CN113564171A

CN113564171A - Method for improving soluble expression yield of polypeptide

Info

Publication number: CN113564171A
Application number: CN202111126097.7A
Authority: CN
Inventors: 彭志恩; 宋浩; 柳学伟; 杨晓瑜; 巨晓芝; 郭万成; 信铭雁
Original assignee: Aoruite Pharmaceutical Tianjin Co ltd
Current assignee: Aoruite Pharmaceutical Tianjin Co ltd
Priority date: 2021-09-26
Filing date: 2021-09-26
Publication date: 2021-10-29
Anticipated expiration: 2041-09-26
Also published as: CN113564171B; WO2023045682A1

Abstract

The invention discloses a method for improving the soluble expression yield of polypeptide, which specifically comprises the steps of taking E.coliBL21(DE3) as an original strain, inhibiting a protease gene by using a CRISPR technology, and reducing the formation of protease, thereby reducing the degradation of the protease on polypeptide fragments and further indirectly improving the yield of the polypeptide; meanwhile, by adopting fusion expression, a more suitable linker is screened, so that the yield and the solubility of the fusion protein are obviously increased, and the expression quantity of the polypeptide is further improved.

Description

Method for improving soluble expression yield of polypeptide

Technical Field

The invention relates to the technical field of biology, in particular to a method for improving the soluble expression quantity of a polypeptide.

Background

The polypeptide is a compound which is simpler than protein, has small molecular weight and is connected by amino acid through peptide bond. At present, more than 60 polypeptide drugs are on the market, and hundreds of polypeptide drugs are in clinical research. Compared with the traditional micromolecule medicine, the polypeptide medicine has the structure similar to the structure of the protein from natural sources, the property is very close to the normal physiological substance in the body, the pharmacological activity is higher, and the metabolite of the polypeptide medicine is micromolecule amino acid, so the safety is high; compared with larger molecular protein drugs, polypeptide drugs are not easy to be identified by the immune system to cause anaphylactic reaction. Therefore, polypeptide drugs have been rapidly developed in recent years and have been used in various therapeutic fields such as diabetes, arthritis, obesity, infection resistance, cardiovascular diseases, diagnosis, allergy, tumor, and the like.

The following three routes exist for synthesizing polypeptides: chemical polypeptide synthesis, natural extraction and biological polypeptide synthesis.

1. Chemical polypeptide synthesis is mainly achieved by amino acid condensation reactions. In order to obtain a synthetic polypeptide with a specific sequence, when more than two amino acid monomers are contained in the raw materials for synthesis, the groups which do not need to be reacted should be temporarily protected, and then the linking reaction is performed to ensure the directional proceeding of the synthesis, so that more energy is consumed and greater pollution is generated.

2. Extracting active components from natural products. The natural product has complex components and very low active component content, so a large amount of raw materials are consumed, and the rapid separation and detection are difficult to carry out, which is not beneficial to large-scale industrial production.

3. Biosynthesis utilizes gene recombination technology to construct the gene sequence of polypeptide on a vector to form a recombinant DNA expression vector, and polypeptide molecule expression is carried out in prokaryotic or eukaryotic cells, and further separation and purification are carried out. With the improvement of polypeptide producing technology in genetic engineering, the development and clinical application of polypeptide medicine in genetic engineering are accelerated, and the polypeptide medicine has great potential.

At present, polypeptide biosynthesis is mainly expressed by prokaryotic or eukaryotic microbial expression systems. However, direct expression of polypeptides has many limitations due to their small molecular weight, for example, low expression levels, susceptibility to degradation by proteases, and the like. Fusion expression is a good choice. Compared with eukaryotic expression systems, the escherichia coli expression system has the advantages of short growth time, easiness in molecular operation, capability of realizing high-density fermentation, low cost and the like, becomes a main host for producing the polypeptide, and is developed rapidly. Currently, there are a number of polypeptides or proteins produced in E.coli that are approved for marketing by the U.S. FDA: exenatide (common name) from astrazeneca, human insulin (common name Humulin) from leisan, insulin glargine (common name Lantus) from seinuffy, and ranibizumab (lucentis) from Genentech.

The polypeptide is easily degraded by protease in cells during the expression process of the microorganism. Proteases are a generic term for a class of enzymes that catalyze the hydrolysis of peptide chains of proteins, and are widely distributed. Several studies exist to develop protease deficient strains to reduce degradation of polypeptides or other proteins. However, protease-deficient strains tend to grow slowly and are difficult to rapidly perform high-density fermentation; while some proteases are required to degrade variant proteins or to provide nutrients, precursors and energy. Thus, reducing rather than completely knocking out the protease in this case is a more advantageous option.

The CRISPR/Cas9 system is a powerful genome editing tool that has evolved dramatically in recent years. Of course, in addition to its use as a gene knock-out, CRISPR/Cas9 soon came up with further modifications. Researchers bring Cas9 to a specific genomic site to regulate expression of a target gene by initiating or stopping transcription. CRISPR inhibition (CRISPRi) is such a technique that is particularly suited to analyze specific functions of non-coding RNAs. The CRISPRi technique is capable of suppressing transcription of a given target, whether a coding or non-coding DNA fragment. CRISPRi uses a catalytically inactive Cas9 (dCas 9), dCas9 is able to reach the site designated by the guide RNA, but is unable to cleave DNA. When dCas9 binds to the genome, it blocks the binding of the transcription machinery, preventing this process from proceeding. The CRISPR can simultaneously regulate a plurality of genes, a plurality of sgRNAs are designed to respectively target different genes, and the CRISPR system can simultaneously inhibit the genes, so that the aim of simultaneously regulating the multiple genes by using the CRISPR system is fulfilled.

In addition, fusion expression can reduce protease degradation of the polypeptide. The presence of a linker sequence (linker) facilitates correct folding of the protein, and its length and amino acid composition are the major considerations in selecting a linker. The linker with strong hydrophilicity and good flexibility is the first choice for constructing the fusion protein. Glycine has the minimum molecular weight in all amino acids and does not have chiral carbon, so the glycine has the best flexibility, can not influence the conformation and the function of proteins at two sides when positioned between fusion proteins, and has the minimum steric hindrance; serine is the most hydrophilic amino acid and increases the hydrophilicity of the fusion protein. Glycine and serine are therefore the commonly used amino acids for the construction of linker. The length of the Linker is too long, and the fusion protein is sensitive to protease in the production process, so that the yield of the active fusion protein is reduced; the linker length is too short, which may cause the two molecules to be too close together resulting in loss of protein function. Therefore, the selection of a linker of appropriate length is very important for efficient expression and solubility of the fusion protein.

Disclosure of Invention

The invention aims to provide a method for improving the soluble expression level of a polypeptide.

In a first aspect of the present invention, there is provided a method for increasing the solubility and/or expression level of an exogenous protein in a recombinant bacterium, the method comprising the step of inhibiting an endogenous protease gene in the recombinant bacterium, wherein the protease comprises: ClpA, ClpP, ClpX, or a combination thereof.

In another preferred embodiment, the protease further comprises ClpQ, ClpY, PepD, and/or HflB.

In another preferred embodiment, the recombinant bacterium is recombinant escherichia coli.

In another preferred embodiment, the recombinant Escherichia coli comprises a recombinant BL21(DE3) strain.

In another preferred embodiment, the foreign protein is selected from the group consisting of: GLP-1, GLP-2, glucagon-like peptide, enterokinase, adenosine deaminase, alpha/beta-glucosidase and glutathione reductase.

In another preferred embodiment, said glucagon-like peptides comprise glucagon-like peptide 1 and glucagon-like peptide 2.

In another preferred embodiment, the coding sequence of the foreign protein is a codon-optimized sequence for expression in E.coli.

In another preferred embodiment, the exogenous protein is GLP-1 and analogues thereof.

In another preferred embodiment, the GLP-1 analog comprises a GLP-1 truncated and/or N-terminally extended form and/or a partially amino acid mutated form.

In another preferred embodiment, the GLP-1 analog comprises Arg34GLP-1 (7-31) or Arg34GLP-1 (9-31).

In another preferred example, the CRISPR/Cas9 system is used to inhibit endogenous protease genes of the recombinant e.

In another preferred example, the CRISPR/Cas9 system comprises sgrnas, and the sequences of the sgrnas are as shown in SEQ ID No. 11.

In another preferred example, the CRISPR/Cas9 system comprises pdCas9 and pTarget comprising a Multi-sgRNA unit, which are kanamycin-resistant and ampicillin-resistant, respectively.

In another preferred example, the Multi-sgRNA unit comprises a template strand specific nucleotide sequence of an inhibitory subject, dCas9 hindle, terminator sequence.

In a second aspect of the present invention, there is provided a recombinant escherichia coli having integrated into its genome an expression cassette for expressing a foreign protein, and having suppressed an endogenous protease gene; the protease comprises the following components: ClpA, ClpP, ClpX, or a combination thereof.

In another preferred example, the expression cassette for expressing the foreign protein comprises PET28a, fusion protein, optimized screened flexible linker, enzyme cutting sites and polypeptide genes.

In another preferred embodiment, the recombinant E.coli is prepared by the method of the first aspect of the invention.

In another preferred embodiment, the recombinant E.coli in which the endogenous protease gene is inhibited has an increased solubility and/or expression of the foreign protein of at least 50%, preferably at least 100%, more preferably at least 200%, compared to wild-type E.coli having the same expression cassette for the foreign protein integrated therein.

In a third aspect of the invention, there is provided a method of producing a polypeptide, the method comprising the steps of:

(i) cultivating a recombinant E.coli according to the second aspect of the invention, thereby obtaining a fermentation product comprising said polypeptide; and

(ii) isolating said polypeptide from said fermentation product.

In another preferred embodiment, the polypeptide is selected from the group consisting of: GLP-1, GLP-2, glucagon-like peptide, enterokinase, adenosine deaminase, alpha/beta-glucosidase and glutathione reductase.

In a fourth aspect of the invention, there is provided a use of a recombinant E.coli strain according to the second aspect of the invention for the production of a polypeptide.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 shows the strain construction diagram.

FIG. 2 shows the protein electrophoretogram. Wherein, FIG. 2A shows a shake flask fermentation protein electrophoretogram; FIG. 2B shows an electrophoretogram of fermentor-fermented protein. In fig. 2A, lane a: recombinant bacteria whole mycoprotein; lane b: crushing recombinant bacteria cells and then obtaining supernatant; lane c: the recombinant bacteria are precipitated after being crushed; in FIG. 2B, the top electrophoretogram shows recombinant bacterial whole-bacterial protein, and each lane is Marker; whole mycoprotein after cell disruption before induction; inducing the whole mycoprotein after cell disruption for 12 hours; inducing the whole mycoprotein after 15 hours of cell disruption; the lower electrophoretogram is the supernatant of the crushed recombinant bacteria; each lane is Marker; supernatant after cell disruption prior to induction; supernatant after 12 hours of cell disruption was induced; supernatant after 15 hours of cell disruption was induced.

FIG. 3 shows the restriction separation and purification scheme. Wherein, lane 2: purifying the fusion protein; lane 3: carrying out enzyme digestion at 25 ℃; lane 4: and (4) carrying out enzyme digestion at the temperature of 4 ℃.

FIG. 4 shows the results of separation and purification.

Fig. 5 shows the liquid chromatography results.

FIG. 6 shows the mass spectrometry results for the polypeptide of interest.

FIG. 7 shows soluble supernatants of intracellular fusion proteins following expression of recombinant bacteria containing different linkers; wherein lanes 1-8 in the figure are those containing linker (EAAAK)₄、（EAAAK）₃、（EAAAK）₂、EAAAK、（GGGGS）₄、（GGGGS）₃、（GGGGS）₂And intracellular fusion protein soluble supernatant (in-frame portion) after the recombinant strain of GGGGS expresses.

Detailed Description

The present inventors have extensively and intensively studied and found an application of inhibiting protease gene in improving the soluble expression yield of polypeptide. Specifically, E.coliBL21(DE3) is used as an original strain, the CRISPR technology is used for inhibiting a protease gene, and the formation of protease is reduced, so that the degradation of the protease on polypeptide fragments is reduced, and the yield of the polypeptide is indirectly improved; meanwhile, by adopting fusion expression, a more suitable linker is screened, so that the yield and the solubility of the fusion protein are obviously increased, and the generation of inclusion bodies is reduced.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides an application of CRISPR inhibitory gene in improving the expression quantity of polypeptide;

the gene has any one of the nucleotide sequences shown as follows:

I. nucleotide sequences having the genes ClpA, ClpP, ClpQ, ClpX, ClpY, PepD, HflB; preferably the nucleotide sequence of ClpA and/or ClpP and/or ClpX;

II. A nucleotide sequence obtained by modifying, substituting, deleting or adding one or more bases in the nucleotide sequence shown as I;

III, a sequence with at least 80 percent of homology with the nucleotide sequence shown in the I or a nucleotide sequence with the protein obtained after translation and the protein expressed by the gene ClpA and/or ClpP and/or ClpX have the same or similar functions;

IV, the complement of the sequence shown in I, II or III.

In some embodiments of the invention, the polypeptides are glucagon, glucagon-like peptide related polypeptides, glucagon-like peptide 1, and glucagon-like peptide 2, including truncated and/or N-terminal extended and site mutated forms, preferably a glucagon-like peptide 1 truncation mutated sequence such as: arg34GLP-1 (7-31) or Arg34GLP-1 (9-31).

In some embodiments of the invention, the genes are protease genes ClpA, ClpP, ClpQ, ClpX, ClpY, PepD, HflB;

in some embodiments of the invention, the inhibition employs CRISPRi. The CRISPR technology is utilized to inhibit protease genes and reduce the formation of protease, thereby reducing the degradation of the protease on the polypeptide fusion protein and further improving the yield of the polypeptide.

In some embodiments of the invention, the CRISPRi comprises pdCas9 and pTarget comprising a Multi-sgRNA unit, having kanamycin resistance and ampicillin resistance, respectively.

On the basis, the invention also provides a Multi-sgRNA unit comprising a template strand specific nucleotide sequence of an inhibition target, dCas9 hindle, and a terminator sequence.

In some embodiments of the invention, the Multi-sgRNA unit, the template strand-specific nucleotide sequence is selected by: near the 5' front end of the template chain, the following is a Protospacer Adjacent Motif (PAM) sequence which takes NGG (N is any base) as the characteristic.

The invention also provides an expression vector which comprises the PET28a, fusion protein, linker, enzyme cutting site and polypeptide gene;

the fusion protein has any one of the nucleotide sequences shown as follows:

I. a nucleotide sequence having the gene TrxA (thioredoxin), SUMO (small ubiquitin-like modifying protein), UB (ubiquitin) or MBP (maltose binding protein);

II. The nucleotide sequence shown as I, preferably the nucleotide sequence of TrxA;

III, flexible linker: GGGGS, (GGS)₂、（GGGGS）₃、（GGGGS）₄Rigid linker: EAAAK, (EAAAK)₂、（EAAAK）₃、（EAAAK）₄The nucleotide sequence of (a); preferably (GGGGS)₃The nucleotide sequence of (a);

IV, having enterokinase, SUMO and ubiquitin enzyme sites, preferably enterokinase sites;

the invention also provides a strain comprising the expression vector.

On the basis of the research, the invention also provides a method for the shake flask fermentation and the high-density fermentation. The method is applied to improving the expression quantity. In some embodiments of the invention, the polypeptides are glucagon, glucagon-like peptide 1 and glucagon-like peptide 2, including truncated and/or N-terminally extended forms thereof. Preferred glucagon-like peptide 1 truncation mutant sequences are: arg34GLP-1 (7-31) or Arg34GLP-1 (9-31).

The invention takes E.coli BL21(DE3) as an original strain, inhibits protease genes by using CRISPR technology, and reduces the formation of protease, thereby reducing the degradation of the protease on polypeptide fragments, further indirectly improving the yield of the polypeptide, and providing a theoretical basis for future industrial production.

The main advantages of the invention include:

(a) the fusion tag is combined with the optimized linker to improve the soluble expression ratio of the polypeptide.

(b) The CRISPRi technique inhibits the protease gene, reducing protease formation.

(c) The degradation of the polypeptide is reduced, and the yield of the soluble polypeptide is improved.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are percentages and parts by weight.

Example 1 construction of recombinant engineering bacteria

In this example, E.coli BL21(DE3) was used for polypeptide expression. The polypeptide gene is connected to a PET28a vector containing a fusion protein, a linker and an enzyme cutting site.

1. Construction of suppressor gene CRISPR Strain

Firstly, selecting a proper gene segment as a component of sgRNA according to a target gene sequence to be edited and entrusting a gene synthesis service company to synthesize a complete sgRNA gene sequence, then using restriction enzymes Ssp I and EcoR I of Thermo company to carry out enzyme digestion on the sgRNA gene sequence after synthesis, and similarly using the Ssp I and EcoR I to carry out enzyme digestion on plasmid pTarget (purchased from Addge company). The digested DNA fragment was ligated to pTarget digested with the same enzyme, transformed into E.coli DH 5. alpha. by conventional methods, screened, and verified by sequencing, and named as pTarget (the procedure for constructing the strain is shown in FIG. 1).

Coli BL21(DE3) (both available from Life Technologies, Inc.) competent cells were prepared according to the calcium chloride method provided in the fourth edition of molecular cloning, laboratory Manual, published by Cold spring harbor laboratory, USA. mu.L of sgRNA expression vector and 1. mu.L of dCas9 expression vector, namely pdCas9, are taken and simultaneously transformed into competent cells of Escherichia coli BL21(DE3), and the transformation method is also carried out according to the calcium chloride method of the fourth edition of molecular cloning Experimental guidelines. The transformation solution was applied to LB solid medium supplemented with kanamycin and ampicillin (final concentration: 50. mu.g/ml), and inverted cultured at 37 ℃ until single colonies appeared, to obtain a mutant strain in which the target gene was to be suppressed.

Specifically, the genes to be suppressed in this example include ClpA, ClpP and ClpX, and the sequence of sgRNA used is shown in SEQ ID No. 11.

2. Construction of recombinant polypeptide expression vectors

Taking the mutant strain with the suppressed target gene as host bacteria, and recombining the expression plasmid PET28a-TrxA- (GGGGS)₃-DDDDK-Arg34GLP-1 (7-31) was transformed into competent cells by the calcium chloride method, which was also performed according to the calcium chloride method of the fourth edition of molecular cloning, A laboratory Manual. PET28a was engineered to change kanamycin resistance to chloramphenicol resistance by enzymatic ligation. The transformation liquid is spread on LB solid culture medium added with chloramphenicol (the final concentration is 50 mug/ml), inverted culture is carried out at 37 ℃ until single colony appears, and sequencing verification is carried out, thus obtaining the recombinant expression strain.

EXAMPLE 2 Shake flask fermentation

The recombinant expression strain containing CRISPIRi ClpA-ClpP-ClpX prepared in example 1 (recombinant expression strain suppressing ClpA, ClpP and ClpX) was cultured as a single cell in LB liquid medium containing appropriate antibiotics (100. mu.g/ml ampicillin, 50. mu.g/ml chloramphenicol, 100. mu.g/ml kanamycin), cultured overnight at 37 ℃ and 220 rpm; the cultures were transferred into 50mL of fresh LB medium (250mL shake flasks) at a 1:100 ratio and grown at 37 ℃. When the optical density at 600nm (OD600) reached about 0.6, the incubator temperature was lowered to 25 ℃ and the temperature was equilibrated for 20 minutes. Isopropylthiogalactoside (IPTG) was added to a final concentration of 1mM and cells were grown for 16 hours at 25 ℃.

The electrophoresis results of the shake flask fermentation are shown in FIG. 2A, indicating that the fusion protein was successfully expressed.

EXAMPLE 3 isolation and purification of the polypeptide

The fermented culture obtained in example 2 was collected at 6500rpm and 4 ℃ and centrifuged. Cells were washed with 0.01M PBS (pH 7.2-7.4). Resuspend the cells with PBS and perform high pressure disruption treatment. Then, the cell lysate was centrifuged at 10,000rpm and 4 ℃ for 30 minutes, and the supernatant was collected and filtered using a 0.45 μm filter.

In this example, the polypeptide is separated and purified by first adsorbing the fusion protein by ion exchange, Buffer A25 mM CH3COONa, pH 4.5; buffer B25 mM PBS, 1M NaCl pH7.5; loading Buffer A in a balanced manner, and eluting Buffer B; the eluted fusion protein is subjected to enzyme digestion Buffer exchange by ultrafiltration, and then is further subjected to enzyme digestion by an ion exchange column balanced by Buffer A, wherein the flow-through part is a target polypeptide product, and the electrophoresis result is shown in figure 3.

In this example, the results of separation and purification of Arg34GLP-1 (7-31) and liquid chromatography detection after digestion of the fusion protein are shown in FIG. 4 (specifically, a peak corresponding to 300ml on the abscissa) and FIG. 5 (specifically, a peak at a retention time of 15.273 min); the mass Spectrum results are shown in fig. 6 (Spectrum from 20180206_ JXZ _ biaopin. wiff (sample 1) -20180206_ JXZ _ biaopin, experimental 1, + TOF MS (100 + 2000) from JXZ min), and the significant mass-to-charge ratio values in fig. 6 are JXZ (5),. JXZ (4), JXZ (3).

The results indicated that the Arg34GLP-1 (7-31) polypeptide was successfully obtained.

Example 4 high Density fermentation

The recombinant expression strain containing the CRISPII ClpA-ClpP-ClpX obtained in example 1 was inoculated into 3mL of liquid LB medium, shake-cultured at 37 ℃ and 250rpm overnight, and then inoculated into 400mL of liquid LB medium at a ratio of about 1%, and when the OD600 reached 4, the seed solution was cultured and inoculated into 2L of fermentation medium for high-density fermentation. The initial temperature was 37 ℃, the stirring speed was 300rpm, the aeration was 1.5vvm/L/min, the pH was 6.8, and then the stirring speed was continuously increased up to 1000 rpm. High-density fermentation has large oxygen demand, such as oxygen deficiency, can generate acetic acid, even cause thalli to crack, explain and release harmful substances, and have irreversible influence on the expression of recombinant engineering bacteria. Therefore, a certain amount of pure oxygen needs to be supplemented in the later period. The fermentation culture is divided into two stages, after the first stage inoculation, the culture is carried out for about 4 hours, the carbon source in the culture medium is completely consumed, and feedback feeding is carried out according to DO. After feeding, the temperature is reduced to 30 ℃, dissolved oxygen is kept above 30%, isopropyl thiogalactoside (IPTG) is added for induction after feeding for 8 hours, and the tank is placed after induction for 12 hours.

The result shows that the yield of the target product can reach 2g/L, and the yield can be improved by more than 2 times compared with a control strain (without CRISPII). The results of the fermenter expression electrophoresis are shown in FIG. 2B. As can be seen from Table 1, the soluble volume yield of the fusion protein of the engineering bacteria not using CRISPII is 100%, and the soluble volume yield of the fusion protein of the engineering bacteria using CRISPII can reach 253% at most.

Comparative example 1 CRISPR technique inhibits different protease genes

The similar method of the embodiment 1 is adopted, the CRISPR technology is utilized to inhibit different types of protease genes, and the formation of protease is reduced, so that the degradation of the protease on polypeptide fragments is reduced, and the yield of the polypeptide is indirectly improved.

Specifically, the ClpA and/or ClpP and/or ClpX genes, and ClpQ, ClpY, PepD, HflB genes were inhibited in escherichia coli using the CRISPRi technique. Wherein NCBI Gene IDs of the ClpA, ClpP, ClpX, ClpQ, ClpY, PepD and HflB sequences are 945764, 945082, 945083, 948429, 948430, 945013 and 947690 respectively; meanwhile, an appropriate gene segment is selected as a component of the sgRNA according to the target gene sequence to be edited.

A Multi-sgRNA unit was designed based on the protease sequence, and contained a template strand-specific nucleotide sequence to be inhibited, dCas9 hindle, and a terminator sequence.

The name of the gene targeted by the sgRNA, the nucleotide sequence of the sgRNA, and the sequence number (SEQ ID No.) are shown below, respectively:

ClpA：CTTGATCTCTTCCATCGCATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO.: 1)；

ClpX：GTACATGGTATCGAGCAGTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO.: 2)；

ClpP：GTATTCCACCGCTTCAGGGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT(SEQ ID NO.: 3)；

ClpQ：AAGTTTGCGCAGCATGCGATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO.: 4)；

ClpY：TCAGCGCCTGCAGTTCAACGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO.: 5)；

HflB：CTTTCGCTACGCTACGGCCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO.: 6)；

PepD：ATCACCGGAGAATTAGCGTCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO.: 7)；

ClpA-ClpP：CTTGATCTCTTCCATCGCATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGTATTCCACCGCTTCAGGGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO.: 8)；

ClpP-ClpX：GTATTCCACCGCTTCAGGGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGTACATGGTATCGAGCAGTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO.: 9)；

ClpA–ClpX：CTTGATCTCTTCCATCGCATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGTACATGGTATCGAGCAGTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO.: 10)；

ClpA-ClpP-ClpX：CTTGATCTCTTCCATCGCATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGTATTCCACCGCTTCAGGGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGTACATGGTATCGAGCAGTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO.: 11)。

fermentation was performed in a similar manner to example 2, the yield of the objective product was measured, and the percentage change in the yield of each protease-inhibited recombinant expression strain from the control strain was calculated using an expression strain that was not inhibited by CRISPRi as the control strain.

Results are shown in the following table 1, compared with a control group which is not subjected to gene editing, the fermentation culture volume yield of the escherichia coli recombinant expression strain containing the CRISPRi ClpA plasmid can reach 156%; the fermentation culture volume yield of the escherichia coli recombinant expression strain containing the CRISPR ClpX plasmid can reach 183 percent; the fermentation culture volume yield of the escherichia coli recombinant expression strain containing the CRISPR ClpP plasmid can reach 200%; the fermentation culture volume yield of the escherichia coli recombinant expression strain containing CRISPII ClpA-ClpP-ClpX can reach 230%. When the CRISPR plasmid and the expression plasmid are co-expressed, the cell growth is basically not influenced, but the protein expression level is greatly improved, which shows that the method can effectively inhibit the expression of protease genes, namely the CRISPR can effectively regulate and control the gene expression.

TABLE 1 fermentation culture volumes of different recombinant Escherichia coli expression strains

The ClpP protease is an important heat shock protein in cells, mainly plays the role of a proteolytic enzyme in vivo and degrades abnormal proteins or short-lived proteins. ClpP is often combined with atpase subunits (ClpA/ClpX, etc.) as a protease subunit to form a Clp complex, which is formed to more efficiently degrade complex polypeptides and folded proteins. ClpA/ClpX can be used as a molecular chaperone to specifically recognize and unfold a substrate, and the unfolded polypeptide is transported to a ClpP protein central hydrolysis cavity for hydrolysis.

Comparative example 2

Synthesis of a flexible linker comprising: GGGGS, (GGS)₂、（GGGGS）₃、（GGGGS）₄(ii) a Rigid linker: EAAAK, (EAAAK)₂、（EAAAK）₃、（EAAAK）₄The different recombinant expression vector PET28 a-TrxA-linker-DDDDDDK-Arg 34GLP-1 (7-31); after different recombinant expression vectors are introduced into host competence, respectively carrying out shake flask expression screening, wherein screening results show that the recombinant expression vectors contain linker: (GGGGS)₃The recombinant strain has the optimal soluble expression ratio. Please refer to fig. 7, lanes 1-8 in the protein electrophoretogram are soluble supernatants (in-frame portions) of intracellular fusion proteins expressed by recombinant bacteria containing linker (EAAAK) 4, (EAAAK) 3, (EAAAK) 2, EAAAK, (GGGGS) 4, (GGGGS) 3, (ggggggs) 2, and GGGGS, respectively; the optical density comparison shows that the fusion protein in lane 6, i.e., the fusion protein containing linker (GGGGS) 3, has the highest solubility ratio.

Discussion of the related Art

Effect of proteases on polypeptide expression in E.coli

Proteases can degrade proteins and peptides, so reducing protease degradation of proteins is also an indirect way to increase protein production. Therefore, we investigated the effect of proteases on polypeptides expressed in E.coli.

Lon is a DNA-binding ATP-dependent protease, belonging to the serine proteases; OmpT, also known as outer membrane protease VII, belongs to the serine proteases; coli BL21(DE3) has knocked out Lon and OmpT. However, since knockout of excessive protease genes changes the growth state of the strain, we attempted to interfere with transcription of protease genes by CRISPRi, and reduce the expression of part of the protease without affecting the growth of the strain. The ClpA, ClpP and ClpX are screened based on experiments, so that the degradation effect of the polypeptide fusion protein of the recombinant engineering bacteria is reduced, and the soluble expression yield of the polypeptide is indirectly improved.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Ourte pharmaceutical industry (Tianjin) Co., Ltd

<120> a method for increasing the soluble expression yield of a polypeptide

<130> P2020-2518

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 103

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 1

cttgatctct tccatcgcat gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt ttt 103

<210> 2

<211> 103

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 2

gtacatggta tcgagcagtg gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt ttt 103

<210> 3

<211> 103

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

gtattccacc gcttcagggg gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt ttt 103

<210> 4

<211> 103

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

aagtttgcgc agcatgcgat gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt ttt 103

<210> 5

<211> 103

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

tcagcgcctg cagttcaacg gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt ttt 103

<210> 6

<211> 103

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

ctttcgctac gctacggccg gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt ttt 103

<210> 7

<211> 103

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

atcaccggag aattagcgtc gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt ttt 103

<210> 8

<211> 206

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 8

cttgatctct tccatcgcat gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt tttgtattcc accgcttcag 120

ggggttttag agctagaaat agcaagttaa aataaggcta gtccgttatc aacttgaaaa 180

agtggcaccg agtcggtgct tttttt 206

<210> 9

<211> 206

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 9

gtattccacc gcttcagggg gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt tttgtacatg gtatcgagca 120

gtggttttag agctagaaat agcaagttaa aataaggcta gtccgttatc aacttgaaaa 180

agtggcaccg agtcggtgct tttttt 206

<210> 10

<211> 206

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 10

cttgatctct tccatcgcat gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt tttgtacatg gtatcgagca 120

gtggttttag agctagaaat agcaagttaa aataaggcta gtccgttatc aacttgaaaa 180

agtggcaccg agtcggtgct tttttt 206

<210> 11

<211> 309

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 11

cttgatctct tccatcgcat gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt tttgtattcc accgcttcag 120

ggggttttag agctagaaat agcaagttaa aataaggcta gtccgttatc aacttgaaaa 180

agtggcaccg agtcggtgct ttttttgtac atggtatcga gcagtggttt tagagctaga 240

aatagcaagt taaaataagg ctagtccgtt atcaacttga aaaagtggca ccgagtcggt 300

gcttttttt 309

Claims

1. A method for improving the soluble expression quantity of an exogenous protein in a recombinant bacterium, which is characterized by comprising the step of inhibiting an endogenous protease gene in the recombinant bacterium by using a CRISPR/Cas9 system, wherein the protease comprises the following components: ClpA, ClpP and ClpX, the CRISPR/Cas9 system comprises sgRNA, and the sequence of the sgRNA is shown as SEQ ID NO. 11.

2. The method of claim 1, wherein the protease further comprises ClpQ, ClpY, PepD, and/or HflB.

3. The method of claim 1, wherein the recombinant bacterium is recombinant E.coli.

4. The method of claim 1, wherein the exogenous protein is selected from the group consisting of: GLP-1, GLP-2, glucagon-like peptide, enterokinase, adenosine deaminase, alpha/beta-glucosidase and glutathione reductase.

5. A recombinant Escherichia coli, wherein an expression cassette for expressing a foreign protein is integrated into the genome of the recombinant Escherichia coli, and an endogenous protease gene of the recombinant Escherichia coli is inhibited; the protease comprises the following components: ClpA, ClpP, and ClpX;

the recombinant Escherichia coli is prepared by the method of claim 1.

6. A method of producing a polypeptide, said method comprising the steps of:

(i) culturing the recombinant E.coli of claim 5, thereby obtaining a fermentation product comprising the polypeptide; and

(ii) isolating said polypeptide from said fermentation product.

7. Use of the recombinant E.coli of claim 5 for the production of a polypeptide.