CN113564240A - HLA-B27 allele detection method and detection kit - Google Patents
HLA-B27 allele detection method and detection kit Download PDFInfo
- Publication number
- CN113564240A CN113564240A CN202110601113.7A CN202110601113A CN113564240A CN 113564240 A CN113564240 A CN 113564240A CN 202110601113 A CN202110601113 A CN 202110601113A CN 113564240 A CN113564240 A CN 113564240A
- Authority
- CN
- China
- Prior art keywords
- hla
- seq
- detection
- dna polymerase
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
An HLA-B27 allele detection method, comprising the following steps: step 1, extracting and purifying nucleic acid by magnetic bead method and column extraction method; step 2, performing HLA-B27 real-time fluorescence PCR detection by adopting a real-time PCR method of a TaqMan probe method, realizing the rapid detection of the single nucleotide polymorphism of the HLA-B27 gene, and providing a basis for the auxiliary diagnosis of ankylosing spondylitis diseases; the detection cost is saved and the detection flux is improved; the single nucleotide polymorphism detection adopts a TaqMan probe method, breaks through the traditional fluorescent dye method, improves the specificity and improves the typing and interpretation accuracy.
Description
Technical Field
The invention relates to the field of microorganisms, in particular to a HLA-B27 allele detection method and a detection kit.
Background
HLA-B27 belongs to MHC-1 surface protein encoded by MHC-B gene on chromosome 6, and is the most important gene for predisposing individuals to Ankylosing Spondylitis (AS). HLA-B27 presents peptide antigens to T immune cells in the body's defense process and is thought to be closely associated with AS and related inflammatory diseases.
Ankylosing spondylitis is a chronic, progressive, articular lesion involving the medial-axial joint. The disease progresses slowly in the early stage, but develops rapidly in the later stage, and a kyphosis, a hip, a knee and other joints are formed in a short time, so that the early diagnosis is particularly important. The expression of human major histocompatibility antigen HLA-B27 is an important means for diagnosing ankylosing spondylitis.
The detection of HLA-B27 includes methods such as a micro-lymphocyte toxicity test (CDC), flow cytometry (FAM), PCR-SSP and fluorescence PCR. The CDC method is complex in operation and difficult to operate; although the FAM method is sensitive in detection, the cost of instruments and detection is high, samples need living cells, and the samples are not easy to store; the PCR-SSP method is a classical method, DNA is amplified by a plurality of pairs of HLA-B27 specific primers and analyzed by an electrophoresis result, the pollution risk is high, the period is long, and the PCR-SSP method is not suitable for clinical application. The existing fluorescence PCR method adopts dye to generate signals for amplified specific segments, has weak specificity and can not carry out internal control of PCR reaction
The invention belongs to the technical field of molecular biology, adopts a TaqMan probe, has more specificity of a detection signal than a fluorescent dye method, adopts a real-time fluorescent quantitative PCR technology, is easy to interpret a detection result, and is more suitable for clinical detection.
Disclosure of Invention
Technical problem to be solved
Aiming at the defects of the prior art, the invention provides the HLA-B27 allele detection method and the detection kit which solve the problems of complicated detection steps, long detection period and the like in clinical gene detection popularization and application.
(II) technical scheme
In order to achieve the purpose, the invention provides the following technical scheme: an HLA-B27 allele detection method, comprising the following steps:
step 1, extracting and purifying nucleic acid by magnetic bead method and column extraction method;
and 2, performing HLA-B27 real-time fluorescent PCR detection by adopting a real-time PCR method of a TaqMan probe method.
The invention improves the method, the HLA-B27 real-time fluorescence PCR method in the step 2 consists of one or more groups of primer probes aiming at HLA-B27 allele.
The improvement of the invention is that the designed primers aiming at HLA-B27 allele are composed of a plurality of groups, and the designed specific primers are arranged at the upstream or downstream of the region to be detected; the distance between the 3 'end of the designed specific primer and the 5' end of the region to be detected is 1-30 bases; 3' ends of designed specific primers, namely an upstream primer, a downstream primer or an upstream primer and a downstream primer, have mismatch modification; the 3 'end of the designed specific primer is mismatched and modified with a base position which is the 1 st to 5 th reciprocal of the 3' end;
the invention has the improvement that the detection method is a real-time fluorescence detection method based on a TaqMan probe method, wherein a specific primer probe is designed aiming at the HLA-B27 allele;
the invention further provides an HLA-B27 allele typing detection kit; comprises a PCR reaction solution A, PCR, a reaction solution B, an enzyme mixed solution, a positive reference substance and a negative reference substance;
the PCR reaction solution A contains 5-250 mM potassium salt, 0.5-15 mM divalent metal ion, enzyme activator, 50-500 mM ammonium salt and 0.2-10 mM dNTPs.
The potassium salt includes but is not limited to one or more of KCl, K2SO4, KNO 3;
the divalent metal ions include, but are not limited to, one or more of Mg2+, Mn2+, Zn2 +;
the enzyme active agent comprises 1-10% of glycerol and 0.01-0.2% of BSA;
the ammonium salt includes but is not limited to NH4Cl、NH42SO4、NH4NO3One or more of;
the PCR reaction B comprises 2.5-40 uM primers and 5-100 uM probes.
The improvement of the invention is that the potassium salt is KCl, and the divalent metal ion is Mg2 +; the enzyme activator is 1.2% of glycerol and 0.02% of BSA, and the ammonium salt is NH4Cl。
In an improvement of the invention, the concentration of KCl is preferably 170 mM; the concentration of Mg2+ is preferably 2.5 mM; the dNTPs concentration is preferably 0.2 mM.
The improvement of the invention is that the primer comprises B27 gene: SEQ 1-SEQ 8, reference gene primer: SEQ 9-SEQ 10, B27 gene: P1-P3; reference gene P4;
the improvement of the invention is that the primer combination of the B27 gene comprises Group 1SEQ 1SEQ 5 and Group 2: SEQ 1SEQ 6Group 3: SEQ 1SEQ 7, Group 4: SEQ 1SEQ 8, Group 5: SEQ2 SEQ5, Group6 SEQ2 SEQ6, Group7 SEQ2 SEQ 7; group8 SEQ2 SEQ 8; group 9: SEQ3 SEQ5, Group10 SEQ3 SEQ6, Group11 SEQ3 SEQ 7; group12 SEQ3 SEQ 8; group13 SEQ4SEQ 5, Group14 SEQ4SEQ 6, Group15 SEQ4SEQ 7, Group16 SEQ4SEQ 8;
the invention has the improvement that the quenching group at the 3' end of the probe can be: BHQ1, BHQ2, MGB, TAMRA, Eclipse-2 and Dabcy1-2, wherein the probe combination of the B27 gene comprises Plan1: P1 and P4, Plan2: P2 and P4, and Plan3: P3 and P4; the enzyme mix also includes a hot start nucleic acid polymerase including a DNA polymerase including but not limited to one or more of Taq DNA polymerase, Super Taq DNA polymerase, UlltraPE DNA polymerase, LA Taq DNA polymerase, Tth DNA polymerase, Pfu DNA polymerase, VentR DNA polymerase, Phusion DNA polymerase, KOD DNA polymerase, and a UNG enzyme; the positive control and the negative control are HLA-B27 cell line DNA and non-HLA-B27 DNA.
(III) advantageous effects
Compared with the prior art, the invention provides a method, a kit and a use method for rapidly detecting microorganisms, and the method, the kit and the use method have the following beneficial effects:
the rapid detection of the single nucleotide polymorphism of the HLA-B27 gene is realized, and a basis is provided for the diagnosis of ankylosing spondylitis diseases; the detection cost is saved and the detection flux is improved; the single nucleotide polymorphism detection adopts a TaqMan probe method, breaks through the traditional fluorescent dye method, improves the specificity and improves the typing and interpretation accuracy.
Drawings
FIG. 1 is a diagram showing fluorescence amplification of reaction solution #1 according to the present invention;
FIG. 2 is a fluorescent amplification chart of reaction solution # 2 according to the present invention;
FIG. 3 is a fluorescent amplification chart of reaction solution #3 according to the present invention;
FIG. 4 is a fluorescent amplification chart of reaction solution # 4 according to the present invention;
FIG. 5 is a fluorescent amplification chart of reaction solution #5 according to the present invention;
FIG. 6 is a fluorescent amplification chart of reaction solution # 6 according to the present invention;
FIG. 7 is a fluorescent amplification chart of reaction solution #7 according to the present invention;
FIG. 8 is a fluorescent amplification chart of reaction solution # 8 according to the present invention;
FIG. 9 is a fluorescent amplification chart of reaction solution #9 according to the present invention.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The invention aims to provide a high-efficiency and accurate HLA-B27 allele detection method; the problems of complicated detection steps, long detection period and the like in clinical gene detection popularization and application are solved.
The invention provides an HLA-B27 allele typing detection method, which mainly comprises nucleic acid extraction and purification, HLA-B27 real-time fluorescence PCR detection;
further, the method is carried out. The nucleic acid extraction and purification adopts a magnetic bead method and a column extraction method;
further, the method is carried out. The HLA-B27 real-time fluorescent PCR detection is a real-time PCR method of a TaqMan probe method;
furthermore, the HLA-B27 real-time fluorescent PCR method consists of one or more groups of primer probes aiming at HLA-B27 allele;
further, the primers designed for HLA-B27 allele consisted of multiple sets;
further, designing a specific primer at the upstream or downstream of the region to be detected;
further, the distance between the 3 'end of the designed specific primer and the 5' end of the region to be detected is 1-30 bases;
furthermore, the 3' ends of the designed specific primer upstream primer, downstream primer or upstream primer and downstream primer have mismatch modification;
further, the 3 'end of the designed specific primer is mismatched and modified with a base position which is the 1 st to 5 th reciprocal of the 3' end;
furthermore, the detection method is a real-time fluorescence detection method based on a TaqMan probe method, wherein a specific primer probe is designed for the HLA-B27 allele;
the invention also provides an HLA-B27 allele typing detection kit; the kit comprises a PCR reaction solution A, PCR, a reaction solution B, an enzyme mixed solution, a positive control and a negative control;
further, PCR reaction A comprises 5-250 mM potassium salt, 0.5-15 mM divalent metal ion, enzyme activator, 50-500 mM ammonium salt, 0.2-10 mM dNTPs;
further, the potassium salts include, but are not limited to, one or more of KCl, K2SO4, KNO 3; preferably KCl; (ii) a
Further, the concentration of KCl is preferentially 170 mM;
further, the divalent metal ions include, but are not limited to, one or more of Mg2+, Mn2+, Zn2+, preferably Mg2 +;
further, the concentration of Mg2+ is preferentially 2.5 mM;
further, the enzyme active agent comprises 1-10% (w/v) glycerol and 0.01-0.2% (w/v) BSA; preferably 1.2% (w/v) glycerol, 0.02% (w/v) BSA;
further, the ammonium salt includes, but is not limited to, one or more of NH4Cl, NH42SO4, NH4NO 3; preferably NH4 Cl;
further, the concentration of dNTPs is preferably 0.2 mM;
further, the PCR reaction B comprises 2.5-40 uM primers and 5-100 uM probes;
further, the primer group comprises B27 gene: SEQ 1-SEQ 8, reference gene primer: SEQ 9-SEQ 10, B27 gene: P1-P3; reference gene P4;
SEQ1:CCTGACCGAGACCTGGGCT
SEQ2:GCTACGTGGACGACACGCT
SEQ3:GGTCTCACACCCTCCAGAA
SEQ4:GGTCTCACACCCTCCATAA
SEQ5:GTCTGTGCCTTGGCCTTGC
SEQ6:GCGCCCGCGGCTCCTCT
SEQ7:TTGCCGTCGTAGGCGTC
SEQ8:GGAGCCACTCCACGCACTC
SEQ9:CATCTGGACATGCTTGCT
SEQ10:CATGTACATAGGAAGACC
P1:CGTGAGGTTCGACAGCGACGC
P2:CGACAGCGACGCCGCGAGTCCGAGA
P3:CTGTTCGTGAGGTTCGACAGCGA
P4:CTGTGTTAAAGCTCTGAATAATG
further, the primer combination of the B27 gene comprises Group 1SEQ 1SEQ 5 and Group 2: SEQ 1SEQ 6Group 3: SEQ 1SEQ 7, Group 4: SEQ 1SEQ 8, Group 5: SEQ2 SEQ5, Group6 SEQ2 SEQ6, Group7 SEQ2 SEQ 7; group8 SEQ2 SEQ 8; group 9: SEQ3 SEQ5, Group10 SEQ3 SEQ6, Group11 SEQ3 SEQ 7; group12 SEQ3 SEQ 8; group13 SEQ4SEQ 5, Group14 SEQ4SEQ 6, Group15 SEQ4SEQ 7, Group16 SEQ4SEQ 8; preferably the primer set is: group6
The quenching group at the 3' end of the probe can be: BHQ1, BHQ2, MGB, TAMRA, Eclipse-2, Dabcy 1-2.
Further, the probe set for the B27 gene is composed of Plan1: P1 and P4, Plan2: P2 and P4, Plan3: P3 and P4, preferably Plan 1;
further, the enzyme mix also includes a hot start nucleic acid polymerase and UNG enzyme;
further, the method comprises the following steps of; the hot start nucleic acid polymerase includes DNA polymerase and hot start enzyme antibody, further, the DNA polymerase includes but is not limited to one or more of Taq DNA polymerase, Super Taq DNA polymerase, Ulltrap DNA polymerase, LA Taq DNA polymerase, Tth DNA polymerase, Pfu DNA polymerase, VentR DNA polymerase, Phusion DNA polymerase, KOD DNA polymerase. Preferably Taq DNA polymerase;
further, the positive control and the negative control are HLA-B27 cell line DNA and non-HLA-B27 DNA;
the HLA-B27 genotype detected by the HLA-B27 allele typing detection kit provided by the invention comprises: HLA-B2701, HLA-B2702, HLA-B2704 and HLA-B2705.
According to a preferred embodiment of the invention, the kit components are as follows (96 persons for example)
| Component name | Specification of | Quantity (tube) |
| PCR reaction solution A | 570 | 2 |
| PCR reaction solution b | 700 | 2 |
| Enzyme mixture | 25 | 1 |
| Positive control | 60 | 1 |
| Negative control | 60 | 1 |
Table 1: HLA-B27 gene detection kit (96 persons)
In a preferred embodiment, the process of the invention comprises the steps of:
1) DNA template preparation
A. Drawing a blood sample from a subject;
B. obtaining DNA from a blood sample, and extracting peripheral blood genomic DNA by using a commercial kit;
C. measuring the concentration and purity of DNA, wherein the concentration is required to be more than 10 ng/ul; OD value 260/280 is 1.7-2.0
2) The preparation of the PCR reaction system was carried out as follows:
| component name | 1x | 8x |
| PCR |
8 | 75.6 |
| PCR |
10 | 85,5 |
| Enzyme mixture | 0.125 | 1 |
| DNA template | 2.5 | 20 |
Oscillating, mixing uniformly and centrifuging instantaneously;
and (3) computer detection: temperature cycle and signal acquisition programs are set according to the following table, and the samples are placed on a fluorescent quantitative PCR instrument for amplification detection.
According to a preferred embodiment of the present invention, the kit can perform nucleic acid extraction and single nucleotide polymorphism detection of a whole blood sample type. The single nucleotide polymorphism detection method adopts a TaqMan probe method for detection, modifies the probe specifically, has specificity and high detection sensitivity, and avoids typing and interpretation errors; meanwhile, the positive quality control material and the negative quality control material are adopted in the kit, and a reaction liquid system and the environment pollution detection condition are respectively monitored, so that the occurrence of misjudgment is avoided.
Example 1 screening of PCR reaction solution A in HLA-B27 genotyping kit
The experimental method comprises the following steps: preparing a plurality of PCR reaction solution A systems according to the following table systems, and respectively using B27 Positive samples Positive Sample1, Positive Sample 2, B27 Negative samples Negative Sample1 and Negative Sample 2 which are known to be B27 typed as system effect evaluation samples;
the experimental steps are as follows:
with reference to the specific implementation steps described above,
performing DNA extraction of the sample,
Preparing a detection system;
a program for operating the computer is set up,
4. placing the reaction solution on Roche LC480 for detection;
reaction liquid formula of table one and nine different components
Table two, nine test results of different reaction solution formulations, fluorescence amplification chart referring to attached figures 1-9
Conclusion
Since the sequence of HLA gene has a high GC ratio, the composition of the buffer is critical for efficient PCR. In order to find an ideal buffer solution formula, different proportions of the components are prepared and tested. KCl, Tris-HCl, MgCl2, NH4Cl and BSA, all of which are purchased with the need to check the quality analysis Certificates (COA). The specificity and efficiency of PCR reaction will be different for 9 different buffers prepared from different components, and after testing, the most ideal composition is selected, and from the test results (Table II), the reaction solution formula of No. 6 has the most suitable reaction conditions.
EXAMPLE II specificity analysis of HLA-B27 primer Probe
The experimental method comprises the following steps: through the analysis of HLA-B27 gene, a plurality of groups of primer probes of HLA-B27 are designed, and DNA of HLA standard cell strain is sampled for verification analysis; firstly, 4 strains of standard products (IHW Nos. 9382, 9219, 9014 and 9021) are used, wherein the genotypes of the 9382 and the 9219 are B.x.2705: 8205 and B.x.2704: 2704 respectively, positive cell strains, and the genotypes of the 9014 and the 9021 are B.x.0801: 0801 and B.x 4201:4201 respectively, and negative cell strains; and (4) screening the primer probes, and accurately analyzing the screened primer probes by using 32 cases of standard products.
The experimental steps are as follows:
extracting nucleic acid, namely extracting the nucleic acid from the standard cell strain, specifically referring to a nucleic acid extraction instruction (whole blood/bacteria/cell nucleic acid extraction kit, TBG);
the detection system is prepared, and the PCR reaction system is prepared according to the following table:
the different primer probe sets are shown in the following table
TABLE III, B27 primer Probe screening
| First group | Second group | Third group | Fourth group | |
| Primer and method for producing the same | SEQ1/SEQ5 | SEQ1/SEQ7 | SEQ3/SEQ8 | SEQ2/SEQ6 |
| Probe needle | Plan1 | Plan2 | Plan3 | Plan1 |
Setting computer program (as above)
Detection on machine
Placing the reaction solution on an ABI7500 instrument for detection
Results of the experiment
TABLE IV, B27 primer Probe screening results
According to the above experimental data, the primer probe combinations of the fourth group have relatively good results, and the corresponding HLA types capable of being amplified are shown in Table five.
TABLE VI, primer Probe accuracy verification results
Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.
Claims (10)
1. A method for detecting HLA-B27 alleles, which is characterized by comprising the following steps:
step 1, extracting and purifying nucleic acid by magnetic bead method and column extraction method;
and 2, performing HLA-B27 real-time fluorescent PCR detection by adopting a real-time PCR method of a TaqMan probe method.
2. The method for detecting HLA-B27 alleles according to claim 1, wherein the HLA-B27 real-time fluorescence PCR method in step 2 comprises one or more sets of primer probes for HLA-B27 alleles.
3. The method for detecting HLA-B27 allele according to claim 2, wherein the primers designed for HLA-B27 allele comprise multiple sets, and the specific primers are designed upstream or downstream of the region to be detected; the distance between the 3 'end of the designed specific primer and the 5' end of the region to be detected is 1-30 bases; 3' ends of designed specific primers, namely an upstream primer, a downstream primer or an upstream primer and a downstream primer, have mismatch modification; the position of the 3 'end mismatch modification base of the designed specific primer is 1-5 reciprocal positions of the 3' end.
4. The method for detecting the HLA-B27 allele according to claim 3, wherein the detection method is a real-time fluorescence detection method based on TaqMan probe method by designing a specific primer probe for the HLA-B27 allele.
5. An HLA-B27 allele typing detection kit; the kit is characterized by comprising a PCR reaction solution A, PCR, a reaction solution B, an enzyme mixed solution, a positive control and a negative control;
the PCR reaction solution A contains 5-250 mM potassium salt, 0.5-15 mM divalent metal ion, enzyme activator, 50-500 mM ammonium salt and 0.2-10 mM dNTPs.
The potassium salt includes but is not limited to one or more of KCl, K2SO4, KNO 3;
the divalent metal ions include, but are not limited to, one or more of Mg2+, Mn2+, Zn2 +;
the enzyme active agent comprises 1-10% of glycerol and 0.01-0.2% of BSA;
the ammonium salt includes but is not limited to NH4Cl、NH42SO4、NH4NO3One or more of;
the PCR reaction B comprises 2.5-40 uM primers and 5-100 uM probes.
6. The HLA-B27 allele-typing detection kit as claimed in claim 5, wherein the potassium salt is KCl, and the divalent metal ion is Mg2 +; the enzyme activator is 1.2% of glycerol and 0.02% of BSA, and the ammonium salt is NH4Cl。
7. The HLA-B27 allele-typing detection kit as claimed in claim 6, wherein the KCl is preferably at a concentration of 170 mM; the concentration of Mg2+ is preferably 2.5 mM; the dNTPs concentration is preferably 0.2 mM.
8. The kit for detecting the allelic classification of HLA-B27 according to claim 7, wherein the primers comprise B27 gene: SEQ 1-SEQ 8, reference gene primer: SEQ 9-SEQ 10, B27 gene: P1-P3; reference gene P4.
9. The HLA-B27 allele typing detection kit according to claim 8, wherein the primer combination of the B27 gene is Group1: SEQ 1SEQ 5, Group 2: SEQ 1SEQ 6Group 3: SEQ 1SEQ 7, Group 4: SEQ 1SEQ 8, Group 5: SEQ2 SEQ5, Group6 SEQ2 SEQ6, Group7 SEQ2 SEQ 7; group8 SEQ2 SEQ 8; group 9: SEQ3 SEQ5, Group10 SEQ3 SEQ6, Group11 SEQ3 SEQ 7; group12 SEQ3 SEQ 8; group13 SEQ4SEQ 5, Group14 SEQ4SEQ 6, Group15 SEQ4SEQ 7, Group16 SEQ4SEQ 8.
10. The kit for detecting HLA-B27 allelic typing according to claim 9, wherein the quenching group at the 3' end of the probe is selected from the group consisting of: BHQ1, BHQ2, MGB, TAMRA, Eclipse-2 and Dabcy1-2, wherein the probe combination of the B27 gene comprises Plan1: P1 and P4, Plan2: P2 and P4, and Plan3: P3 and P4; the enzyme mix also includes a hot start nucleic acid polymerase including a DNA polymerase including but not limited to one or more of Taq DNA polymerase, Super Taq DNA polymerase, UlltraPE DNA polymerase, LA Taq DNA polymerase, Tth DNA polymerase, Pfu DNA polymerase, VentR DNA polymerase, Phusion DNA polymerase, KOD DNA polymerase, and a UNG enzyme; the positive control and the negative control are HLA-B27 cell line DNA and non-HLA-B27 DNA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110601113.7A CN113564240A (en) | 2021-05-31 | 2021-05-31 | HLA-B27 allele detection method and detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110601113.7A CN113564240A (en) | 2021-05-31 | 2021-05-31 | HLA-B27 allele detection method and detection kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113564240A true CN113564240A (en) | 2021-10-29 |
Family
ID=78161662
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110601113.7A Pending CN113564240A (en) | 2021-05-31 | 2021-05-31 | HLA-B27 allele detection method and detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113564240A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080182252A1 (en) * | 2005-04-08 | 2008-07-31 | Linkage Biosciences, Inc. | Genotyping Hla Loci |
| CN106119362A (en) * | 2016-06-30 | 2016-11-16 | 江苏伟禾生物科技有限公司 | One is used for detecting the allelic primer sets of HLA B*1502 and test kit |
| CN110923307A (en) * | 2019-12-12 | 2020-03-27 | 福建医科大学附属第一医院 | Kits, compositions and methods for detecting HLA-B27 alleles |
-
2021
- 2021-05-31 CN CN202110601113.7A patent/CN113564240A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080182252A1 (en) * | 2005-04-08 | 2008-07-31 | Linkage Biosciences, Inc. | Genotyping Hla Loci |
| CN106119362A (en) * | 2016-06-30 | 2016-11-16 | 江苏伟禾生物科技有限公司 | One is used for detecting the allelic primer sets of HLA B*1502 and test kit |
| CN110923307A (en) * | 2019-12-12 | 2020-03-27 | 福建医科大学附属第一医院 | Kits, compositions and methods for detecting HLA-B27 alleles |
Non-Patent Citations (2)
| Title |
|---|
| C.E.M. VOORTER等: "B*27 in molecular diagnostics: Impact of new alleles and polymorphism outside exons 2 and 3", TISSUE ANTIGENS, vol. 60, pages 25, XP055069849, DOI: 10.1034/j.1399-0039.2002.600104.x * |
| E. ZINO等: "Rapid detection of all HLA-B*27 alleles (B*2701–B*2725) by group-specific polymerase chain reaction", TISSUE ANTIGENS, vol. 63, pages 88 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103074434B (en) | CYP2C19 gene polymorphyism detection kit and detection method thereof | |
| CN108220413B (en) | Fluorescent multiplex amplification kit for combined detection of human Y chromosome STR and Indel loci and application thereof | |
| CN103074436B (en) | Multi-gene detection kit for guiding administration of 5-fluorouracil and detection method of multi-gene detection kit | |
| CN111073961A (en) | High-throughput detection method for gene rare mutation | |
| CN111235272A (en) | Composition for one-time detection of lung cancer multiple gene mutation and application thereof | |
| CN111733291A (en) | Method and kit for detecting novel coronavirus nucleic acid by digital PCR (polymerase chain reaction) | |
| CN110846408A (en) | Primer combination for detecting TTN gene mutation and application thereof | |
| CN107164521A (en) | A kind of CYP2C19*2 genotype detections kit and its detection method | |
| CN109321651A (en) | A kind of composition, kit, sample treatment and application detecting people CYP2D6 gene pleiomorphism | |
| CN113755644A (en) | Kit for detecting novel coronavirus Alpha and Delta mutant and application | |
| CN110607381B (en) | Mycobacterium tuberculosis detection kit and method | |
| CN109439704B (en) | Method and kit for detecting leukemia related gene variation | |
| CN103074438A (en) | Multi-gene detection kit for guiding administration of warfarin and detection method of multi-gene detection kit | |
| CN112626270B (en) | Method and kit for simultaneously and rapidly detecting new coronavirus and influenza A virus | |
| CN113564240A (en) | HLA-B27 allele detection method and detection kit | |
| CN109022556A (en) | A kind of quantitative approach and application of DNA methylation degree | |
| CN112592965B (en) | E.coli host DNA residue detection kit adopting TaqMan probe method | |
| CN107326086A (en) | A kind of ADH2*2 genotype detections kit and its detection method | |
| CN109402259B (en) | Kit for detecting leukemia fusion gene and gene mutation | |
| CN103215356A (en) | Assay kit for detecting human leukocyte antigen-B (HLA-B)*57:01 and HLA complex P5 (HCP5) alleles | |
| CN112029851A (en) | Method and kit for detecting gene polymorphism of clopidogrel medication and application of kit | |
| CN111793676A (en) | Method and kit for detecting gene polymorphism and application thereof | |
| CN112899385A (en) | Primer group and probe for identifying Brucella S2 vaccine strain and wild strain and application of primer group and probe | |
| CN112779322A (en) | Gene mutation detection kit based on non-fluorescence labeled probe and high-resolution melting curve, detection method and application thereof | |
| CN111363792B (en) | Kit and method for detecting gene polymorphism based on shared primer probe and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |