CN109022556A - A kind of quantitative approach and application of DNA methylation degree - Google Patents
A kind of quantitative approach and application of DNA methylation degree Download PDFInfo
- Publication number
- CN109022556A CN109022556A CN201810997175.2A CN201810997175A CN109022556A CN 109022556 A CN109022556 A CN 109022556A CN 201810997175 A CN201810997175 A CN 201810997175A CN 109022556 A CN109022556 A CN 109022556A
- Authority
- CN
- China
- Prior art keywords
- methylation
- dna
- copy number
- taqman probe
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides the quantitative approach and application of a kind of DNA methylation degree, the described method comprises the following steps: (1) PCR system is added in the DNA by sulphite modification, carries out digital pcr；(2) according to the methylation copy number of DNA and non-methylation copy number, the methylation of DNA is obtained；Wherein, step (1) described PCR system includes Taqman probe, and the Taqman probe includes methylation Taqman probe or non-methylation Taqman probe.Methylation probe is respectively adopted method of the invention in the target gene that sulphite is modified and non-methylation probe detects, go out the methylation copy number and non-methylation copy number of cls gene to be checked based on digital pcr accurate quantitative analysis, realize the absolute quantitation to target gene methylation, the detection of micro ctDNA suitable for blood sample, it is high sensitivity, high specificity, precisely quick, be conducive to the popularization in liquid Biopsy field.
Description
Technical field
The invention belongs to field of biotechnology, are related to the quantitative approach and application of a kind of DNA methylation degree.
Background technique
Malignant tumour has become one of highest disease of lethality, although existing multiple means are used for the treatment of tumour,
The prognosis of patient is often by stages related to tumour, and the outcome of late tumor is poor.The World Health Organization (WHO) points out:
The early diagnosis and treatment of tumour are conducive to cure rate being increased to 80%.However most cancer early stage non-evident symptons, development
Fast and easily transfer, when discovery have been middle and advanced stages, and clinical therapeutic efficacy is bad.The methods for screening of clinical application at present includes blood
The shortcomings that clear to learn Tumor marker detection or image Hygienic monitoring on hands of childhood, but there are sensitivity is low or lag.Currently, clinically also lacking
Weary effective tumour early detection method.
Circulating tumor DNA is also referred to as ctDNA, is the dissociative DNA segment being discharged into blood circulation system from tumour cell.
The concentration of ctDNA and the progress of tumour are highly relevant, can be used for neoplasm staging, prognosis evaluation and dynamic monitoring.CtDNA liquid
Biopsy refers to the detection that genomics, transcription group and epigenetics etc. are carried out for ctDNA, and this method not only samples
Simply, moreover it is possible to which the gene information of reaction tumour cell comprehensively can be used for non-invasive tumour early screening, auxiliary diagnosis parting, use
Medicine guidance and prognosis determine.
The methylation in the site CpG is an important factor for adjusting gene expression in DNA molecular.The study found that and normal cell
It compares, tumour cell shows the trend that genomic methylation level is low, tumor suppressor gene promoter CpG island methylation level is high.
In tumorigenic early stage, there is same type of tumour cell the characteristic DNA methylation of stable and consistent to change, and cause corresponding
Tumor suppressor gene inactivation, therefore the methylate DNA to dissociate in blood can be used as the marker of early diagnosis of tumor.
In recent years a large number of studies show that, in the kinds cancers such as lung cancer, colorectal cancer and liver cancer, methylation ctDNA and swollen
The early diagnosis of tumor and Prognosis scoveillance are closely related, have important clinical value.One large-scale research is horizontal from full-length genome
On to 485 in liver cancer tissue and normal blood DNA, the methylation level in 000 site CpG compares, and screening is gone on business
Anisotropic significant site, has carried out methylation PCR amplification and sequencing to the ctDNA in nearly 2,000 liver cancer and human normal plasma,
10 are filtered out respectively and 8 sites establish diagnostic model and survival region model.The diagnostic model is in 715 livers of training group
Cancer patient and diagnostic sensitivity in 560 normal persons and specificity have respectively reached 85.7% and 94.3%, in validation group 383
Example liver cancer patient and diagnostic sensitivity in 275 normal persons and specificity have respectively reached 83.3% and 90.5%, obviously
Higher than liver cancer serum marker AFP.Also, the model can accurately distinguish liver cancer patient and chronic hepatitis (HBV/HCV) and fat
Hepatopath shows that methylation ctDNA detects the immense value in hepatocarcinoma early diagnosis.
Traditional methylation detecting method includes methylation status of PTEN promoter (MSP), sulphite processing+sequencing, joint Asia
Restriction enzyme enzyme process (COBRA), pyrosequencing and the quantitative fluorescent PCR of sulfate.Wherein, based on the testing result of sequencing
It is often incorporated by reference standard, but the segment of ctDNA is shorter, the error of sequencing result is larger；Inscribe enzyme process can carry out first
The qualitative analysis of base, but cannot achieve quantitative analysis；Fluorescence quantitative PCR method is simple and convenient, but for trace sample, detection knot
Fruit poor accuracy, sensitivity are low.The defect of conventional method limits its application in clinic.
Different from quantitative fluorescent PCR, digital pcr is by the way of absolute quantitation, independent of standard curve and referring to sample
This, directly detects the copy number of target sequence, has sensitivity, specificity and the accuracy outstanding than traditional qPCR.Its
In, droplet type digital pcr (ddPCR) can determine the absolute number of the target molecule to be checked singly copied, it is at low cost, it is practical.
105603061 A of CN discloses a kind of method based on digital pcr technology detection people Septin9 gene methylation
And probe used and primer and its kit, method includes: that DNA profiling to be measured, PCR primer, detectable marker and PCR is pre-
Mixed liquid mixing, prepares digital pcr mixed liquor；Prepare the micro- reaction drop of PCR；Reaction drop micro- to PCR carries out PCR amplification；To expansion
Product carries out signal collection after increasing, judges whether the people Septin9 gene containing methylation and its quantity and content, wherein detectable mark
Note object is TaqMan probe or EvaGreen fluorescent dye shown in SEQ ID No:1, SEQ ID No:2 or SEQ ID No:3,
The PCR primer includes forward primer shown in SEQ ID No:4 or SEQID No:6 and SEQ ID No:5 or SEQ ID No:
Reverse primer shown in 7.Method and kit high sensitivity, high specificity, stability of the invention is good, compliance is high.However
The method is unable to the methylation of quantitative analysis target gene.
106916893 A of CN discloses a kind of gene methylation degree quantitative approach based on digital pcr chip, described
Method includes: (1) for target gene to be detected, determines the area for being rich in methylation sensitive restriction enzyme cleavage sites
Domain, and to the region design primer and taqman probe；(2) sample to be detected is divided into two parts, a copy of it is quick through methylating
Perceptual restriction enzyme enzymatic treatment, another is not handled；(3) quantitative inspection is carried out to two parts of samples respectively using digital pcr chip
It surveys, finally calculates the methylation of target gene in sample.The method can accurately quantify cls gene to be checked
Methylate percentage shared by copy number；Detection sensitivity is high；Detection process is simple；And detection time is short.However, the method
Methylation sensitive restriction enzyme cleavage sites must be rich on the target gene of detection, for not containing methyl-sensitive
Property restriction enzyme cleavage sites target gene, cannot using the method carry out methylation detection, greatly limit
The application range of method；It is respectively processed in addition, the method needs for sample to be detected to be divided into two parts, sample requirement
Amount is big, is not suitable for the DNA methylation assay of micro ctDNA.
Therefore, the quantitative detecting method for establishing sensitiveer, accurate, convenient and fast methylation ctDNA, has in clinical application
It is significant.
Summary of the invention
In view of the deficiencies of the prior art, described the present invention provides the quantitative approach and application of a kind of DNA methylation degree
Methylation probe is respectively adopted in the target gene that sulphite is modified to method and non-methylation probe detects, based on number
PCR accurate quantitative analysis goes out the methylation copy number and non-methylation copy number of cls gene to be checked, realizes and methylates to target gene
The absolute quantitation of degree, the detection of micro ctDNA suitable for blood sample is high sensitivity, high specificity, precisely quick, has
Conducive to the popularization in liquid Biopsy field.
To achieve this purpose, the present invention adopts the following technical scheme:
In a first aspect, the method includes following steps the present invention provides a kind of quantitative approach of DNA methylation degree
It is rapid:
(1) PCR system is added in the DNA by sulphite modification, carries out digital pcr；
(2) according to the methylation copy number of DNA and non-methylation copy number, the methylation of DNA is obtained；
Wherein, step (1) described PCR system includes Taqman probe, and the Taqman probe includes methylation Taqman
Probe or non-methylation Taqman probe.
In the present invention, in the DNA of sulphite modification, methylated cytosine is remained unchanged, and non-methylated cytosine is de-
Be transformed into uracil after ammonia, by sulphite modify DNA be respectively adopted methylation PCR system and non-methylation PCR system into
Line number word PCR amplification, wherein the Taqman probe in methylation PCR system is methylation Taqman probe, non-methylation PCR body
Taqman probe in system is non-methylation Taqman probe, to be copied according to the methylation copy number of DNA and non-methylation
Number, is calculated the methylation of DNA.
Preferably, fluorophor and quenching group are modified in the both ends of the Taqman probe respectively.
Preferably, the fluorophor includes any one in FAM, HEX or VIC.
Preferably, the quenching group includes any one in BHQ1, BHQ2 or MGB.
Preferably, step (1) described PCR system further include in primer, archaeal dna polymerase or dNTP any one or at least
Two kinds of combination.
Preferably, the calculation method of the methylation of step (2) described DNA includes:
The methylation copy number of DNA obtains the first of the DNA divided by methylation the sum of copy number and non-methylation copy number
Base degree.
Digital pcr carries out quantitative analysis using the method directly counted, i.e., has the anti-of fluorescence signal after PCR amplification
Unit is answered to be denoted as 1, unstressed configuration signal is then denoted as 0, there is the target point for containing at least one copy in the reaction member of fluorescence signal
Son.In the present invention, it is assumed that fluorescence signal number is n, and droplet number is N, and number x of the DNA molecular in micro system meets Poisson point
Cloth:
Wherein, λ is the average copy number (concentration) of contained target dna molecule in each reaction member, and p is in certain λ
Under the conditions of, the probability of contained x copy targeting DNA molecular in each reaction member.
When being free of target dna molecule in droplet, there is no fluorescence signal in droplet,
As the number x >=1 of target dna molecule in droplet, there is fluorescence signal in droplet,
Total copy number of target dna is λ × N.
During the methylation of quantitative detection DNA, the methylation copy number of DNA is respectively obtained according to above-mentioned formula
(M) and non-methylation copy number (NM), then methylation can be calculated by following formula:
Methylation=M/ (M+NM) × 100%
Preferably, further include the steps that sulphite handles DNA before step (1).
In the present invention, sulphite processing is carried out to DNA, the cytimidine to methylate in DNA remains unchanged, and methyl does not occur
It is transformed into uracil after the cytimidine deamination of change, is conducive to subsequent using methylation probe and the detection of non-methylation probe quantitative
The methylation of DNA.
Second aspect, the present invention provides a kind of methods as described in relation to the first aspect in quantitative detection cg10590292 methyl
Application in change degree.
The third aspect, the present invention provides a kind of quantitative approach of cg10590292 methylation, the method is used
Method as described in relation to the first aspect, comprising the following steps:
(1 ') carries out sulphite processing to cg10590292；
PCR system is added in the cg10590292 that (2 ') modify sulphite, carries out digital pcr；
(3 ') according to the methylation copy number and non-methylation copy number of cg10590292, using methylation copy number divided by
Methylate the sum of copy number and non-methylation copy number, obtains the methylation of cg10590292.
Preferably, step (the 2 ') PCR system include cg10590292 methylation Taqman probe or non-methylation
Taqman probe.
Preferably, the methylation Taqman probe of the cg10590292 includes the nucleic acid sequence as shown in SEQ ID NO.1
Column；
Nucleic acid sequence shown in the SEQ ID NO.1 are as follows:
5’-TGGGAGAGCGGGAGAT-3’.
In the present invention, the 5 ' of SEQ ID NO.1 are terminal modified FAM, 3 ' the terminal modified methylation probes for having BHQ1, obtaining
Sequence is 5 ' -/6-FAM/TGGGAGAGCGGGAGAT/BHQ1/-3 '
Preferably, the non-methylation Taqman probe of the cg10590292 includes the nucleic acid as shown in SEQ ID NO.2
Sequence；
Nucleic acid sequence shown in the SEQ ID NO.2 are as follows:
5’-TTTGGGAGAGTGGGAGATTT-3’.
In the present invention, the 5 ' of SEQ ID NO.2 are terminal modified a HEX, and 3 ' terminal modified have BHQ1, the sequence of non-methylation probe
For 5 ' -/HEX/TTTGGGAGAGTGGGAGATTT/BHQ1/-3 '
Preferably, step (the 2 ') PCR system further includes the primer pair of cg10590292 gene.
Preferably, the primer pair is as shown in SEQ ID NO.3-4；
Nucleic acid sequence shown in the SEQ ID NO.3 are as follows:
5'-TGTTAGTTTTTATGGAAGTTT-3'；
Nucleic acid sequence shown in the SEQ ID NO.4 are as follows:
5’-AAACAACAAAATACTCAAA-3’.
Compared with prior art, the invention has the following beneficial effects:
After the present invention carries out sulphite processing to DNA, digital pcr is carried out using different probes, respectively obtains purpose
The methylation copy number of DNA and non-methylation copy number, do not depend on standard items and standard curve, realize to DNA methylation journey
The absolute quantitation of degree, the detection of micro ctDNA suitable for blood sample is detection sensitivity height, high specificity, precisely quick,
Meet the demand of clinical fluid biopsy.
Detailed description of the invention
The DNA methylation assay that Fig. 1 (A) is cg10590292 is as a result, the non-DNA methylation assay knot that Fig. 1 (B) is cg10590292
Fruit.
Specific embodiment
The technological means and its effect taken for the present invention is further explained, with reference to embodiments with attached drawing to this hair
It is bright to be further described.It is understood that the specific embodiments described herein are used only for explaining the present invention, rather than
Limitation of the invention.
In the examples where no specific technique or condition is specified, described technology or conditions according to the literature in the art,
Or it is carried out according to product description.Reagents or instruments used without specified manufacturer, be can be by regular channel commercially available from
The conventional products of acquisition.
The primer and probe design and preparation of 1 cg10590292 of embodiment
The present embodiment is opened according to the characterized DNA sequences and its upstream in the island the GpC methyl-sensitive region of cg10590292
Mover area designs specific primer and Taqman probe, specifically:
It methylates probe (SEQ ID NO.1):
5'-/6-FAM/TGGGAGAGCGGGAGAT/BHQ1/-3'；
Non- methylation probe (SEQ ID NO.2):
5'-/HEX/TTTGGGAGAGTGGGAGATTT/BHQ1/-3'；
Upstream primer (SEQ ID NO.3):
5'-TGTTAGTTTTTATGGAAGTTT-3'；
Downstream primer (SEQ ID NO.4):
5’-AAACAACAAAATACTCAAA-3’.
2 DNA of embodiment is extracted and sulphite modification
(1) subject's blood sample 10mL is extracted, Streck Cell-Free DNA BCT plasma DNA is stored in and adopts
In blood vessel, blood plasma separation is carried out；
(2) it is extracted in blood plasma using ctDNA extracts kit (QIAamp Circulating Nucleic Acid Kit)
CtDNA；
(3) kit (EZ DNA Methylation-Direct Kit) is modified using DNA sulphite, in strict accordance with
Specification operating procedure carries out sulphite processing to the ctDNA of extraction, makes the cytimidine deamination not methylated in ctDNA
It is transformed into uracil, and the cytimidine to methylate remains unchanged, and obtains the ctDNA of sulphite conversion.
3 digital pcr of embodiment
(1) methylation PCR system and non-methylation PCR system, including ctDNA template, primer pair, Taqman is respectively configured
Probe, archaeal dna polymerase and dNTP etc., the primer pair and Taqman probe of use are as shown in table 1；
(2) modification of 20 μ L sulphite is respectively added into 8 holes of the intermediate row of DG8cartridge droplet card
CtDNA sample is supplied when sample size is less than 8 using 20 μ L buffers, is respectively added in 8 holes arranged to the end DG8cartridge
Enter 70 μ L droplets and generates oil；
(3) it is mixed by inversion, bubble removing is removed in centrifugation, is put into droplet and generates in instrument, generates droplet；
(4) droplet is transferred in 96 orifice plates, PCR amplification, amplification condition is carried out after sealer are as follows: 95 DEG C, 10min, 1 follows
Ring；95 DEG C, 30s, 60 DEG C, 60s, 40 circulations；98℃,10min；
(5) it after being assembled 96 orifice plates for completing PCR reaction, is smoothly put into droplet and reads in instrument, to two kinds of PCR bodies
DNA in system carries out absolute quantitation, counts methylate in two kinds of systems cg10590292 and non-methylation according to fluorescence number
The copy number of cg10590292 calculates the methylation of cg10590292.
Table 1
4 interpretation of result of embodiment
The methylation that the present invention early sieves marker cg10590292 to the liver cancer of 6 blood ctDNA samples is determined
Amount detection, and compared with pyrosequencing result, as shown in table 2.
Table 2
| Sample number | The methylation of digital pcr detection | The methylation of pyrosequencing detection |
| 1 | 14.6% | 15.2% |
| 2 | 9.78% | 10.2% |
| 3 | 1.06% | 0% |
| 4 | 18.45% | 18.13% |
| 5 | 46.37% | 48.52% |
| 6 | 29.72% | 28.6% |
Wherein sample number for 1 sample to be tested cg10590292 methylation such as Fig. 1 (A) and Fig. 1 (B) institute
Show, Fig. 1 (A) is DNA methylation assay as a result, methylation copy sum M=134；Fig. 1 (B) is non-DNA methylation assay as a result, non-first
Baseization copies sum NM=784, and the methylation of sample to be tested 1 is 134/ (134+784)=14.6%.
In conclusion carrying out digital pcr using different probes, respectively after the present invention carries out sulphite processing to DNA
The methylation copy number and non-methylation copy number of target DNA are obtained, standard items and standard curve is not depended on, realizes to DNA
The absolute quantitation of methylation, the detection of micro ctDNA suitable for blood sample, method high sensitivity, high specificity, essence
It is quasi- quick, be conducive to the popularization in liquid Biopsy field.
The Applicant declares that the present invention is explained by the above embodiments method detailed of the invention, but the present invention not office
Be limited to above-mentioned method detailed, that is, do not mean that the invention must rely on the above detailed methods to implement.Technical field
Technical staff it will be clearly understood that any improvement in the present invention, equivalence replacement and auxiliary element to each raw material of product of the present invention
Addition, selection of concrete mode etc., all of which fall within the scope of protection and disclosure of the present invention.
SEQUENCE LISTING
<110>Luo Min
<120>a kind of quantitative approach and application of DNA methylation degree
<130> 20180827
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 16
<212> DNA
<213>artificial synthesized
<400> 1
tgggagagcg ggagat 16
<210> 2
<211> 20
<212> DNA
<213>artificial synthesized
<400> 2
tttgggagag tgggagattt 20
<210> 3
<211> 21
<212> DNA
<213>artificial synthesized
<400> 3
tgttagtttt tatggaagtt t 21
<210> 4
<211> 19
<212> DNA
<213>artificial synthesized
<400> 4
aaacaacaaa atactcaaa 19
Claims (10)
1. a kind of quantitative approach of DNA methylation degree, which is characterized in that the described method comprises the following steps:
(1) PCR system is added in the DNA by sulphite modification, carries out digital pcr；
(2) according to the methylation copy number of DNA and non-methylation copy number, the methylation of DNA is obtained；
Wherein, step (1) described PCR system includes Taqman probe, and the Taqman probe includes methylation Taqman probe
Or non-methylation Taqman probe.
2. the method according to claim 1, wherein fluorophor is modified at the both ends of the Taqman probe respectively
And quenching group；
Preferably, the fluorophor includes any one in FAM, HEX or VIC；
Preferably, the quenching group includes any one in BHQ1, BHQ2 or MGB.
3. method according to claim 1 or 2, which is characterized in that step (1) described PCR system further includes primer, DNA
In polymerase or dNTP any one or at least two combination.
4. method according to claim 1-3, which is characterized in that the methylation of step (2) described DNA
Calculation method includes:
The methylation copy number of DNA obtains the methylation of the DNA divided by methylation the sum of copy number and non-methylation copy number
Degree.
5. method according to claim 1-4, which is characterized in that before the step (1) further include sulphite
The step of handling DNA.
6. a kind of the method according to claim 1 to 5 answering in quantitative detection cg10590292 methylation
With.
7. a kind of quantitative approach of cg10590292 methylation, which is characterized in that the method uses such as claim 1-5
Described in any item methods, comprising the following steps:
(1 ') carries out sulphite processing to cg10590292；
PCR system is added in the cg10590292 that (2 ') modify sulphite, carries out digital pcr；
(3 ') according to the methylation copy number and non-methylation copy number of cg10590292, using methylation copy number divided by methyl
Change the sum of copy number and non-methylation copy number, obtains the methylation of cg10590292.
8. the method according to the description of claim 7 is characterized in that step (the 2 ') PCR system includes cg10590292's
Methylate Taqman probe or non-methylation Taqman probe.
9. according to the method described in claim 8, it is characterized in that, the methylation Taqman probe of the cg10590292 includes
The nucleic acid sequence as shown in SEQ ID NO.1；
Preferably, the non-methylation Taqman probe of the cg10590292 includes the nucleic acid sequence as shown in SEQ ID NO.2.
10. according to the described in any item methods of claim 7-9, which is characterized in that step (the 2 ') PCR system further includes
The primer pair of cg10590292 gene；
Preferably, the primer pair is as shown in SEQ ID NO.3-4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810997175.2A CN109022556A (en) | 2018-08-29 | 2018-08-29 | A kind of quantitative approach and application of DNA methylation degree |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810997175.2A CN109022556A (en) | 2018-08-29 | 2018-08-29 | A kind of quantitative approach and application of DNA methylation degree |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109022556A true CN109022556A (en) | 2018-12-18 |
Family
ID=64625327
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810997175.2A Pending CN109022556A (en) | 2018-08-29 | 2018-08-29 | A kind of quantitative approach and application of DNA methylation degree |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109022556A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112011619A (en) * | 2020-09-17 | 2020-12-01 | 山东大学深圳研究院 | Application of SFRP2 as marker in early diagnosis of hepatitis B virus-related hepatocellular carcinoma and detection kit |
| JPWO2019207921A1 (en) * | 2018-04-26 | 2021-08-12 | 宗英 松久 | Test method for tissue-specific cytotoxicity |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102321745A (en) * | 2010-10-14 | 2012-01-18 | 博尔诚（北京）科技有限公司 | Method and kit for quantitatively detecting methylation degree of DNA specific site |
| CN105603061A (en) * | 2015-12-11 | 2016-05-25 | 宁云山 | Method, probe, primer and kit for detecting methylation of human Septin 9 gene based on digital PCR technology |
| CN106916893A (en) * | 2016-12-26 | 2017-07-04 | 中国科学院上海微系统与信息技术研究所 | A kind of gene methylation degree quantitative approach based on digital pcr chip |
| CN108064314A (en) * | 2015-01-18 | 2018-05-22 | 加利福尼亚大学董事会 | Judge the method and system of cancerous state |
-
2018
- 2018-08-29 CN CN201810997175.2A patent/CN109022556A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102321745A (en) * | 2010-10-14 | 2012-01-18 | 博尔诚（北京）科技有限公司 | Method and kit for quantitatively detecting methylation degree of DNA specific site |
| CN108064314A (en) * | 2015-01-18 | 2018-05-22 | 加利福尼亚大学董事会 | Judge the method and system of cancerous state |
| CN105603061A (en) * | 2015-12-11 | 2016-05-25 | 宁云山 | Method, probe, primer and kit for detecting methylation of human Septin 9 gene based on digital PCR technology |
| CN106916893A (en) * | 2016-12-26 | 2017-07-04 | 中国科学院上海微系统与信息技术研究所 | A kind of gene methylation degree quantitative approach based on digital pcr chip |
Non-Patent Citations (1)
| Title |
|---|
| YU,M. ET AL: "MethyLight droplet digital PCR for detection and absolute quantification of infrequently methylated alleles", 《EPIGENETICS》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPWO2019207921A1 (en) * | 2018-04-26 | 2021-08-12 | 宗英 松久 | Test method for tissue-specific cytotoxicity |
| JP7060274B2 (en) | 2018-04-26 | 2022-04-26 | 宗英 松久 | Tissue-specific cytotoxicity testing method |
| CN112011619A (en) * | 2020-09-17 | 2020-12-01 | 山东大学深圳研究院 | Application of SFRP2 as marker in early diagnosis of hepatitis B virus-related hepatocellular carcinoma and detection kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101570779B (en) | A kind of method of cancer screening | |
| CN104745679A (en) | Method and kit for non-invasive detection of EGFR (epidermal growth factor receptor) gene mutation | |
| CN102776286B (en) | Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation | |
| CN113846167B (en) | Molecular marker detection kit for primary liver cancer, nucleic acid composition and application | |
| CN106498035A (en) | A kind of construction method and its application for detecting chemotherapeutics gene SNP variation library for high-flux sequence | |
| WO2021073029A1 (en) | Method, kit and system for auxiliary diagnosis of bladder cancer based on connecting driver gene mutations and adn methylation, and uses thereof | |
| CN107988372A (en) | A kind of kit and its detection method for detecting susceptibility gene of colorectal cancer mutation | |
| CN109777877A (en) | Detection kit for auxiliary diagnosis of cerebral aneurysm based on PTBP1 methylation and application thereof | |
| CN109055555B (en) | Lung cancer early stage metastasis diagnosis marker and kit and application thereof | |
| CN106498036A (en) | A kind of construction method in the Drug Discovery SNP variations library for high-flux sequence detection and its application | |
| CN109022556A (en) | A kind of quantitative approach and application of DNA methylation degree | |
| CN107513577A (en) | A kind of method of efficient detection EGFRT790M mutant and probe and kit for detection | |
| CN113337608B (en) | Combined marker for early diagnosis of liver cancer and application thereof | |
| CN110484625A (en) | For detecting primer combination of probe object, kit and the detection method of PRKY gene methylation | |
| JP2006524996A5 (en) | ||
| CN107022621A (en) | BRAF gene mutation detection primer probe and its kit | |
| CN111304305A (en) | Kit and method for detecting EGFR gene methylation | |
| WO2020134950A1 (en) | Gene mutation/fusion combination and kit for identification of benign and malignant pulmonary nodules | |
| CN105950766A (en) | Primer group and kit for detecting HLA-B*5801 allelic genes | |
| CN105441553A (en) | Primer probe system for SEPT9 (septin-9) gene promoter methylation detection and kit adopting primer probe system | |
| CN110951857B (en) | Method and kit for noninvasively detecting fetal trisomy 21, 18 and 13 syndrome based on digital PCR (polymerase chain reaction) | |
| CN109355362B (en) | High-sensitivity SNPs detection system and application | |
| CN102399858A (en) | Detection method for DNA point mutation based on fluorescent quenching release | |
| CN113930501A (en) | Digital PCR detection method for human EGFR gene mutation and application | |
| CN111206117A (en) | Kit for detecting human immunodeficiency virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20210831 Address after: 300000 502-505, building 2, phase III, Lingao Creative Industrial Park, liqizhuang street, Xiqing District, Tianjin Applicant after: Tianjin Zhiyin Biotechnology Co., Ltd Address before: 300382 402, No. 2 complex building, phase III, Lingao Creative Industrial Park, liqizhuang street, Xiqing District, Tianjin Applicant before: TIANJIN ZHIYU BIO-TECH Co.,Ltd. |
|
| TA01 | Transfer of patent application right | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20181218 |
|
| WD01 | Invention patent application deemed withdrawn after publication |