CN110229846B

CN110229846B - Universal positive standard plasmid for screening transgenic rice and construction method thereof

Info

Publication number: CN110229846B
Application number: CN201910538395.3A
Authority: CN
Inventors: 马卉; 汪秀峰; 张秀杰; 许学; 李夏莹; 焦小雨; 陈子言; 赵伟
Original assignee: Rice Research Institute of Anhui Academy of Agricultural Sciences
Current assignee: Rice Research Institute of Anhui Academy of Agricultural Sciences
Priority date: 2019-06-20
Filing date: 2019-06-20
Publication date: 2020-08-18
Anticipated expiration: 2039-06-20
Also published as: CN110229846A

Abstract

The invention discloses a universal positive standard plasmid for screening transgenic rice and a construction method thereof; the universal positive standard plasmid comprises a vector framework and a screening element, wherein the screening element comprises a CaMV35S promoter, a Ubiquitin promoter, an NOS terminator, a CaMV35S terminator, a Bar gene, an HPT gene, a Bt gene, an SPS gene and a PLD gene. The invention further discloses a method for constructing the universal positive standard plasmid and application of the universal positive standard plasmid in screening, detecting and monitoring of transgenic rice. When screening and detecting transgenic rice, the universal positive standard plasmid provided by the invention is used as a positive reference substance and a quality control sample to detect various transgenic rice, and has the characteristics of wide applicability, wide coverage and the like.

Description

Universal positive standard plasmid for screening transgenic rice and construction method thereof

Technical Field

The invention relates to a universal positive standard plasmid, in particular to a universal positive standard plasmid for screening transgenic rice, further relates to a construction method of the universal positive standard plasmid and application of the universal positive standard plasmid in screening, detecting and monitoring of the transgenic rice, and belongs to the field of construction and application of the universal positive standard plasmid for screening the transgenic rice.

Background

With the rapid development of transgenic organism development and commercialization worldwide, more and more transgenic crops are approved for commercial planting in different countries and regions. As for rice, many transgenic rice with insect resistance, disease resistance, herbicide tolerance and improved nutrient content are successfully developed at present. However, transgenic crops have great social and economic benefits and potential environmental and food safety problems, and are always controversial.

As an important grain crop, only the transgenic insect-resistant rice variety Huahui No.1 and the hybrid Bt Shanyou 63 thereof obtain a production application safety certificate issued by the Ministry of agriculture in 2009 at present, and are not approved for commercial planting. However, from 2005, the phenomenon that rice is polluted by transgenic components such as LLRICE601, Bt SHANYOU 63, KEFEN No.6 and Ke-Ming-dao is continuously discovered in China and China. With the rapid development of the biotechnology industry, more and more transgenic crops are approved and in the field test stage, the risk of accidental or intentional leakage of the transgenic crops is increased, the threat to the environment and food safety is caused, and the panic and trade dispute of people are easily caused. Therefore, it is important to enhance the screening, detection and supervision of transgenic rice.

In the daily detection process, the positive standard substance is a scale in the detection process, but the operation process of preparing the standard substance by using plant raw materials is complex, and the requirements on the environment and instruments and equipment are higher. In the process of transgene screening detection, a plurality of detection mechanisms select a conversion event specificity detection standard substance containing a corresponding target as a positive control according to the detected target, so that a plurality of positive controls are required for a plurality of detection targets in screening detection, the detection cost is improved, and the detection work is inconvenient.

In 2002, a positive plasmid standard substance proposed by japanese scientist Kuribara H can construct a plurality of exogenous target genes into one plasmid molecule together by using a gene synthesis technology without depending on raw materials, and the plasmid molecule can be stored and cultured in a large amount by microorganisms. The plasmid DNA is easy to extract and has higher purity, the problems of lack of positive standard substances and difficult preparation can be effectively solved, and convenience is brought to detection work. Therefore, the development of a positive plasmid molecule for screening and detecting transgenic rice is of great significance.

At present, partial patents and documents report recombinant standard plasmids for screening transgenic rice, for example, in 2013, CaMV35S promoter, SPS gene, Bt gene, NPT II gene, Htp gene, Bar gene and NOS terminator fragments are cloned and constructed into a vector pUC-19 by using an overlapping PCR technology to obtain the recombinant standard plasmid pUC-RS (the name of the invention is a recombinant standard plasmid and a kit for screening transgenic rice; the patent application publication number is CN 103215346A). And in the year of Li Xiaofei equals 2013, CaMV35S promoter, NOS terminator, marker genes Bar, HPT and NPT II genes are used as screening detection targets of transgenic Rice to construct a plasmid molecule pBS Rice for detecting the transgenic Rice (Li Xiaofei et al, construction and application of a positive plasmid molecule for detecting the transgenic Rice, 2013).

However, the existing method for screening and detecting the target sequences of different degrees of existing elements of the positive plasmid molecules of the transgenic rice has the defects of narrow applicability, not wide enough coverage and the like, and needs to be improved.

Disclosure of Invention

The invention aims to provide a positive plasmid molecule capable of screening and detecting transgenic rice, which can be used as a positive reference substance and a quality control sample to detect various transgenic rice when the transgenic rice is screened and detected, and has the advantages of wide applicability, wider coverage and the like.

In order to achieve the purpose, the invention provides the following technical scheme:

a universal positive standard plasmid for screening transgenic rice comprises a vector skeleton and a screening element; wherein, the screening element comprises a CaMV35S promoter, a Ubiquitin promoter, an NOS terminator, a CaMV35S terminator, a Bar gene, an HPT gene, a Bt gene, an SPS gene and a PLD gene.

As a preferred embodiment, the SPS gene is selected from any one of the nucleotide sequences shown in SEQ ID No.8 or SEQ ID No.9 or is simultaneously selected from two sequences of SEQ ID No.8 or SEQ ID No. 9.

In a preferred embodiment, the nucleotide sequence of the CaMV35S promoter is shown as SEQ ID No. 1; the nucleotide sequence of the Ubiquitin promoter is shown in SEQ ID No. 2; the nucleotide sequence of the NOS terminator is shown as SEQ ID No. 3; the nucleotide sequence of the CaMV35S terminator is shown as SEQ ID No. 4; the nucleotide sequence of the Bar gene is shown in SEQ ID No. 5; the nucleotide sequence of the HPT gene is shown in SEQ ID No. 6; the nucleotide sequence of the Bt gene is shown in SEQ ID No. 7; the nucleotide sequence of the PLD gene is shown in SEQ ID No. 10.

The screening element is obtained by connecting a CaMV35S promoter, a Ubiquitin promoter, an NOS terminator sequence, a CaMV35S terminator, a Bar gene, an HPT gene, a Bt gene, an SPS gene and a PLD gene sequence according to any sequence; as a specific embodiment of the invention, the nucleotide sequence of a fusion gene obtained by connecting a CaMV35S promoter, a Ubiquitin promoter, an NOS terminator sequence, a CaMV35S terminator, a Bar gene, an HPT gene, a Bt gene, an SPS gene and a PLD gene sequence in sequence is shown as SEQ ID No. 11.

The invention further provides a construction method of the universal positive standard plasmid, which comprises the following steps: splicing a CaMV35S promoter, a Ubiquitin promoter, an NOS terminator, a CaMV35S terminator, a Bar gene, an HPT gene, a Bt gene, an SPS gene and a PLD gene together to obtain a fusion gene; connecting the fusion gene to a vector skeleton to obtain a recombinant plasmid; and transforming the recombinant plasmid into an escherichia coli receptor bacterium to obtain the recombinant plasmid.

As a preferred embodiment, the nucleotide sequence of a fusion gene obtained by splicing together the CaMV35S promoter, the Ubiquitin promoter, the NOS terminator, the CaMV35S terminator, the Bar gene, the HPT gene, the Bt gene, the SPS gene and the PLD gene in this order is shown in SEQ ID No. 11.

In a preferred embodiment, the vector backbone is the pUC18 plasmid.

The universal positive standard plasmid provided by the invention can be applied to screening, detecting and monitoring of transgenic rice; the method comprises the following steps: the universal positive standard plasmid is used as a positive control plasmid or a positive standard substance for detecting the transgenic rice, and the common PCR and real-time fluorescence PCR screening detection of transgenic components is carried out on a rice sample to be detected.

Detailed technical solution of the present invention

According to the invention, 8 transgenic rice transformants are inquired by referring to a GM ApprovalDatabase database of an international agricultural biotechnology application service organization (ISAAA) website. Among them, 2 domestically developed rice transformants were contained: the transgenic Bt rice Huahui No. 1/TT 51-1 and a hybrid Bt Shanyou 63 thereof. Combining the searched and collected information of transformation elements, marker genes and the like of 11 domestic rice transformants. 7 rice screening elements/genes were selected: CaMV35S promoter, Ubiquitin promoter, NOS terminator, CaMV35S terminator, Bar gene, HPT gene and Bt gene; and 2 rice internal standard genes: SPS (2 fragments) and PLD, were used to construct transgenic rice screening element positive plasmid molecules. The 7 exogenous elements/genes are detected, and the full coverage of 19 known transgenic rice varieties can be realized.

Relevant transgenic detection methods are retrieved through a transgenic detection method database (GMDD, http:// gmdd.sjtu.edu.cn /) and an European Union transgenic food and feed reference method database (http:// gmo-crl.jrc.ec.europa.eu/gmomethods /), and target sequences of transgenic rice screening elements/genes and internal standard genes are finally determined by combining published agricultural ministerial standards, relevant detection methods and sequence information on existing patents or documents.

The sequence numbers and the nucleotide fragments of the transgenic rice screening element/gene and the internal standard gene are shown in Table 1:

TABLE 1 Rice screening elements/genes and internal Standard genes sequence numbers

Therefore, the invention provides a positive universal standard plasmid for screening transgenic rice, which is a positive plasmid molecule of a polymerized transgenic rice screening element/gene and 2 common rice internal standard genes, contains nucleotide fragments in SEQ ID No. 1-SEQ ID No.7 and SEQ ID No.10, and contains any one or two nucleotide fragments in SEQ ID No. 8-SEQ ID No. 9.

Preferably, the plasmid molecule of the transgenic rice screening element contains ten nucleotide fragments of SEQ ID No. 1-SEQ ID No. 10; the ten nucleotide fragments may be ligated in any order.

In the embodiment of the invention, 7 rice screening elements/genes (pCaMV35S, pUbiquitin, tNOS, tCaMV35S, Bar, HPT, Bt) and detection target sequences SEQ ID No. 1-SEQ ID No.10 of 2 common rice internal standard genes (SPS and PLD) are spliced together into a sequence SEQ ID No.11 with the length of 3791bp according to the sequence of SEQ ID No. 1-SEQ ID No. 10; the spliced fusion sequence SEQ ID No.11 is artificially synthesized and loaded on a pUC18 plasmid, so that a positive plasmid molecule of the transgenic RICE screening element is obtained and is marked as pUC 18-RICE-screen.

PCR amplification verification proves that the constructed positive plasmid molecules of the transgenic rice screening element have the characteristics of wide screening coverage area, easiness in obtaining a large amount, simplicity in preparation and the like, can be used as a positive control sample in screening and detecting of transgenic rice, and is used for screening, detecting and monitoring of most announced rice transformants and the transgenic rice under research. Experiments prove that the pUC 18-RICE-screen plasmid is used as a positive control and is suitable for 7 screening elements/genes listed in tables 13 and 14 and 2 RICE internal standard genes of the existing department of agriculture and entry and exit standards, so that the technical problem that the positive control or the standard product is lacked in the screening and detection of the transgenic RICE is effectively solved, the problem that a plurality of positive controls are prepared for a plurality of detection targets in the screening and detection is avoided, and the labor cost and the economic cost are obviously reduced.

Drawings

FIG. 119 shows the exogenous element information matrix of transgenic rice.

FIG. 2 is a schematic overlay of 19 rice transformants with 7 screening elements selected.

Fig. 3 determination of target sequence of pCaMV 35S.

FIG. 4 target sequence determination of pUbiquitin.

FIG. 5 determination of target sequence for tNOS.

FIG. 6 target sequence determination of tCaMV 35S.

FIG. 7 target sequence determination of Bar gene.

FIG. 8 target sequence determination of HPT gene.

FIG. 9 target sequence determination of Bt genes.

Target sequence determination for the reference gene SPS (1) in FIG. 10.

Target sequence determination of the reference gene SPS (2) in FIG. 11.

Target sequence determination of the standard gene PLD in fig. 12.

FIG. 13 is a diagram of the construction of a pUC 18-RICE-screen positive plasmid molecule constructed according to the present invention.

FIG. 14 is an electrophoresis chart of the validation of the applicability of the conventional general PCR qualitative detection standard for each element/gene of pUC 18-RICE-screen positive plasmid molecule obtained in example 1.

FIG. 15 is an electrophoretogram of pUC 18-RICE-screen positive plasmid obtained in example 1 for a suitable concentration test experiment for general PCR qualitative detection of each element/gene.

FIG. 16 is a graph of the amplification curve of the pUC 18-RICE-screen positive plasmid obtained in example 1 for a suitable concentration test experiment for real-time fluorescent PCR detection of each element/gene.

Detailed Description

The invention is further described below in conjunction with specific embodiments, the advantages and features of which will become apparent from the description. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be within the scope of the invention.

Example 1 construction of Universal Positive Standard plasmid for transgenic Rice screening

1. Determination of detection target of transgenic rice

The exogenous expression frame inserted by the exogenous gene of the rice transformant is obtained by searching a 'GM ApprovaDatase' database of an international agricultural biotechnology application service organization (ISAAA) website, related patents and literatures, and separating, identifying and sequencing. Finally obtaining the information of transformation elements, marker genes and the like of 19 rice transformants at home and abroad. Table 2 shows the information and the source of the transgenic rice lines involved in the present invention.

TABLE 2 information and sources related to transgenic rice lines involved in the present invention

The use frequency of each gene element in each rice transformant is comparatively analyzed by counting the elements/genes contained in the exogenous expression frame inserted into the rice transformant and drawing a matrix diagram (figure 1), and a CaMV35S promoter, a Ubiquitin promoter, a NOS terminator, a CaMV35S terminator, a Bar gene, an HPT gene and a Bt gene are selected as targets for screening and detecting the transgenic rice. And 2 rice internal standard genes: SPS and PLD are combined to construct positive plasmid of transgenic rice screening element.

As can be seen from the schematic coverage of the 19 rice transformants with the selected 7 screening elements (FIG. 2), the coverage of the above 7 screening elements can reach 100% when the 19 rice transformants involved in the present invention are tested. Among them, the transformants 114-7-2 and PA110-15 were covered 1 time, and the remaining transformants were covered 2 or more times.

2. Determination of target sequences

Detection primer sequences (Table 3-Table 12) for sorting and screening the related detection methods of the element/gene and the internal standard gene were collected and aligned with the nucleotide sequences of the respective elements/genes by searching the Ministry of agriculture, entry and exit standards, European Union transgenic food and feed reference method database (http:// gmo-crl.jrc.ec.europa.eu/gmomethods /) and transgenic detection method database (GMDD, http:// gmdd.sjtu.edu.cn /), respectively (FIG. 3-FIG. 12). The selection of each screening element/gene target sequence follows the principle of striving for the widest applicability, and finally determines the target sequences of the screening elements/genes and the internal standard genes of the transgenic rice.

(1) The target sequence of pCaMV35S was determined as shown in fig. 3.

TABLE 3 primer/Probe sequences corresponding to CaMV35S promoter detection standards

(2) The target sequence of pUbiquitin was determined as shown in FIG. 4.

TABLE 4 primer/Probe sequences corresponding to the Ubiquitin promoter detection Standard

(3) the target sequence of tNOS is determined as shown in FIG. 5.

TABLE 5 primer/Probe sequences corresponding to NOS terminator detection standards

(4) the target sequence of tCaMV35S was determined as shown in fig. 6.

TABLE 6 primer/Probe sequences corresponding to CaMV35S promoter detection standards

(5) The target sequence of the Bar gene was determined as shown in FIG. 7.

TABLE 7 primer/Probe sequences corresponding to Bar Gene detection standards

(6) The target sequence of the HPT gene was determined as shown in FIG. 8.

TABLE 8 primer/Probe sequences corresponding to HPT Gene detection standards

(7) The target sequence of the Bt gene was determined as shown in fig. 9.

TABLE 9 primer/probe sequences corresponding to Bt Gene detection standards

(8) The target sequence of the internal standard gene SPS (1) (SEQ ID No.8) was determined as shown in FIG. 10.

TABLE 10 primer/Probe sequences corresponding to SPS Gene detection standards

(9) The target sequence of the internal standard gene SPS (2) (SEQ ID No.9) was determined as shown in FIG. 11.

TABLE 11 primer/Probe sequences corresponding to SPS Gene detection standards

(10) The target sequence of the internal standard gene PLD was determined as shown in fig. 12.

TABLE 12 primer/Probe sequences corresponding to PLD Gene detection standards

3. Construction and preservation of Universal Positive Standard plasmids

According to the corresponding nucleotide sequences in Table 1, the target sequences SEQ ID No. 1-SEQ ID No.10 are spliced into a sequence SEQ ID No.11 with the length of 3791bp in sequence. The spliced fusion sequence SEQ ID No.11 is artificially synthesized and loaded on a pUC18 plasmid, so that a positive plasmid of the transgenic RICE screening element is obtained and named as pUC 18-RICE-screen. The ligation sequence and plasmid molecular size are shown in FIG. 13.

The constructed positive plasmid pUC 18-RICE-screen is transformed into recipient bacterium of Escherichia coli, the bacterium is preserved in a refrigerator at-80 deg.C, and ampicillin resistance (Amp) is used as vector⁺) Is a screening marker.

3. Extraction, purification and sequencing verification of positive plasmids

The deposited strain was plated out, cultured overnight at 37 ℃ and the next day a monoclonal colony was picked up containing ampicillin resistance (Amp)⁺) The cells were cultured at 37 ℃ and 200rpm for 12 hours in LB medium, and then a plasmid-based small-volume DNA extraction kit (AxyPrep) from Axygen was used^TMPlasmid Miniprep Kit) for extraction and purification.

The extracted and purified plasmid molecules were subjected to sequencing validation. Sequencing analysis results show that the pUC 18-RICE-screen plasmid is composed of 2653bp of pUC18 vector framework and 3791bp of screening element integrated sequence (target sequence), the total length of the sequence is 6444bp, and the exogenous sequence in the positive plasmid is consistent with the expected sequence.

Test example 1 test for verifying applicability of each element/gene of positive plasmid molecule to conventional common PCR qualitative test standard

1. Extraction and detection of positive plasmid pUC 18-RICE-screen

Escherichia coli containing a positive plasmid molecule pUC 18-RICE-screen was cultured at 37 ℃ and 200rpm for 12 hours, and the Axygen plasmid small-amount DNA extraction kit (AxyPrep) was used^TMPlasmid Miniprep Kit) instructions to extract Plasmid DNA. The purity and concentration of the plasmid are detected by an ultramicro nucleic acid protein detector, and the result shows thatOD₂₆₀/OD₂₈₀The ratio of (A) to (B) is about 1.8, and meets the requirements of qualitative and quantitative PCR detection.

2. Positive plasmid verification PCR verification of transgenic RICE screening element positive plasmid pUC 18-RICE-screen was performed using the following corresponding bulletin, general PCR primers in the standard (Table 13), reaction system and program (Table 14), and it was checked whether the constructed plasmid contained the expected foreign fragment and was suitable for the existing Ministry of agriculture and entry and exit general PCR qualitative detection standard, PCR amplification was performed using a PCR instrument manufactured by ABI, and the results are shown in FIG. 14. As can be seen from FIG. 14, the screening elements/genes were all amplified efficiently, indicating that the constructed plasmids contain the expected genes of interest and are suitable for the existing Ministry of agriculture and entry and exit detection standards.

TABLE 13 screening element/Gene and internal Standard Gene general PCR detection primers

Test example 2 transgenic Rice screening element Positive plasmid pUC 18-RICE-screen for general PCR qualitative detection of appropriate concentration test

Based on the initial concentration and size of positive plasmid DNA, ddH was used₂O diluting it to 1 × 10⁸copies/. mu.L (gradient 1), 1 × 10⁷copies/. mu.L (gradient 2), 1 × 10⁶copies/. mu.L (gradient 3), 1 × 10⁵copies/. mu.L (gradient 4), 1 × 10⁴copies/. mu.L (gradient 5), 1 × 10³copies/. mu.L (gradient 6), 1 × 10²copies/. mu.L (gradient 7), 1 × 10 copies/. mu.L (gradient 8), 1 copies/. mu.L (gradient 9), stored at 4 ℃ until use.

DNA samples of the positive plasmid pUC18-RICE-sceen at different concentrations (1 × 10)⁸、1×10⁷、1×10⁶、1×10⁵、1×10⁴、1×10³、1×10²1 × 10, 1 copies/. mu.L) as a template, and performing ordinary PCR amplification by using a corresponding notice of each element/gene, a primer (table 13) in the standard, a reaction system and a program (table 14) to judge the appropriate concentration of the positive plasmid of the transgenic rice screening element for the ordinary PCR qualitative detection.

The results of the experiments showed that each screening element/gene had a plasmid concentration of 1 × 10²Plasmid samples of copies/μ L (gradient 7) and pUC 18-RICE-screen above can be amplified (FIG. 15) to meet the requirement of qualitative PCR detection of corresponding elements/genes, plasmid molecule pUC 18-RICE-screen is used as positive control for common PCR screening detection, and the appropriate concentration range for stable amplification is 1 × 10³～1×10⁵copies/μL。

Test example 3 transgenic Rice screening element Positive plasmid pUC 18-RICE-screen for appropriate concentration test for real-time fluorescent PCR detection

Selection of 5 of the 9 concentration gradients in Experimental example 2-1 × 10⁶copies/. mu.L (gradient 3), 1 × 10⁵copies/. mu.L (gradient 4), 1 × 10⁴copies/. mu.L (gradient 5), 1 × 10³copies/. mu.L (gradient 6), 1 × 10²The transgenic RICE screening element positive plasmids of copies/muL (gradient 7) and 1 × 10 copies/muL (gradient 8) were used as DNA templates, and real-time fluorescence PCR detection was performed on the transgenic RICE screening element positive plasmids pUC 18-RICE-screen using an Applied Biosystems QuantStaudio 5 real-time quantitative PCR instrument using the following corresponding bulletin, fluorescent primers in the standard (Table 15), reaction system (Table 16) and reaction program, to determine the appropriate concentration of the transgenic RICE screening element positive plasmids for real-time fluorescence PCR detection.

The detection results show that each element/gene corresponds to the real-time fluorescent PCR detection primer at different concentrations (1 × 10)⁶、1×10⁵、1×10⁴、1×10³、1×10²1 × 10 copies/. mu.L) of the plasmid pUC 18-RICE-screen, which is suitable for the real-time fluorescent PCR detection standard of corresponding department of agriculture and entry and exit, and can meet the corresponding detection requirements, and the plasmid molecule pUC 18-RICE-screen as a positive control is used for the real-time fluorescent PCR detection of each screening element/gene, and the suitable concentration range is 1 × 10³～1×10⁵copies/μL。

TABLE 15 real-time fluorescent PCR detection primers for screening elements/genes and internal standard genes

TABLE 16 screening elements/genes real-time fluorescent PCR detection reaction system

Reagent	Volume of
		TaqMan reaction buffer	10.0μL
10 μmol/L upstream primer (F)	1.0μL
		10 μmol/L upstream primer (R)	1.0μL
10 μmol/L Probe (P)	0.5μL
		DNA template	2.0μL
ddH₂O	5.5μL
		Total volume	20.0μL

The reaction procedure is as follows: 50 ℃ for 2 min; 95 deg.C for 2 min; 95 ℃ for 1 s; 60 ℃ for 20 s; the number of cycles is 40; the fluorescence signal was collected during the second stage of annealing extension (60 ℃).

SEQUENCE LISTING

<110> institute of Paddy Rice of agricultural science institute of Anhui province

<120> universal positive standard plasmid for screening transgenic rice and construction method thereof

<130>AH-2001-190410A

<160>11

<170>PatentIn version 3.5

<210>1

<211>287

<212>DNA

<213>Artifical sequence

<400>1

aaaggaaggt ggctcctaca aatgccatca ttgcgataaa ggaaaggcta tcattcaaga 60

tgcctctgcc gacagtggtc ccaaagatgg acccccaccc acgaggagca tcgtggaaaa 120

agaagacgtt ccaaccacgt cttcaaagca agtggattga tgtgacatct ccactgacgt 180

aagggatgac gcacaatccc actatccttc gcaagaccct tcctctatat aaggaagttc 240

atttcatttg gagaggacag cccaagcttc gactctagag gatcccc 287

<210>2

<211>653

<212>DNA

<213>Artifical sequence

<400>2

caggattcct caaagagaaa cactggcaag ttagcaatca gaacatgtct gatgtacagg 60

tcgcatccgt gtacgaacgc tagcagcacg gatctaacac aaacacggat ctaacacaaa 120

catgaacaga agtagaacta ccgggcccta accatggacc ggaacgccga tctagagaag 180

gtagagagag gggggggggg aggatgagcg gcgtaccttg aagcggaggt gccgacgggt 240

ggatttgggg gagatctggt tgtgtgtgtg tgcgctccga acgaacacga ggttggggaa 300

agagggtgtg gagggggtgt ctatttatta cggcgggcga ggaagggaaa gcgaaggagc 360

ggtgggaaag gaatcccccg taggctgccg tgccgtgaga ggaggaggag gccgcctgcc 420

gtgccgcctc acgtctgccg ctccgccacg caatttctgg atgccgacag cggagcaagt 480

ccaacggtgg agcggaactc tcgagagggg tccagaggca gcgacagaga tgccgtgccg 540

tctgcttcgc ttggcccgac gcgacgctgc tggttcgctg gttggtgtcc gttagactcg 600

tcgacggcgt ttaacaggct ggcattatct actcgaaaca agaaaaatgt ttc 653

<210>3

<211>257

<212>DNA

<213>Artifical sequence

<400>3

cgatcgttca aacatttggc aataaagttt cttaagattg aatcctgttg ccggtcttgc 60

gatgattatc atataatttc tgttgaatta cgttaagcat gtaataatta acatgtaatg 120

catgacgtta tttatgagat gggtttttat gattagagtc ccgcaattat acatttaata 180

cgcgatagaa aacaaaatat agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc 240

tatgttacta gatcggg 257

<210>4

<211>209

<212>DNA

<213>Artifical sequence

<400>4

gatctgtcga tcgacaagct cgagtttctc cataataatg tgtgagtagt tcccagataa 60

gggaattagg gttcctatag ggtttcgctc atgtgttgag catataagaa acccttagta 120

tgtatttgta tttgtaaaat acttctatca ataaaatttc taattcctaa aaccaaaatc 180

cagtactaaa atccagatcc cccgaatta 209

<210>5

<211>440

<212>DNA

<213>Artifical sequence

<400>5

tcgtcaacca ctacatcgag acaagcacgg tcaacttccg taccgagccg caggaaccgc 60

aggagtggac ggacgacctc gtccgtctgc gggagcgcta tccctggctc gtcgccgagg 120

tggacggcga ggtcgccggc atcgcctacg cgggcccctg gaaggcacgc aacgcctacg 180

actggacggc cgagtcgacc gtgtacgtct ccccccgcca ccagcggacg ggactgggct 240

ccacgctcta cacccacctg ctgaagtccc tggaggcaca gggcttcaag agcgtggtcg 300

ctgtcatcgg gctgcccaac gacccgagcg tgcgcatgca cgaggcgctc ggatatgccc 360

cccgcggcat gctgcgggcg gccggcttca agcacgggaa ctggcatgac gtgggtttct 420

ggcagctgga cttcagcctg 440

<210>6

<211>500

<212>DNA

<213>Artifical sequence

<400>6

ccgattccgg aagtgcttga cattggggag tttagcgaga gcctgaccta ttgcatctcc 60

cgccgtgcac agggtgtcac gttgcaagac ctgcctgaaa ccgaactgcc cgctgttcta 120

caaccggtcg cggaggctat ggatgcgatc gctgcggccg atcttagcca gacgagcggg 180

ttcggcccat tcggaccgca aggaatcggt caatacacta catggcgtga tttcatatgc 240

gcgattgctg atccccatgt gtatcactgg caaactgtga tggacgacac cgtcagtgcg 300

tccgtcgcgc aggctctcga tgagctgatg ctttgggccg aggactgccc cgaagtccgg 360

cacctcgtgc acgcggattt cggctccaac aatgtcctga cggacaatgg ccgcataaca 420

gcggtcattg actggagcga ggcgatgttc ggggattccc aatacgaggt cgccaacatc 480

ttcttctgga ggccgtggtt 500

<210>7

<211>530

<212>DNA

<213>Artifical sequence

<400>7

aggccatctc taggttggaa ggtttgagca atctctacca aatctatgcagagagcttca 60

gagagtggga agccgatcct actaacccag ctctccgcgg ggaaatgcgt attcaattca 120

acgacatgaa cagcgccttg accacagcta tcccattgtt cgcagtccag aactaccaag 180

ttcctctctt gtccgtgtac gttcaagcag ctaatcttca cctcagcgtg cttcgagacg 240

ttagcgtgtt tgggcaaagg tggggattcg atgctgcaac catcaatagc cgttacaacg 300

accttactag gctgatcgga aactacaccg accacgctgt tcgttggtac aacactggct 360

tggagcgtgt ctggggtcct gattctagag attggattag atacaaccag ttcaggagag 420

aattgaccct cacagttttg gacattgtgt ctctcttccc gaactatgac tccagaacct 480

accctatccg tacagtgtcc caacttacca gagaaatcta tactaaccca 530

<210>8

<211>295

<212>DNA

<213>Artifical sequence

<400>8

ctttttattt gcgcctgaac ggatatcttt cagtttgtaa ccaccggatg acgcacggac 60

ggctcggatc atcccgaaaa gatcaaccgc ggcgcgagca cgagaccacc gtgggcccca 120

tggcccaccg acttacacaa tctctcccac tgccatgcgg gcccacacca gcaacagtcc 180

agtccagaga gccccgaact cctccaaacc cggggggcca caccctgcca cgtgtcaccc 240

gccagcctcc ctctcatcct ctctctcctc gtccagtgct tctccttctc ctcgc 295

<210>9

<211>310

<212>DNA

<213>Artifical sequence

<400>9

tacagagtgg atctgtttac tcgtcaagtg tcatctcctg aagtggactg gagctatggg 60

gagcctactg aaatgttaac tccggttcca ctgacggaga gggaagcggt gagagtgctg 120

gtgcgtacat tgtgcgcatt ccgtgcggtc caagggacaa gtacctccgt aaagagccct 180

gtggccttac ctccaagagt ttgtcgacgg agctctcgcg catatctgaa catgtccaag 240

gctctggggg aacaggttag caatgggaag ctggtcttgc catatgtaat ccatggccac 300

tatgccgatg 310

<210>10

<211>310

<212>DNA

<213>Artifical sequence

<400>10

atcaggcctt gtcagtggca agaacaacac cattgacagg agcatccaag atgcatacat 60

ccacgcaatt cgccgcgcca agaacttcat ctacatcgag aatcagtact tccttggcag 120

ctcatttgca tggaaagccg atggcatcag accagaagac attgaggcgt tgcatctgat 180

tcccagagag atttctctga agattgtgaa caagattgaa gctggtgagc gttttgcagt 240

ctatgttgtg ctgccaatgt ggcctgaagg acctcctgct agtggatcag tgcaggcaat 300

actggattgg 310

<210>11

<211>3791

<212>DNA

<213>Artifical sequence

<400>11

aaaggaaggt ggctcctaca aatgccatca ttgcgataaa ggaaaggcta tcattcaaga 60

tgcctctgcc gacagtggtc ccaaagatgg acccccaccc acgaggagca tcgtggaaaa 120

agaagacgtt ccaaccacgt cttcaaagca agtggattga tgtgacatct ccactgacgt 180

aagggatgac gcacaatccc actatccttc gcaagaccct tcctctatat aaggaagttc 240

atttcatttg gagaggacag cccaagcttc gactctagag gatcccccag gattcctcaa 300

agagaaacac tggcaagtta gcaatcagaa catgtctgat gtacaggtcg catccgtgta 360

cgaacgctag cagcacggat ctaacacaaa cacggatcta acacaaacat gaacagaagt 420

agaactaccg ggccctaacc atggaccgga acgccgatct agagaaggta gagagagggg 480

gggggggagg atgagcggcg taccttgaag cggaggtgcc gacgggtgga tttgggggag 540

atctggttgt gtgtgtgtgc gctccgaacg aacacgaggt tggggaaaga gggtgtggag 600

ggggtgtcta tttattacgg cgggcgagga agggaaagcg aaggagcggt gggaaaggaa 660

tcccccgtag gctgccgtgc cgtgagagga ggaggaggcc gcctgccgtg ccgcctcacg 720

tctgccgctc cgccacgcaa tttctggatg ccgacagcgg agcaagtcca acggtggagc 780

ggaactctcg agaggggtcc agaggcagcg acagagatgc cgtgccgtct gcttcgcttg 840

gcccgacgcg acgctgctgg ttcgctggtt ggtgtccgtt agactcgtcg acggcgttta 900

acaggctggc attatctact cgaaacaaga aaaatgtttc cgatcgttca aacatttggc 960

aataaagttt cttaagattg aatcctgttg ccggtcttgc gatgattatc atataatttc 1020

tgttgaatta cgttaagcat gtaataatta acatgtaatg catgacgtta tttatgagat 1080

gggtttttat gattagagtc ccgcaattat acatttaata cgcgatagaa aacaaaatat 1140

agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc tatgttacta gatcggggat 1200

ctgtcgatcg acaagctcga gtttctccat aataatgtgt gagtagttcc cagataaggg 1260

aattagggtt cctatagggt ttcgctcatg tgttgagcat ataagaaacc cttagtatgt 1320

atttgtattt gtaaaatact tctatcaata aaatttctaa ttcctaaaac caaaatccag 1380

tactaaaatc cagatccccc gaattatcgt caaccactac atcgagacaa gcacggtcaa 1440

cttccgtacc gagccgcagg aaccgcagga gtggacggac gacctcgtcc gtctgcggga 1500

gcgctatccc tggctcgtcg ccgaggtgga cggcgaggtc gccggcatcg cctacgcggg 1560

cccctggaag gcacgcaacg cctacgactg gacggccgag tcgaccgtgt acgtctcccc 1620

ccgccaccag cggacgggac tgggctccac gctctacacc cacctgctga agtccctgga 1680

ggcacagggc ttcaagagcg tggtcgctgt catcgggctg cccaacgacc cgagcgtgcg 1740

catgcacgag gcgctcggat atgccccccg cggcatgctg cgggcggccg gcttcaagca 1800

cgggaactgg catgacgtgg gtttctggca gctggacttc agcctgccga ttccggaagt 1860

gcttgacatt ggggagttta gcgagagcct gacctattgc atctcccgcc gtgcacaggg 1920

tgtcacgttg caagacctgc ctgaaaccga actgcccgct gttctacaac cggtcgcgga 1980

ggctatggat gcgatcgctg cggccgatct tagccagacg agcgggttcg gcccattcgg 2040

accgcaagga atcggtcaat acactacatg gcgtgatttc atatgcgcga ttgctgatcc 2100

ccatgtgtat cactggcaaa ctgtgatgga cgacaccgtc agtgcgtccg tcgcgcaggc 2160

tctcgatgag ctgatgcttt gggccgagga ctgccccgaa gtccggcacc tcgtgcacgc 2220

ggatttcggc tccaacaatg tcctgacgga caatggccgc ataacagcgg tcattgactg 2280

gagcgaggcg atgttcgggg attcccaata cgaggtcgcc aacatcttct tctggaggcc 2340

gtggttaggc catctctagg ttggaaggtt tgagcaatct ctaccaaatc tatgcagaga 2400

gcttcagaga gtgggaagcc gatcctacta acccagctct ccgcggggaa atgcgtattc 2460

aattcaacga catgaacagc gccttgacca cagctatccc attgttcgca gtccagaact 2520

accaagttcc tctcttgtcc gtgtacgttc aagcagctaa tcttcacctc agcgtgcttc 2580

gagacgttag cgtgtttggg caaaggtggg gattcgatgc tgcaaccatc aatagccgtt 2640

acaacgacct tactaggctg atcggaaact acaccgacca cgctgttcgt tggtacaaca 2700

ctggcttgga gcgtgtctgg ggtcctgatt ctagagattg gattagatac aaccagttca 2760

ggagagaatt gaccctcaca gttttggaca ttgtgtctct cttcccgaac tatgactcca 2820

gaacctaccc tatccgtaca gtgtcccaac ttaccagaga aatctatact aacccacttt 2880

ttatttgcgc ctgaacggat atctttcagt ttgtaaccac cggatgacgc acggacggct 2940

cggatcatcc cgaaaagatc aaccgcggcg cgagcacgag accaccgtgg gccccatggc 3000

ccaccgactt acacaatctc tcccactgcc atgcgggccc acaccagcaa cagtccagtc 3060

cagagagccc cgaactcctc caaacccggg gggccacacc ctgccacgtg tcacccgcca 3120

gcctccctct catcctctct ctcctcgtcc agtgcttctc cttctcctcg ctacagagtg 3180

gatctgttta ctcgtcaagt gtcatctcct gaagtggact ggagctatgg ggagcctact 3240

gaaatgttaa ctccggttcc actgacggag agggaagcgg tgagagtgct ggtgcgtaca 3300

ttgtgcgcat tccgtgcggt ccaagggaca agtacctccg taaagagccc tgtggcctta 3360

cctccaagag tttgtcgacg gagctctcgc gcatatctga acatgtccaa ggctctgggg 3420

gaacaggtta gcaatgggaa gctggtcttg ccatatgtaa tccatggcca ctatgccgat 3480

gatcaggcct tgtcagtggc aagaacaaca ccattgacag gagcatccaa gatgcataca 3540

tccacgcaat tcgccgcgcc aagaacttca tctacatcga gaatcagtac ttccttggca 3600

gctcatttgc atggaaagcc gatggcatca gaccagaaga cattgaggcg ttgcatctga 3660

ttcccagaga gatttctctg aagattgtga acaagattga agctggtgag cgttttgcag 3720

tctatgttgt gctgccaatg tggcctgaag gacctcctgc tagtggatca gtgcaggcaa 3780

tactggattg g 3791

Claims

1. A universal positive standard plasmid for screening transgenic rice comprises a vector skeleton and a screening element, and is characterized in that the screening element consists of a CaMV35S promoter, a Ubiquitin promoter, an NOS terminator, a CaMV35S terminator, a Bar gene, an HPT gene, a Bt gene, an SPS gene and a PLD gene;

the SPS gene is selected from any one or two of nucleotide sequences shown in SEQ ID No.8 or SEQ ID No. 9;

the nucleotide sequence of the CaMV35S promoter is shown as SEQ ID No. 1; the nucleotide sequence of the Ubiquitin promoter is shown in SEQ ID No. 2; the nucleotide sequence of the NOS terminator is shown as SEQ ID No. 3; the nucleotide sequence of the CaMV35S terminator is shown as SEQ ID No. 4; the nucleotide sequence of the Bar gene is shown in SEQ ID No. 5; the nucleotide sequence of the HPT gene is shown in SEQ ID No. 6; the nucleotide sequence of the Bt gene is shown in SEQ ID No. 7; the nucleotide sequence of the PLD gene is shown in SEQ ID No. 10.

2. The universal positive standard plasmid of claim 1 wherein the selection element comprises the sequence of the CaMV35S promoter, the Ubiquitin promoter, the NOS terminator sequence, the CaMV35S terminator, the Bar gene, the HPT gene, the Bt gene, the SPS gene and the PLD gene linked together in sequence.

3. The universal positive standard plasmid according to claim 2, wherein the nucleotide sequence of a fusion gene obtained by sequentially connecting a CaMV35S promoter, a Ubiquitin promoter, an NOS terminator sequence, a CaMV35S terminator, a Bar gene, an HPT gene, a Bt gene, an SPS gene and a PLD gene sequence is represented by SEQ ID No. 11.

4. The method for constructing a universal positive standard plasmid according to claim 1, comprising: splicing a CaMV35S promoter, a Ubiquitin promoter, an NOS terminator, a CaMV35S terminator, a Bar gene, an HPT gene, a Bt gene, an SPS gene and a PLD gene together to obtain a fusion gene; connecting the fusion gene to a vector skeleton to obtain a recombinant plasmid; and transforming the recombinant plasmid into an escherichia coli receptor bacterium to obtain the recombinant plasmid.

5. The constructing method according to claim 4, wherein the nucleotide sequence of the fusion gene obtained by splicing the CaMV35S promoter, the Ubiquitin promoter, the NOS terminator, the CaMV35S terminator, the Bar gene, the HPT gene, the Bt gene, the SPS gene and the PLD gene in sequence is shown as SEQ ID No. 11.

6. The method of claim 4, wherein the vector backbone is a pUC18 plasmid.

7. Use of the universal positive standard plasmid according to any one of claims 1 to 3 for qualitative screening, detection and monitoring of transgenic rice.

8. The application according to claim 7, characterized in that said application comprises: the universal positive standard plasmid as claimed in any one of claims 1 to 3 is used as a positive control plasmid or a positive standard for transgenic rice detection, and the common PCR and real-time fluorescent PCR screening detection of transgenic components is carried out on a rice sample to be detected.