CN113583995B - Corn casein kinase 2CK2 alpha 2 and application of encoding gene thereof based on high temperature stress response - Google Patents
Corn casein kinase 2CK2 alpha 2 and application of encoding gene thereof based on high temperature stress response Download PDFInfo
- Publication number
- CN113583995B CN113583995B CN202110694048.7A CN202110694048A CN113583995B CN 113583995 B CN113583995 B CN 113583995B CN 202110694048 A CN202110694048 A CN 202110694048A CN 113583995 B CN113583995 B CN 113583995B
- Authority
- CN
- China
- Prior art keywords
- corn
- zmck
- high temperature
- casein kinase
- temperature stress
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/11—Protein-serine/threonine kinases (2.7.11)
- C12Y207/11001—Non-specific serine/threonine protein kinase (2.7.11.1), i.e. casein kinase or checkpoint kinase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Botany (AREA)
- Mycology (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a corn casein kinase 2CK2 alpha 2 and an application of a coding gene thereof based on high temperature stress response, and aims to solve the technical problem of lack of high temperature resistant gene resources and germplasm resources of the current corn. The invention is based on maize casein kinase 2αThe subunit can respond to the discovery of high-temperature stress, and an over-expression vector OE is constructed‑ZmCK2α2、pFGC5941‑ZmCK2α2 overexpression vector obtained by using corn genetic transformation technologyZmCK2α2 overexpression homozygous strains, and screening out strains with high expression quantity by using qRT-PCR detection to be used as breeding materials for breeding high-temperature-resistant corn varieties/lines. The invention determines the corn casein kinase2αThe subunit can respond to high-temperature stress, preliminarily analyzes the action mechanism of the subunit under the high-temperature stress, is beneficial to understanding the heat-resistant mechanism of the corn, and can provide important gene resources and related germplasm resources for cultivating high-temperature-resistant corn varieties.
Description
Technical Field
The invention relates to the technical field of high temperature stress resistance of corn, in particular to corn casein kinase 2CK2 alpha 2 and application of a coding gene thereof based on high temperature stress response.
Background
Corn is the first major food crop in China, has the top of the food crop in both yield and area, and plays an important role in national food safety. However, with the global warming, high temperature heat damage frequently occurs in recent years, and serious loss is caused to the corn production. Relevant researches show that the optimal temperature for reproductive growth of the corn is 25-28 ℃, the growth and development of the corn can be accelerated at higher temperature, the growth period of the corn is shortened, the growth and development of the corn are hindered at extremely high temperature, for example, the dry matter accumulation is not facilitated at the high temperature of more than 32 ℃, and the flowering, pollination and grouting of the corn are seriously affected at the high temperature of more than 5 days and more than 35 ℃, and the phenomena of deformed ears such as bald tip, starry sky, empty stems and the like occur. In 2013, if the continuous high-temperature weather in 7 and 8 months is 23 days, the continuous high-temperature history record in China is broken through; in 2019, the high-temperature weather is 22 days in 7 months and above 35 ℃, the continuous high-temperature weather is 14 days in the middle and last ten days, the maximum temperature in the field can exceed 42 ℃, and the time period is the key period of the reproductive growth of the corns, so that the yield and the quality of the corns are seriously influenced, and the method has wide attention of relevant departments, farmers and technologists.
In response, breeding of high temperature resistant corn varieties/lines is one of the important approaches. The heat resistance of the corn is a complex quantitative character, and the key link of the high-temperature resistant breeding of the corn is to screen an excellent high-temperature resistant inbred line, understand the genetic rule and identify a functional gene.
Therefore, the excavation and screening of important genes of high-temperature-resistant characters are carried out on the whole genome level of the corn, the function analysis and the utilization of key regulatory genes are carried out, the organic combination of modern biotechnology and conventional breeding is promoted, the conversion of the corn breeding from experience breeding to accurate breeding is promoted, important gene resources and technical support are provided for the cultivation of high-temperature-resistant corn varieties, and a foundation is laid for molecular breeding and genome selective breeding.
Disclosure of Invention
The invention aims to provide corn casein kinase 2CK2 alpha 2 and application of a coding gene thereof based on high temperature stress response, so as to solve the technical problem that the current corn high temperature resistant gene resources and germplasm resources are deficient.
Casein kinase 2CK2 plays an important role in plant growth, development and stress response, and participates in a plurality of important physiological processes such as physiological clock, photoperiod, plant floral development and ABA/adversity related gene expression regulation. Combining with a great deal of previous experiences of the inventor on the research of corn high-temperature regulation genes, the invention further carries out systematic combing and deep exploration research on the stress response function of corn casein kinase, and finally discovers and determines that the corn casein kinase2αSubunits are capable of responding to high temperature stress.
Based on maize casein kinase2αSubunit coding gene (shown as SEQ ID NO. 1) and over-expression vector OE is constructed-ZmCK2α2, the corn protoplast transient transformation system is transformed into the corn leaf protoplast, and a high-temperature stress test shows that the overexpression is performedZmCK2αAfter 2, the increase of the MDA content induced by high temperature is obviously inhibited, and the increase of the CAT activity induced by high temperature is improved.
And further constructs pFGC5941-ZmCK2α2 overexpression vector obtained by using corn genetic transformation technologyZmCK2α2, over-expressing the homozygous strain, and screening out the strain with high expression quantity by using qRT-PCR detection to be used as a breeding material for breeding high-temperature-resistant corn varieties/lines.
Furthermore, use is made of the resultantZmCK2α2, the overexpression strain is subjected to phenotype identification under high-temperature stress, and research and determination are carried out under the high-temperature stressZmCK2α2 MDA content and anti-oxidation protective enzyme CAT activity in the over-expression transgenic plant, thereby preliminarily analyzingZmCK2α2 mechanism of action under high temperature stress.
The invention has the main beneficial technical effects that:
screening and determining maize casein kinase2αThe subunit can respond to high-temperature stress, preliminarily analyzes the action mechanism of the subunit under the high-temperature stress, is beneficial to understanding the heat-resistant mechanism of the corn, and can provide important gene resources and related germplasm resources for cultivating high-temperature-resistant corn varieties.
Drawings
Figure 1 is a graph comparing the effect of high temperature stress on the expression of 4 alpha subunits of ZmCK2 in maize, where the expression of ZmCK2 alpha 2 is significantly induced by high temperature stress; data represent mean ± SD (3 biological replicates).
FIG. 2 isZmCK2α2, the arrowed region in the drawing representsZmCK2α2 gene ATG initiation codon upstream 2000 bp sequence, bracket shows cis-acting element sequence, positive and negative signs represent positive and negative strand, respectively, different cis-acting elements in different strand positions.
FIG. 3 is transient silencing and overexpression under high temperature stressZmCK2α2 measurement of physiological indices in maize protoplasts, wherein A and B are transient silencesZmCK2α2, measuring the activity of CAT and MDA content in the corn protoplast under high temperature stress; c and D are transient overexpressionZmCK2α2, measuring the CAT activity and the MDA content in the corn protoplast under high-temperature stress; wherein CK is a control; h is protoplast high-temperature stress treatment; rnai nucleic acid molecules-ZmCK2α2+H is protoplast transformeddsZmCK2α2Then high-temperature stress treatment is carried out; OE-ZmCK2α2+ H is protoplast transformed overexpression vector OE-ZmCK2α2, high-temperature stress treatment is carried out; mean ± SE (n = 6), mean of the same letter in P<There was no significant difference at 0.05.
FIG. 4 shows the detection of transgenic lines by qRT-PCRZmCK2α2 in the presence of a labeled antibody.
FIG. 5 is a drawing showingZmCK2α2 comparative photograph of enhanced maize thermotolerance of overexpression lines.
FIG. 6 is a drawing showingZmCK2α2 and the survival rate statistical chart of 3 days of the over-expression strain and the wild type high-temperature stress recovery.
FIG. 7 is a drawing showingZmCK2α2, measuring the content of MDA and the catalase CAT activity of the overexpression transgenic plants under high-temperature stress.
Detailed Description
The following examples are intended to illustrate the present invention in detail and should not be construed as limiting the scope of the present invention in any way.
The instruments and devices referred to in the following examples are conventional instruments and devices unless otherwise specified; the related test materials and reagents are all purchased from the market if no special description is given; the related test and detection methods are conventional methods unless otherwise specified.
