys Tyr Pro Val Phe Asn Pro Val

305 310 315 320

Ile Pro Lys Pro Phe Arg Lys Gln Gln Ser Ile Phe Glu Leu Leu Lys

325 330 335

Lys Glu Asp Val Leu Leu His His Pro Phe Asp Ser Phe Gln Pro Val

340 345 350

Ile Ser Leu Leu Arg Glu Ala Ala Lys Asp Pro Asn Val Leu Ala Ile

355 360 365

Lys Gln Thr Leu Tyr Arg Ser Gly Pro Asp Ser Glu Ile Val Gln Val

370 375 380

Leu Ala Glu Ala Ala Arg Asn Gly Lys Glu Val Thr Ala Val Ile Glu

385 390 395 400

Leu Arg Ala Arg Phe Asp Glu Glu Ser Asn Ile Thr Val Ala Asn Val

405 410 415

Leu Gln Glu Ala Gly Ala Val Val Val Tyr Gly Ile Val Gly Tyr Lys

420 425 430

Thr His Ala Lys Met Ile Leu Ile Val Arg Arg Glu Glu Gln Gln Leu

435 440 445

Val Arg Tyr Val His Leu Gly Thr Gly Asn Tyr His Ala Gly Asn Ala

450 455 460

Lys Leu Tyr Thr Asp Tyr Ser Leu Met Thr Thr Gln Pro Asp Ile Cys

465 470 475 480

Glu Asp Val His Arg Met Phe Gln Glu Leu Thr Gly Met Gly Lys Met

485 490 495

Ala Lys Leu Lys Thr Leu Leu His Ala Pro Phe Thr Leu His Ala Glu

500 505 510

Leu Leu Lys Leu Ile Glu Gln Glu Ile Glu Tyr Ala Gln Ala Gly Lys

515 520 525

Thr Ala Arg Ile Ile Ile Lys Val Asn Ala Leu Thr Glu Pro Gln Leu

530 535 540

Ile Ala Ala Leu Tyr Arg Ala Ser Gln Ala Gly Val Lys Ile Asp Leu

545 550 555 560

Ile Ile Arg Ser Ile Cys Cys Leu Val Pro Gln Leu Ala Gly Leu Ser

565 570 575

Asp Asn Ile Arg Val Arg Ser Ile Val Gly Arg Phe Leu Glu His Thr

580 585 590

Arg Val Tyr Tyr Phe Glu Gln Gly Gly Glu Lys Lys Leu Tyr Cys Ala

595 600 605

Ser Ala Asp Trp Met Gly Arg Asn Leu Phe Ser Arg Val Glu Thr Cys

610 615 620

Phe Pro Ile Leu Asp Pro Lys Ile Lys Lys Arg Ile Leu Gln Asp Gly

625 630 635 640

Leu Gln Asn Tyr Leu Ser Asp His His Gly Thr Trp Glu Leu Gln Ala

645 650 655

Ser Gly Glu Trp Leu Lys Ala Gln Ala Pro Glu Gly Gln Val Pro His

660 665 670

Ser Ala Gln Glu Phe Leu Met Asn Lys Ser Leu Gln Lys Ile

675 680 685

<210> 5

<211> 693

<212> PRT

<213> Acinetobacter. tandoii

<400> 5

Met Asn Thr Ala Ala Gln Thr Pro Leu Glu Pro Val Glu Tyr Thr Tyr

1 5 10 15

Asn Asp Arg Phe Ile Asn Arg Glu Leu Ser Ile Leu Asp Phe His Leu

20 25 30

Arg Val Leu Glu Gln Ala Val Asp Pro Leu His Pro Leu Leu Glu Arg

35 40 45

Met Asn Phe Leu Leu Ile Phe Ser Arg Asn Leu Asp Glu Phe Phe Glu

50 55 60

Ile Arg Val Ala Gly Met Met Glu Gln Leu Asp Leu Gly Asn Glu Ser

65 70 75 80

His Thr Pro Asp Gly Leu Thr Pro Lys Gln Val Leu Glu Gln Ile Ser

85 90 95

Gln Thr Ala His Ala Ala Ile Glu Arg Gln Tyr Arg Ile Leu Asn Glu

100 105 110

Glu Ile Leu Ala Lys Leu Arg Glu Glu Asp Ile Cys Phe Leu Arg Arg

115 120 125

Gly Glu Leu Thr Pro Ala Gln Ser Ser Trp Val Lys Lys Tyr Phe Gln

130 135 140

Glu Gln Val Ala Pro Val Leu Thr Pro Ile Ser Leu Asp Pro Ala His

145 150 155 160

Pro Phe Pro Arg Leu Val Asn Lys Ser Leu Asn Phe Ile Val Thr Leu

165 170 175

Glu Gly Lys Asp Ala Phe Gly Arg Gln Ile Asp Leu Ala Val Val Pro

180 185 190

Ala Pro Arg Ser Leu Pro Arg Val Val Arg Leu Pro Asp Glu Leu Thr

195 200 205

Gly Gly Lys Glu His His Val Met Leu Ser Ala Ile Ile His Glu His

210 215 220

Val Ser Asp Leu Phe Pro Gly Met Thr Ala Thr Gly Cys Tyr Gln Phe

225 230 235 240

Arg Val Thr Arg Asn Ala Asp Leu Ala Leu Asn Glu Asp Val Glu Asp

245 250 255

Leu Ala Lys Ala Leu Lys Gly Glu Leu Asn Ser Arg Arg Phe Gly Arg

260 265 270

Ala Val Arg Leu Glu Val Thr Glu Asn Cys Pro Lys His Ile Tyr Asp

275 280 285

Tyr Leu Leu Asn Glu Phe Asp Leu Glu Glu Glu Gln Leu Tyr Lys Val

290 295 300

Asp Gly Pro Val Asn Leu Ala Arg Leu Leu Ser Asn Phe Lys Arg Pro

305 310 315 320

His Leu Arg Tyr Asp Thr His Thr Pro Val Ile Pro Lys Val Leu Lys

325 330 335

Lys Ser Glu Asn Ile Phe Ser Ala Met Gln Lys Gln Asp Ile Leu Leu

340 345 350

His His Pro Tyr Glu Ser Phe Ala Pro Val Ile Asn Leu Leu Arg Glu

355 360 365

Ala Ala Arg Asp Pro Gln Val Leu Ala Ile Lys Gln Thr Leu Tyr Arg

370 375 380

Ser Gly Ala Asp Ser Glu Ile Val Gln Val Leu Ala Glu Ala Ala Arg

385 390 395 400

Asn Gly Lys Glu Val Thr Ala Val Ile Glu Leu Arg Ala Arg Phe Asp

405 410 415

Glu Glu Ser Asn Ile Ala Val Ala Asn Val Leu Gln Glu Ala Gly Ala

420 425 430

Val Val Val Tyr Gly Ile Val Gly Tyr Lys Thr His Ala Lys Met Ile

435 440 445

Leu Val Val Arg Arg Glu Asn Asn Lys Leu Val Arg Tyr Val His Leu

450 455 460

Gly Thr Gly Asn Tyr His Ala Gly Asn Ala Arg Ile Tyr Thr Asp Tyr

465 470 475 480

Gly Leu Leu Thr Thr Asp Lys Glu Leu Cys Glu Asp Val His Arg Ile

485 490 495

Phe Gln Glu Leu Thr Gly Met Gly Lys Met Ala Lys Leu Lys Lys Leu

500 505 510

Leu His Ala Pro Phe Thr Leu His Ala Gln Leu Leu Asn Phe Ile Asp

515 520 525

Asp Glu Ile Ala Asn Ala Lys Ala Gly Lys Pro Ala Gln Ile Ile Val

530 535 540

Lys Val Asn Ala Leu Thr Glu Leu Gln Leu Ile Asn Lys Leu Tyr Glu

545 550 555 560

Ala Ser Gln Ala Gly Val Gln Ile Asp Leu Ile Ile Arg Ser Ile Cys

565 570 575

Cys Leu Arg Pro Gly Leu Pro Gly Leu Ser Glu Asn Ile Arg Val Arg

580 585 590

Ser Ile Val Gly Arg Phe Leu Glu His Thr Arg Val Tyr Tyr Phe Ser

595 600 605

Asn Asn Gly Asn Pro His Val Tyr Cys Ser Ser Ala Asp Trp Met Asp

610 615 620

Arg Asn Leu Phe Asn Arg Val Glu Ala Cys Phe Pro Ile Glu Asp Pro

625 630 635 640

Ala Leu Lys Lys Arg Ile Tyr Gln Gln Gly Leu Phe Asn Tyr Leu Lys

645 650 655

Asp Asn Gln Gln Ala Trp Leu Leu Gln Gly Asp Gly Ser Trp Val Arg

660 665 670

Ala Gln Val Ala Gln Gly Glu Asp Ala Tyr Asn Ala Gln Arg Thr Leu

675 680 685

Leu Glu Met Ile Lys

690

<210> 6

<211> 669

<212> PRT

<213> Acinetobacter. tandoii

<400> 6

Leu Ser Ile Leu Asp Phe Asn Leu Arg Val Leu Glu Gln Ala Val Asp

1 5 10 15

Pro Leu Asn Pro Leu Leu Glu Lys Leu Asn Phe Leu Leu Ile Phe Ser

20 25 30

Arg Asn Leu Asp Glu Phe Phe Glu Ile Arg Val Ala Thr Met Leu Glu

35 40 45

His Phe Val Gln Glu Arg Asp Ile Gln Thr Ala Asp Gly Leu Ser Pro

50 55 60

Gln Glu Ile Leu His Gln Ile Ser Glu Thr Ala His Ala Ala Ile Glu

65 70 75 80

Arg Gln Tyr Gln Ile Leu Asn Glu Gln Ile Phe Pro Gln Leu Arg Glu

85 90 95

Glu Gly Ile Ser Phe Leu Arg Arg Gly Glu Leu Thr Gln Ala Gln Ser

100 105 110

Asn Trp Val Lys Lys Tyr Phe Gln Glu Gln Val Ala Pro Ala Leu Thr

115 120 125

Pro Ile Ser Leu Asp Pro Ala His Pro Phe Pro Arg Leu Val Asn Lys

130 135 140

Ser Leu Asn Phe Ile Val Thr Leu Glu Gly Lys Asp Ala Phe Gly Arg

145 150 155 160

Gln Ile Asp Leu Ala Val Val Pro Ala Pro Arg Ser Leu Pro Arg Val

165 170 175

Val Arg Leu Pro Asp Glu Leu Thr Glu Gly Lys Glu His His Val Met

180 185 190

Leu Ser Ser Ile Ile His Thr His Val Ser Asp Leu Phe Pro Gly Met

195 200 205

Thr Ala Thr Gly Cys Tyr Gln Phe Arg Val Thr Arg Asn Ala Asp Leu

210 215 220

Thr Leu Thr Glu Asp Val Glu Asp Leu Ala Glu Ala Leu Lys Asp Glu

225 230 235 240

Leu Ser Ser Arg Arg Phe Gly Arg Ala Val Arg Leu Glu Val Asn Lys

245 250 255

Asn Cys Pro Thr His Ile Tyr Glu Tyr Leu Leu Lys Glu Phe Asp Leu

260 265 270

Asp Thr His Gln Leu Tyr Arg Val Asp Gly Pro Val Asn Leu Ala Arg

275 280 285

Leu Val Ser Asp Phe Lys Arg Pro Tyr Leu Arg Tyr Glu Pro His Thr

290 295 300

Pro Val Ile Pro Lys Ile Leu Lys Lys Ser Ala Asn Ile Phe Ser Ala

305 310 315 320

Met Gln Lys Gln Asp Ile Leu Leu His His Pro Phe Glu Ser Phe Ser

325 330 335

Pro Val Ile Arg Leu Leu Arg Glu Ala Ala Gln Asp Pro His Val Leu

340 345 350

Ala Ile Lys Gln Thr Leu Tyr Arg Ser Gly Ala Asn Ser Glu Ile Val

355 360 365

Gln Ile Leu Ala Glu Ala Ala Arg Asn Gly Lys Glu Val Thr Ala Val

370 375 380

Ile Glu Leu Arg Ala Arg Phe Asp Glu Glu Ser Asn Ile Ala Val Ala

385 390 395 400

Asn Val Leu Gln Glu Ala Gly Ala Val Val Val Tyr Gly Ile Val Gly

405 410 415

Tyr Lys Thr His Ala Lys Met Ile Leu Val Val Arg Arg Glu Asn Gln

420 425 430

Lys Leu Val Arg Tyr Ala His Leu Gly Thr Gly Asn Tyr His Ala Gly

435 440 445

Asn Ala Lys Ile Tyr Thr Asp Tyr Gly Leu Leu Thr Thr Asn Gln Asp

450 455 460

Leu Cys Glu Asp Val His Arg Ile Phe Gln Glu Leu Thr Gly Met Gly

465 470 475 480

Lys Met Val Lys Leu Lys Lys Leu Leu His Ala Pro Phe Thr Leu His

485 490 495

Ser Gln Leu Met Asn Phe Ile Glu Asn Glu Ile Val Leu Ala Lys Ala

500 505 510

Gly Lys Pro Ala Lys Ile Ile Ile Lys Val Asn Ala Leu Thr Glu Val

515 520 525

Gln Leu Ile Asn Lys Leu Tyr Glu Ala Ser Gln Ala Gly Val Gln Ile

530 535 540

Glu Leu Ile Ile Arg Ser Ile Cys Cys Leu Arg Pro Gly Leu Ile Gly

545 550 555 560

Leu Ser Glu Asn Ile Arg Val Arg Ser Ile Val Gly Arg Phe Leu Glu

565 570 575

His Thr Arg Val Tyr Tyr Phe Tyr Asn Asn Gly Asp Thr Arg Val Tyr

580 585 590

Cys Ser Ser Ala Asp Trp Met Glu Arg Asn Leu Phe Lys Arg Val Glu

595 600 605

Val Cys Phe Pro Ile Glu Asn Thr Arg Leu Lys Lys Arg Ile Tyr Gln

610 615 620

Gln Gly Leu Glu Asn Tyr Leu Met Asp Asn Gln Gln Ala Trp Leu Leu

625 630 635 640

Gln Ser Asp Gly Ser Trp Lys Arg Asn Ser Cys Ile Glu Asn Glu Lys

645 650 655

Pro His Asn Ala Gln His Phe Leu Leu Ser Val Ile Lys

660 665

Claims (3)

1. two kinds of engineering bacterias, it is characterised in that the engineering bacteria is respectively BL21 (DE3)/pET28a-ppk33, M15/pQE30a- ppk44；The DNA sequence dna of wherein ppk33, ppk44 are respectively provided with the nucleotide sequence as shown in SEQ NO 1, SEQ NO 2.

2. application of the two kinds of engineering bacterias described in claim 1 in sewage dephosphorization.

3. two novel Polyphosphate kinase gene ppk33, ppk44 are in preparation engineering bacterium BL21 (DE3)/pET28a- Application in ppk33, M15/pQE30a-ppk44；The DNA sequence dna of wherein ppk33, ppk44 are respectively provided with such as SEQ NO 1, SEQ Nucleotide sequence shown in NO 2.