Casein kinase CK2(casein kinase 2, CK2) is a multi-substrate phosphorylated serine (Ser)/threonine (Thr) protein kinase that is widely present and function-conserved in eukaryotes. 4 of the known cornsCK2αSubunits including ZmCK2 α 1 (GRMZM 2G 143602), ZmCK2 α 2 (GRMZM 2G 141903), ZmCK2 α 3 (GRMZM 5G 845755), and ZmCK2 α 4 (GRMZM 2G 047855).
Casein kinase 2CK2 plays an important role in plant growth, development and stress response, and participates in a plurality of important physiological processes such as physiological clock, photoperiod, plant floral development and ABA/adversity related gene expression regulation. But whether it can respond to high temperature stress or which kindαSubunits are still unknown to respond to high temperature stress. Therefore, the invention carries out systematic combing and intensive research on the stress response of casein kinase, determines the CK2 alpha subunit (shown as SEQ ID NO. 2) responding to high temperature in the corn and analyzes the action mechanism of the CK2 alpha subunit under the high temperature stress, is helpful for understanding the heat-resistant mechanism of the corn and provides important gene resources for cultivating high-temperature-resistant corn varieties. The following are aboutZmCK2αExample of the main research process and validation test of high temperature response.
The first embodiment is as follows: casein kinase 2 in maize in response to high temperaturesαIdentification of subunits
1. Identification of casein kinase 2 affected by high temperature in maize by qRT-PCRαSubunit (II)
To determine ZmCK2 alpha 1、α2、α3、Whether the alpha 4 is affected by high temperature or not, respectively carrying out high-temperature stress treatment on the three-leaf-stage seedlings of Zhengdan 958 of the corn hybrid variety for 0h, 0.5 h, 1 h, 2 h, 4h, 6 h, 8 h and 10h, then extracting the total RNA of the second leaf, and analyzing the expression of the second leaf by qRT-PCR; research results show that ZmCK2 alpha 2 and ZmCK2 alpha 3 are obviously induced by high-temperature stress, the expression of ZmCK2 alpha 2 is increased most remarkably, the expression amount is the highest when the ZmCK is treated at high temperature for 4h, and the high-temperature stress has no influence on the expression of ZmCK2 alpha 1 and ZmCK2 alpha 4 (see figure 1).
2. ZmCK2α2 analysis of cis-acting elements in the promoter region of the Gene
To further analyzeZmCK2α2Whether or not it will respond to stress, its promoter cis-acting element was analyzed. First found at NCBIZmCK2α2The genome sequence and the transcription initiation site thereof, and intercepting a 2 kb sequence at the upstream of the transcription initiation site, namely the genome sequence and the transcription initiation site thereofZmCK2α2. The promoter sequence was put into a database of plantaCARE (http:// bioinformatics. psb. element. be/webtools/plantaCARE/htmL) to analyze its promoter elements, and the results were shown in FIG. 2ZmCK2α2 has 1 action element associated with abiotic stress (TC-rich repeat, GTTTTCTTAC) and 5 action elements associated with response to ABA (ABRE).
The above results show that it is possible to obtain,ZmCK2α2 has a response to high temperature and is associated with abiotic stress, particularly high temperature stress, of plants.
Example two:ZmCK2α2 high temperature resistant functional test of Gene
The Malondialdehyde (MDA) content is the embodiment of the peroxidation degree of the plant cell membranous substance, and the malondialdehyde content is high, which indicates that the peroxidation degree of the plant cell membranous substance is high and the cell membrane is seriously damaged. And H2O2The accumulation of the content can directly or indirectly oxidize intracellular biomacromolecules such as nucleic acid, protein and the like and damage cell membranes, thereby accelerating the aging and disintegration of cells.Catalase (CAT) can scavenge H2O2It is one of the important enzymatic defense systems in plants. To determineZmCK2α2Whether the gene participates in the resistance of the corn to high temperature or not, the over-expression vector OE is obtained by utilizing a corn protoplast transient transformation system-ZmCK2α2 andZmCK2α2 into corn leaf protoplasts, incubated for 12 h at room temperature and then incubated for 30 min under high temperature stress (38 ℃). And finally, detecting the content of MDA in the protoplast and the activity of the antioxidant protective enzyme CAT under high-temperature stress.
The results are shown in FIG. 3, over-expressionZmCK2αAfter 2, the increase of the MDA content induced by high temperature is obviously inhibited, and the increase of CAT activity induced by high temperature is improved; RNAi interferenceZmCK2α2, the increase of high-temperature induced MDA content is obviously improved after expression, the increase of high-temperature induced CAT activity is inhibited, and further, the damage caused by high-temperature stress can be effectively resisted.
Example three: based onZmCK2α2 high temperature resistance function identification of transgenic plants
To further exploreZmCK2α2 under the high temperature stress, the corn genetic transformation technology is utilized to obtainZmCK2α2 overexpression homozygous lines. Firstly, the method of homologous recombinationZmCK2α2 to a binary expression vector pFGC5941 containing a 35S promoter, then transforming a plasmid with a correct sequencing result into agrobacterium GV3101, and finally utilizing an agrobacterium-mediated maize mature embryo in-situ transformation method to transform the pFGC5941-ZmCK2α2Transforming corn with carrier, screening herbicide to obtain T0Generating positive plants, selfing toT 2 And generating clusters of the transgenic plants.
1. Detection of transgenic lines by qRT-PCRZmCK2α2 expression level
To determine overexpression of transgenesZmCK2α2 whether or not the expression level is increased, to the obtainedT 2 Generation of transgenic lines, selection of transgenic lines using the glufosinate-ammonium gene (Basta) as a marker and the use of qRT-PCR (primer sequences such asShown in SEQ ID NO. 3-4, see Table 1) pairsZmCK2α2 (see fig. 4), three strains with higher expression levels (OE 1, OE2 and OE 3) were selected. In the normal case of the operation of the device,ZmCK2α2 overexpression strains OE1, OE2 and OE3 in comparison with their wild type WT,ZmCK2α2 was increased by 2.5, 2.6 and 2.8 times, respectively.
2. Corn (corn)ZmCK2α2Phenotype identification of overexpression transgenes under high temperature stress
To study furtherZmCK2α2The function of the transgenic plant in the heat resistance of the corn is determined by using a pot experiment on the phenotype and the survival rate of the transgenic plant under high-temperature stress. As a result, as shown in FIG. 5, on the third day of the high-temperature treatment, the wild type had significant yellowing and curling. On the 5 th day of high-temperature treatment, the wild type part shows withering and dry scorching phenomena, and the over-expressed plants still grow well although the leaf tips are yellow. On day 7 of the high temperature treatment, the wild type had died for the most part, and the over-expressed plant leaves were yellow but still grew well. In addition, the maize plants after 7 days of high temperature treatment were cultured under normal conditions (28 ℃/14h day, 22 ℃/10h night), and after 3 days of recovery, the survival rates of the wild type and the over-expressed plants were counted, showing that the survival rate of the wild type was only 12%, and the survival rate of 3 over-expressed lines was over 90% (fig. 6). These results indicate that relative to the wild typeZmCK2α2 the over-expressed strain has higher heat resistance.
3. Stress pair at high temperatureZmCK2α2 MDA content in over-expressed transgenic plants and determination of antioxidant protective enzyme CAT
To further clarifyZmCK2α2, the resistance effect under high temperature stress, and the MDA content and CAT activity of an overexpression strain of the strain are measured under the high temperature stress. The results are shown in FIG. 7, over-expressionZmCK2αThe strain 2 obviously inhibits the increase of MDA content induced by high temperature and improves the increase of CAT activity induced by high temperature, thereby effectively resisting damage caused by high temperature stress.
While the invention has been described in detail with reference to the drawings and examples, it will be understood by those skilled in the art that various changes in the specific parameters of the embodiments described above may be made or equivalents of related methods, steps and materials may be substituted without departing from the spirit of the invention to form multiple embodiments, which are common variations of the invention and will not be described in detail herein.
SEQUENCE LISTING
<110> Henan university of agriculture
<120> corn casein kinase 2CK2 alpha 2 and application of coding gene thereof based on high temperature stress response
<130> /
<160> 4
<170> PatentIn version 3.2
<210> 1
<211> 1152
<212> DNA
<213> corn
<400> 1
atgatcggtt tccccccttg gaactgcctg cctaccggca tcgccaagat cgccgccgcg 60
gctgccgtcg tcgtagcggc gctcgcgtcc tccgggatcg ccctcccgcg tccacgcgcc 120
gcgccgcccc catcgggatt cggcctcctc atgtcgaagg cgaaggtcta caccgacgtc 180
aacgtcctgc gtcccaagga gtactgggac tacgaggcgc tcaccgtcca atggggtgag 240
caggatgact atgaagttgt caggaaagtt ggaagaggta aatatagtga ggtctttgaa 300
ggcatcaatg ttaacaacaa tgagaaatgc atcattaaga tccttaagcc tgtcaagaaa 360
aagaagatca aaagggagat caaaatactt cagaatctct gtggaggtcc aaacattgtg 420
aaattgcttg atattgtcag ggatcagcat tcaaagactc ccagtttgat atttgaattc 480
gtcaacaaca cagacttcaa agttttgtac cccacattga cggattatga catccgctac 540
tacatatatg agctactcaa ggcccttgat tactgtcatt ctcaaggcat catgcatcga 600
gatgtcaagc cccataatgt aatgatagat catgagcttc gaaaacttcg gttgatagac 660
tggggcttag ctgagttcta ccatccaggc aaggaataca atgtccgtgt tgcatcgagg 720
tatttcaagg gacctgaact ccttgttgat ttacaagact atgattattc tttagacatg 780
tggagtcttg gttgcatgtt tgctggaatg atatttcgca aggaaccatt cttttatggc 840
catgacaacc atgaccaact tgtgaagatt gcaaaggtcc ttggaacaga tgggctgaat 900
tcttatttga acaagtacca cattgagctg gaccctcaac ttgaagctct tgttggaagg 960
catagtagaa aaccctggtt gaagttcatg aatggtgata accaacatct agtatcacct 1020
gaggccatag attttctcga taagctcctg cgctatgatc accaagacag gcttactgca 1080
cgggaagcta tggcacatcc ctacttcctt caagtcagag ctgtggagaa cagtaggacg 1140
agagcacaat aa 1152
<210> 2
<211> 383
<212> PRT
<213> corn
<400> 2
Met Ile Gly Phe Pro Pro Trp Asn Cys Leu Pro Thr Gly Ile Ala Lys
1 5 10 15
Ile Ala Ala Ala Ala Ala Val Val Val Ala Ala Leu Ala Ser Ser Gly
20 25 30
Ile Ala Leu Pro Arg Pro Arg Ala Ala Pro Pro Pro Ser Gly Phe Gly
35 40 45
Leu Leu Met Ser Lys Ala Lys Val Tyr Thr Asp Val Asn Val Leu Arg
50 55 60
Pro Lys Glu Tyr Trp Asp Tyr Glu Ala Leu Thr Val Gln Trp Gly Glu
65 70 75 80
Gln Asp Asp Tyr Glu Val Val Arg Lys Val Gly Arg Gly Lys Tyr Ser
85 90 95
Glu Val Phe Glu Gly Ile Asn Val Asn Asn Asn Glu Lys Cys Ile Ile
100 105 110
Lys Ile Leu Lys Pro Val Lys Lys Lys Lys Ile Lys Arg Glu Ile Lys
115 120 125
Ile Leu Gln Asn Leu Cys Gly Gly Pro Asn Ile Val Lys Leu Leu Asp
130 135 140
Ile Val Arg Asp Gln His Ser Lys Thr Pro Ser Leu Ile Phe Glu Phe
145 150 155 160
Val Asn Asn Thr Asp Phe Lys Val Leu Tyr Pro Thr Leu Thr Asp Tyr
165 170 175
Asp Ile Arg Tyr Tyr Ile Tyr Glu Leu Leu Lys Ala Leu Asp Tyr Cys
180 185 190
His Ser Gln Gly Ile Met His Arg Asp Val Lys Pro His Asn Val Met
195 200 205
Ile Asp His Glu Leu Arg Lys Leu Arg Leu Ile Asp Trp Gly Leu Ala
210 215 220
Glu Phe Tyr His Pro Gly Lys Glu Tyr Asn Val Arg Val Ala Ser Arg
225 230 235 240
Tyr Phe Lys Gly Pro Glu Leu Leu Val Asp Leu Gln Asp Tyr Asp Tyr
245 250 255
Ser Leu Asp Met Trp Ser Leu Gly Cys Met Phe Ala Gly Met Ile Phe
260 265 270
Arg Lys Glu Pro Phe Phe Tyr Gly His Asp Asn His Asp Gln Leu Val
275 280 285
Lys Ile Ala Lys Val Leu Gly Thr Asp Gly Leu Asn Ser Tyr Leu Asn
290 295 300
Lys Tyr His Ile Glu Leu Asp Pro Gln Leu Glu Ala Leu Val Gly Arg
305 310 315 320
His Ser Arg Lys Pro Trp Leu Lys Phe Met Asn Gly Asp Asn Gln His
325 330 335
Leu Val Ser Pro Glu Ala Ile Asp Phe Leu Asp Lys Leu Leu Arg Tyr
340 345 350
Asp His Gln Asp Arg Leu Thr Ala Arg Glu Ala Met Ala His Pro Tyr
355 360 365
Phe Leu Gln Val Arg Ala Val Glu Asn Ser Arg Thr Arg Ala Gln
370 375 380
<210> 3
<211> 20
<212> DNA
<213> Artificial primer
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Artificial primer
<400> 4
Claims (4)
1. Amino acidsThe sequence of the maize casein kinase 2CK2 alpha 2 is shown as SEQ ID NO.2 or the maize casein kinase coding gene with the nucleotide sequence shown as SEQ ID NO.1ZmCK2α2 in the application of high temperature stress resistance of corn.
2. Corn casein kinase 2 alpha subunit coding gene with nucleotide sequence shown as SEQ ID NO.1ZmCK2α2 in the breeding of high temperature resistant corn variety/line.
3. A method for obtaining high-temperature-resistant corn breeding materials comprises the following steps:
(1) the nucleotide sequence is shown as SEQ ID NO.1 by a homologous recombination methodZmCK2α2, recombining the gene into a binary expression vector pFGC5941 containing a 35S promoter, and constructing an overexpression vector pFGC5941-ZmCK2α2；
(2) Overexpression vector pFGC5941 by utilizing agrobacterium-mediated maize mature embryo in-situ transformation method-ZmCK2α2 transforming corn, selecting T by screening herbicide0Generating positive plants, selfing to obtain T2Generating transgenic strains;
(3) screening the transgenic strains obtained in the previous step by taking glufosinate-ammonium gene as a marker, and detecting by using qRT-PCRZmCK2α2, expressing the gene, and screening to obtain an over-expression strain with the expression quantity meeting the requirement.
4. The method for obtaining high temperature resistant corn breeding material as claimed in claim 3, wherein in the step (3), the qRT-PCR primer sequence is:
CK2α2-F： CATCATGTGGACAACCTTGG ，
CK2α2-R： TTCATCACGGTGACTATCGC 。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110694048.7A CN113583995B (en) | 2021-06-22 | 2021-06-22 | Corn casein kinase 2CK2 alpha 2 and application of encoding gene thereof based on high temperature stress response |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110694048.7A CN113583995B (en) | 2021-06-22 | 2021-06-22 | Corn casein kinase 2CK2 alpha 2 and application of encoding gene thereof based on high temperature stress response |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113583995A CN113583995A (en) | 2021-11-02 |
| CN113583995B true CN113583995B (en) | 2022-05-31 |
Family
ID=78244296
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110694048.7A Active CN113583995B (en) | 2021-06-22 | 2021-06-22 | Corn casein kinase 2CK2 alpha 2 and application of encoding gene thereof based on high temperature stress response |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113583995B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115786563B (en) * | 2022-08-19 | 2024-05-07 | 华中农业大学 | Molecular marker closely linked with corn high-temperature response character, amplification primer and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160355836A1 (en) * | 2013-10-25 | 2016-12-08 | Zhejiang University | Modified plants |
-
2021
- 2021-06-22 CN CN202110694048.7A patent/CN113583995B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160355836A1 (en) * | 2013-10-25 | 2016-12-08 | Zhejiang University | Modified plants |
| CN106232818A (en) * | 2013-10-25 | 2016-12-14 | 浙江大学 | Improvement plant |
Non-Patent Citations (5)
| Title |
|---|
| Analysis of DNA methylation of maize in response to osmotic and salt stress based on methylation-sensitive amplified polymorphism;Ming-pu Tan;《Plant Physiology and Biochemistry》;20091030;21-26 * |
| Cloning and sequencing of the casein kinase 2a subunit from zea mays;Grazyna Dobrowolska等;《biochimica cl Biophysica Acta》;19911231;139-140 * |
| Maize protein kinase CK2: regulation and functionality of three beta regulatory subunits;Marta Riera 等;《The Plant Journal》;20011231;365-374 * |
| Purification and characterization of maize seedling casein kinase IIB, a monomeric enzyme immunologically related to the a subunit of animal casein kinase-2;Grazyna DOBROWOLSKA 等;《Eur.J.Biochem.》;19921231;299-303 * |
| 酪蛋白激酶 2 的亚基结构与生理功能;段艳芳 等;《生命的化学》;20090215;37-40 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113583995A (en) | 2021-11-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chen et al. | Patterning the Asteraceae capitulum: duplications and differential expression of the flower symmetry CYC2-like genes | |
| CN106480075A (en) | A kind of gene of regulation and control corn drought stress resistance and its application | |
| CN111254142B (en) | Molecular marker of corn seed cadmium low accumulation control gene ZmCD1 and application | |
| CN103695438A (en) | Arabidopsis MYB family transcription factor AtMYB17 gene as well as coding sequence and application thereof | |
| US11643665B2 (en) | Nucleotide sequences encoding Fasciated EAR3 (FEA3) and methods of use thereof | |
| CN110903368B (en) | Gene for controlling female character of corn, kit for creating female sterile line of corn, mutant genotype and method | |
| CN104245724A (en) | Nucleic acid sequences and peptides/ proteins of the ft family providing flower-repressing properties in tobacco and transgenic plants transformed therewith | |
| CN113583995B (en) | Corn casein kinase 2CK2 alpha 2 and application of encoding gene thereof based on high temperature stress response | |
| CN112342236B (en) | Application of rice histone methyltransferase in enhancing crop drought resistance and improving single plant yield | |
| CA2872128A1 (en) | Dirigent gene eg261 and its orthologs and paralogs and their uses for pathogen resistance in plants | |
| ZA200608285B (en) | Cytokinin oxidase sequences and methods of use | |
| CN110438134A (en) | Plant leaf blade frizzled related protein OsRoc8 and its encoding gene and application | |
| CN112280784B (en) | Rice lateral root development control gene OsLRD2, encoding protein and application thereof | |
| CN111088239B (en) | Corn high-temperature response protein kinase ZmCDPK7, and coding gene and application thereof | |
| CN113754746B (en) | Rice male fertility regulation gene, application thereof and method for regulating rice fertility by using CRISPR-Cas9 | |
| CN109609515B (en) | Gene for regulating growth and development of chloroplast and influencing leaf color under low-temperature stressCDE4And applications | |
| CN106318923A (en) | Protein capable of regulating chloroplast development under high temperature stress and genes and application thereof | |
| CN113151295A (en) | Rice temperature-sensitive male sterile gene OsFMS1 and application thereof | |
| Kinney et al. | Molecular evolution of the maize sex-determining gene TASSELSEED2 in Bouteloua (Poaceae) | |
| Chen et al. | FKF1b controls reproductive transition associated with adaptation to geographical distribution in maize | |
| Lambret-Frotte et al. | Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs | |
| CN112390867B (en) | Chimonanthus praecox CpCO-L2 gene and protein coded by same and application of gene | |
| CN112899292B (en) | Upland cotton plant height regulating gene GhGA20ox6 and its use | |
| CN117947043A (en) | Gene for regulating rice grain yield and appearance quality and application thereof | |
| CN115948434A (en) | Application of OsPHOT1 gene in improving high temperature and/or darkness resistance of rice |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |