CN113564169A

CN113564169A - Japanese eel antibacterial peptide Cathelicidin2 gene promoter and application thereof

Info

Publication number: CN113564169A
Application number: CN202110942337.4A
Authority: CN
Inventors: 冯建军; 彭欣慰; 林鹏; 王艺磊; 陈鹏云
Original assignee: Jimei University
Current assignee: Jimei University
Priority date: 2021-08-17
Filing date: 2021-08-17
Publication date: 2021-10-29
Anticipated expiration: 2041-08-17
Also published as: CN113564169B

Abstract

The invention relates to a promoter of a Cathelicidin2 gene of anguilla japonica antibacterial peptide and application thereof. The invention successfully clones the promoter sequence of the peptide Cathelicidin2 gene of anguilla japonica, and successfully constructs a reporter plasmid of the gene promoter pGL3-Cathelicidin2-pro luciferase of the peptide Cathelicidin2 of anguilla japonica. Experiments prove that the promoter of the antibacterial peptide Cathelicidin2 gene of the anguilla japonica can be induced and activated by important surface antigen LPS of gram-negative bacteria and aeromonas hydrophila. Cloning of a promoter of the antibacterial peptide Cathelicidin2 gene of the anguilla japonica and induced expression analysis of the activity of the strong promoter thereof provide a good experimental system for researching an expression regulation mechanism of the antibacterial peptide Cathelicidin2 gene of the anguilla japonica, a natural immune response mechanism of fishes for resisting pathogenic bacteria infection, particularly important research on a regulation mechanism of NF-kB and MAPK signal path networks related to fish inflammation, and create conditions for constructing an expression vector to efficiently express exogenous genes by using the promoter or applying the promoter to constructing transgenic fishes.

Description

Japanese eel antibacterial peptide Cathelicidin2 gene promoter and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a promoter of a Cathelicidin2 gene of anguilla japonica antibacterial peptide and application thereof.

Background

Antimicrobial Peptides (AMPs) are small Molecular polypeptides with biological activity, are important components of the innate immune defense system of the body, can well inhibit or kill gram-negative bacteria, gram-positive bacteria, fungi, viruses, parasites and the like, and play an important role in Natural immune response reaction [ Chung, C. -R., J. -H.Jhong, Z.Wang, W.Chen, Wan, Horng and T. -Y.Lee (2020). "chromatography and Identification of Natural Antimicrobial Peptides on Difference Organisms." International Journal of Molecular Sciences 21:986 ]. Fish, like higher vertebrates such as mammals, have innate and adaptive immune systems. The antibacterial peptide is an important component of the fish innate immune system, and can be rapidly produced and spread in vivo to play a role in defense and killing when fish bodies are damaged or invaded by pathogenic microorganisms. The fish antibacterial Peptide mainly comprises Cathelicidins, liver-expressed antibacterial Peptide-2 (Lipex antibacterial Peptide 2, LEAP-2), Piscidins, beta-defensens, Hepcidins and NKlysins [ Zitao, xu Yang, Jun, Nees (2020). ] aquatic animal antibacterial Peptide research progress 44(09): 1572) 1583 ].

Cathelicidin is a largest antimicrobial peptide family discovered at present, has the function of resisting pathogenic microorganisms in a broad spectrum, and has good killing effect on gram-positive bacteria, gram-negative bacteria, fungi, viruses and protozoa. Studies have shown that humans have only one Cathelicidin gene, whereas other mammals and fish contain multiple Cathelicidin genes. The structure of the fish Cathelicidin is the same as that of mammals, and comprises three regions of a signal peptide (Pre region), a Pro region and a C-terminal mature peptide, but the number of contained amino acids is different. Two antibacterial peptides, Cathelicidin1 and Cathelicidin2, were identified at present in anguilla japonica, rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar), and Atlantic spotted salmon (salvellus fontinalis), Cathelicidin2 was identified in Plecoglossus altivelis and Anise (Thymallus thysus), while three antibacterial peptides, Cathelicidin1, Cathelicidin2 and Cathelicidin3 were identified in Acipenser dabryanus (Gadus morhoua) [ sic, Chapter zuki (2013). "Proc. university of research on Cathelicidin antibacterial peptides in fishes" (Nature. Acad. Sci. Association edition) 18 (06: 413) 419 ]. However, the research on the promoter of the fish antimicrobial peptide Cathelicidin2 has been reported only in rainbow trout [ Zhao purple Xixia, Xijian, Jiangxiang, Baiqingli, Jiankun, Chen Bao Hua, Xupeng (2018). ] that the promoter function of the immune inducible gene Cathelicidin2 of rainbow trout is analyzed 39(04): 37-45.). The research successfully constructs the rainbow trout pGL3-Cathelicidin2 promoter luciferase expression vector, and finds that the NF-kB transcription factor can enhance the activity of the promoter, but the mechanism of immune regulation whether the luciferase expression vector is induced and expressed by pathogenic microorganisms such as viruses and bacteria is not reported.

The regulation of gene expression has become a hotspot in the field of molecular biology research, and promoters are important elements for the regulation of gene expression. In view of the importance of the fish Cathelicidin2 in resisting bacteria and virus immunity and preventing and treating diseases thereof, the research on a gene expression regulation mechanism of the fish Cathelicidin2 provides a new idea for preventing and treating bacteria and virus diseases of the fish by regulating the expression of Cathelicidin 2. A promoter is a key factor determining gene expression and regulation, in order to research an expression regulation mechanism of a fish Cathelidin 2 gene, a possible sequence of a 5' flanking regulatory region of a Cathelidin 2 gene of Japanese eel is obtained through comparison analysis of an open reading frame sequence and a genome sequence of the Cathelidin 2 of Japanese eel, a promoter sequence of the Cathelidin 2 gene is obtained through primer design and PCR cloning verification, analysis shows that the promoter has transcription binding sites of C/EBPalp, NF-kappaB, GATA and GAAA in a reported Cathelidin 2 promoter of the rainbow trout, but lacks transcription binding sites of CREBP, MAFF and HRE, and has specific transcription factor binding sites of AP1, AP-2, C-Jun, C-Fos, Sp1, NF-muE1, Ftz, 1, USF, MyoD and the like, and a specific eel Cathelidin 2 gene sequence is shown. Reporter gene detection experiments prove that the promoter of the Japanese eel Cathelicidin2 gene has stronger promoter activity, and can be induced and expressed by important antigen LPS (low-cholesterol) shown by gram-negative bacteria, important pathogenic bacteria aeromonas hydrophila of aquatic organisms and artificially synthesized double-stranded RNA poly I: C.

Therefore, the cloning of the promoter of the antibacterial peptide Cathelicidin2 gene of the anguilla japonica and the induced expression analysis of the strong promoter activity thereof provide a good experimental system for researching the expression regulation mechanism of the antibacterial peptide Cathelicidin2 gene of the anguilla japonica, the natural immune response mechanism of the fish for resisting pathogenic bacteria infection, in particular the important research on the regulation mechanism of NF-kappa B and MAPK signal path network related to fish inflammation, create conditions for constructing an expression vector to efficiently express an exogenous gene by using the promoter or applying the promoter to the construction of transgenic fish in the application aspect, and have important theoretical and practical significance.

Disclosure of Invention

The invention aims to overcome the defects of the prior art, provides a promoter of a Cathelicidin2 gene of anguilla japonica antibacterial peptide and application thereof, and solves the problems in the background art.

One of the technical schemes adopted by the invention for solving the technical problems is as follows: provides a promoter of a Japanese eel antibacterial peptide Cathelicidin2 gene, and the nucleotide sequence is shown as SEQ ID NO: 1 is shown.

The second technical scheme adopted by the invention for solving the technical problems is as follows: provides an expression cassette, a recombinant vector, a transgenic cell line, a recombinant bacterium or a recombinant virus containing the promoter.

Preferably, the expression cassette consists of the above-mentioned promoter, the target gene whose transcription is initiated by the above-mentioned promoter, and a terminator.

Preferably, the recombinant vector is pGL3-Basic, pGL2-Basic, pGL4.10 or pGLuc.

Preferably, the recombinant bacteria are escherichia coli, bacillus subtilis, lactic acid bacteria and yeast.

The third technical scheme adopted by the invention for solving the technical problems is as follows: provides the application of the promoter of the Japanese eel antibacterial peptide Cathelicidin2 gene in constructing eukaryotic expression vectors, fish cells or mammalian cells to efficiently express exogenous genes.

The fourth technical scheme adopted by the invention for solving the technical problems is as follows: provides the application of the promoter of the antimicrobial peptide Cathelicidin2 gene of the anguilla japonica in constructing transgenic fish.

The invention has the following beneficial effects: the applicant successfully clones and obtains a promoter of a Japanese eel antibacterial peptide Cathelicidin2 gene. According to the invention, the Japanese eel genome is analyzed by comparing the sequence of the first exon of an open reading frame of the Japanese eel antibacterial peptide Cathelicidin2 gene, and the sequence of the 5' flanking region of the gene of the antibacterial peptide Cathelicidin2 is analyzed and predicted by adopting a touchdown PCR method, so that the promoter sequence of the Japanese eel antibacterial peptide Cathelicidin2 gene is obtained; report gene analysis experiments prove that the promoter of the antibacterial peptide Cathelicidin2 gene of the anguilla japonica can be induced and activated by important surface antigen LPS of gram-negative bacteria escherichia coli and important pathogenic bacteria aeromonas hydrophila of aquatic animals. Therefore, the cloning of the promoter of the Japanese eel antibacterial peptide Cathelicidin2 gene and the verification of the strong promoter activity thereof theoretically provide a good experimental system for researching the expression regulation mechanism of the fish antibacterial peptide Cathelicidin2 gene and the antibacterial infection mechanism of an important fish inflammation related functional gene, in particular the important research on the NF-kB and MAPK signal path network regulation mechanism related to fish inflammation, create conditions for constructing an expression vector to efficiently express an exogenous gene by using the promoter or applying the promoter to transgenic fish construction in the application aspect, and have important theoretical and practical significance.

Drawings

FIG. 1 is a schematic diagram 1 of binding sites of transcription factors of a promoter of a Japanese eel antibacterial peptide Cathelicidin2 gene.

FIG. 2 is a schematic diagram of binding sites of transcription factors of a promoter of the Japanese eel antibacterial peptide Cathelicidin2 gene.

FIG. 3 is a schematic diagram of binding sites of transcription factors of a promoter of the Japanese eel antibacterial peptide Cathelicidin2 gene.

FIG. 4 is a diagram showing quantitative analysis of the activity of the promoter of the peptide Cathelicidin2 gene from anguilla japonica by using a dual-luciferase reporter gene detection system.

Wherein the abscissa pGL3 represents the relative luciferase activity of the empty vector pGL3-Basic transfected EPC cells (as a control);

pGL3-Cathelicidin2-pro is the relative luciferase activity of recombinant vector pGL3-Cathelicidin2-pro transfected EPC cells (as experimental group).

As shown in FIG. 4, the relative activity of luciferase in the EPC cells transfected by the recombinant vector pGL3-Cathelicidin2-pro is 2.1 times that of the EPC cells transfected by the empty vector pGL3-Basic, which indicates that the promoter of the peptide Cathelicidin2 gene of anguilla japonica can well promote the transcription of a luciferase reporter gene.

Each experiment was performed in triplicate, three replicates each time; error bars represent standard error of the mean. The experimental group was statistically analyzed for significant differences from the control group using a two-tailed group T-test, "x" p <0.05, "x" p < 0.01.

FIG. 5 is a graph showing the change in the activity of the promoter of the peptide Cathelicidin2 gene of anguilla japonica under the stimulation with LPS (30. mu.g/mL) which is an important surface antigen of gram-negative bacteria Escherichia coli.

Wherein the abscissa pGL3-Basic indicates the relative luciferase activity of the empty vector pGL3-Basic transfected EPC cells (as a control);

As shown in FIG. 5, the relative activity of luciferase in EPC cells transfected with recombinant vector pGL3-Cathelicidin2-pro stimulated by LPS for 24h was 1.9 times that of EPC cells transfected with empty vector pGL3-Basic, indicating that the promoter of the peptide Cathelicidin2 gene of anguilla japonica was activated by LPS induction.

FIG. 6 shows Aeromonas hydrophila (10), an important pathogen of aquatic animals⁶cfu/mL) under the stimulation condition, the activity change diagram of the promoter of the antimicrobial peptide Cathelicidin2 gene of the Japanese eel.

As shown in FIG. 6, the relative activity of luciferase in EPC cells transfected by recombinant vector pGL3-Cathelicidin2-pro stimulated by Aeromonas hydrophila 6h was 2.2 times that of EPC cells transfected by empty vector pGL3-Basic, indicating that the promoter of the peptide Cathelicidin2 gene of anguilla japonica was inducible to be activated by Aeromonas hydrophila.

FIG. 7 is a graph showing the change in the activity of the promoter of the Cathelidin 2 gene from Japanese eels under the stimulation with a virus mimic artificially synthesized double-stranded RNA poly I: C (50. mu.g/mL).

As shown in FIG. 7, the relative activity of luciferase in EPC cells transfected by 24h recombinant vector pGL3-Cathelicidin2-pro stimulated by poly I: C was 1.1 times that of EPC cells transfected by empty vector pGL3-Basic, and there was no significant difference, indicating that the promoter of the Catelicidin 2 gene of Anguilla japonica could not be activated by poly I: C induction.

Detailed Description

For better understanding of the present invention, the following embodiments and the accompanying drawings are used to describe the present invention in further detail, but those skilled in the art will appreciate that the following embodiments are not intended to limit the scope of the present invention, and any changes and modifications based on the present invention are within the scope of the present invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 cloning of promoter of Cathelidin 2 Gene of Anguilla japonica antimicrobial peptide

Firstly, extracting and purifying the Japanese eel muscle tissue genome DNA by adopting a TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 Kit. The specific operation is as follows:

1. 10mg of Japanese eel muscle tissue was cut with a razor blade and placed in a 2mL centrifuge tube, and 180. mu.L of Buffer GL, 20. mu.L of protease K and 10. mu.L of RNase A (10mg/mL) were added thereto, followed by lysis in a 56 ℃ water bath overnight.

2. Add 200. mu.L Buffer GB and 200. mu.L 100% ethanol to the lysate, pipette well and mix well. The Spin Column was mounted on a Collection Tube, the solution was transferred to the Spin Column, centrifuged at 12,000rpm for 2 minutes, and the filtrate was discarded.

3. mu.L of Buffer WA WAs added to the Spin Column, centrifuged at 12,000rpm for 1 minute, and the filtrate WAs discarded.

4. mu.L of Buffer WB (with the previously indicated volume of 100% ethanol added) was added to the Spin Column around the tube wall, centrifuged at 12,000rpm for 1 min, and the filtrate discarded. mu.L of Buffer WB was again added to the Spin Column around the tube wall, centrifuged at 12,000rpm for 1 min, and the filtrate was discarded.

5. Spin Column was mounted on the Collection Tube and centrifuged at 12,000rpm for 2 minutes. Spin Column was placed on a new 1.5mL centrifuge tube, and 150 μ L of sterile water heated to 65 ℃ was added to the center of the Spin Column membrane and allowed to stand at room temperature for 5 minutes. DNA was eluted by centrifugation at 12,000rpm for 2 minutes.

6. The concentration of the extracted genomic DNA was measured by absorbance measurement.

Secondly, amplifying a promoter sequence of the Cathelicidin2 gene of the anguilla japonica antibacterial peptide by adopting a two-round touchdown PCR method. The method comprises the following specific steps:

1. the sequence of the first exon (shown as SEQ ID NO: 2) of the open reading frame of the antimicrobial peptide Cathelicidin2 gene of the Japanese eel is analyzed in an alignment way, the sequence of the 5 'flanking region of the gene 2 of the antimicrobial peptide Cathelicidin predicted by the analysis is amplified, an upstream primer "5'-CTACCTGGGAAATGTGGGTGGAG-3'(shown as SEQ ID NO: 3)" is the sequence of the 5' flanking region of the gene 2 of the antimicrobial peptide Cathelicidin, and a downstream primer "5'-GACATCTGTAAAGGTGAAGACGCTCC-3' (shown as SEQ ID NO: 4)" is the sequence of the first exon of the open reading frame of the gene Cathelicidin2 of the antimicrobial peptide Cathelicidin, and the sequence is synthesized by Shanghai bioengineering company.

2. The first round of PCR was performed using high fidelity enzyme from Takara

GC Buffer(Mg²⁺plus), the reaction system: 2 XPrimeSTAR HS DNA Polymerase 12.5. mu.L, upstream primer 0.5. mu.L, downstream primer 0.5. mu. L, gDNA 0.5.5. mu.L, sterilized water 11. mu.L; the dropping PCR reaction program is 95 ℃ for 5 min; at 95 ℃ for 30s, at 60 ℃ for 30s, at 72 ℃ for 4min, for 4 cycles; at 95 ℃ for 30s, at 58 ℃ for 30s, at 72 ℃ for 4min, for 4 cycles; 30 cycles of 95 ℃ for 30s, 56 ℃ for 30s, and 72 ℃ for 4 min; 10min at 72 ℃; 5min at 4 ℃.

3. The second round of PCR was performed using Takara 10 XEx Taq Buffer (Mg)²⁺plus), the reaction system: ex Taq 0.13. mu.L, 10 XEx Taq Buffer (Mg2+ plus) 2.5. mu.L, dNTP mix (2.5mM each) 2. mu.L, upstream primer 0.5. mu.L, downstream primer 0.5. mu.L, first round PCR product 0.5. mu.L, and sterilized water 18.87. mu.L; the dropping PCR reaction program is 95 ℃ for 5 min; 9530s at 60 ℃ for 30s, 4min at 72 ℃ for 4 cycles; at 95 ℃ for 30s, at 58 ℃ for 30s, at 72 ℃ for 4min, for 4 cycles; 30 cycles of 95 ℃ for 30s, 56 ℃ for 30s, and 72 ℃ for 4 min; 10min at 72 ℃; 5min at 4 ℃.

4. The PCR product obtained by the second round of PCR amplification is connected to a pMD19T-Simple vector of TaKaRa company for sequence determination and analysis, thereby obtaining a pMD19T-Cathelicidin2-pro recombinant plasmid containing a promoter sequence of the Japanese eel antibacterial peptide Cathelicidin2 gene.

The nucleotide sequence of the promoter of the antibacterial peptide Cathelicidin2 gene of the anguilla japonica is shown as SEQ ID NO: 1, and the following components:

the sequence of the first exon of an open reading frame of the Japanese eel antibacterial peptide Cathelicidin2 gene is shown as SEQ ID NO: 2 is shown in

ATGAGAAGTGAGACACATAAGATGAAGAGCTCTGTTGGACCTCTGCTGCTGCTCTCCCTTGTTGCTTTTGTCTCTGTGACATTGGCCAGGAGCGTCTTCACCTTTACAGATGTCCTTGCCGCGGCCACTGCAGACTTCAACCAGAAAAGCCAGGAGACAAAAGCTTTTGGACCTCCAAAGCAGGGCGCTTTGCGGTCAATG

Example 2 prediction of transcription factor binding site of promoter of antimicrobial peptide Cathelicidin2 Gene from Anguilla japonica

The online prediction software Alibaba2(http:// gene-regulation. com/pub/programs/Alibaba2/index. html) for transcription factor binding sites in the 5' flanking region of the internet access gene copies the promoter sequence of the Cathelicidin2 gene obtained by the clone test verification, pastes the copied promoter sequence in a fasta format in a dialog box, and clicks START to perform prediction analysis of the transcription factor binding sites. The results are shown in FIGS. 1 to 3:

the main transcription factor binding sites of the promoter of the antibacterial peptide Cathelicidin2 gene of the anguilla japonica are as follows:

example 3 Activity analysis of the promoter of the Cathelidin 2 Gene of the anguilla marmorata antimicrobial peptide

Firstly, constructing a recombinant luciferase reporter gene vector pGL3-Cathelicidin2-pro containing a promoter fragment of a Cathelicidin2 gene of anguilla japonica antibacterial peptide.

1. The promoter fragment of the Japanese eel antibacterial peptide Cathelicidin2 gene is inserted into Luciferase reporter gene vector pGL3-Basic of Promega company, so that the expression of the firefly Luciferase (Luciferase) reporter gene is controlled by the Japanese eel antibacterial peptide Cathelicidin2 gene promoter, and the constructed recombinant vector is named as pGL3-Cathelicidin 2-pro. The method comprises the following specific steps:

synthesizing an upstream primer with an MluI enzyme cutting site:

5'-CGACGCGTCTACCTGGGAAATGTGGGTGGAG-3' (shown in SEQ ID NO: 5),

downstream primer with SmaI cleavage site:

5'-TCCCCCGGGCTCAGTCGCACACTGGTCAATTACAG-3' (shown in SEQ ID NO: 6). Using high fidelity enzyme of Takara

GC Buffer(Mg²⁺plus), the reaction system: 2 XPrimeSTAR HS DNA polymerase12.5. mu.L, upstream primer 0.5. mu.L, downstream primer 0.5. mu. L, pMD19T-Cathelicidin2-pro recombinant plasmid 0.5. mu.L, sterilized water 11. mu.L; the dropping PCR reaction program is 95 ℃ for 5 min; at 95 ℃ for 30s, at 60 ℃ for 30s, at 72 ℃ for 4min, for 4 cycles; at 95 ℃ for 30s, at 58 ℃ for 30s, at 72 ℃ for 4min, for 4 cycles; 30 cycles of 95 ℃ for 30s, 56 ℃ for 30s, and 72 ℃ for 4 min; 10min at 72 ℃; 5min at 4 DEG C. PCR product recovery was performed using Omega gel recovery kit.

2. The recovered PCR product and the vector pGL3-Basic were digested with MluI/SmaI (Thermo Scientific Fermentas Fast Digest), respectively.

The total volume of the double enzyme digestion reaction system is 40 mu L, comprising 4 mu L of 10 XFastdigest Green Buffer, 2 mu L of each of enzyme MluI and enzyme SmaI, 1.5 mu g of each vector/PCR product, and sterilized water is supplemented to 40 mu L.

And (3) uniformly mixing the system in a PCR tube, and then carrying out enzyme digestion reaction, wherein the reaction procedure is as follows: 60min at 37 ℃; 20min at 80 ℃; 4 ℃ for 5 min.

Respectively recovering the MluI/SmaI double-enzyme-digested PCR product and the vector pGL3-Basic by using an Omega glue recovery kit, connecting the double-enzyme-digested PCR product and the vector pGL3-Basic by using Takara T4 ligase, wherein the connecting reaction system is 20 mu L and comprises 2 mu L10 XT 4 Buffer, 1 mu LT4 DNA ligase, 40ng of double-enzyme-digested vector pGL3-Basic and 300ng of double-enzyme-digested PCR product, supplementing sterile water to 20 mu L, uniformly mixing the systems in a PCR tube, and connecting at 16 ℃ for overnight.

3. Coli DH5 alpha competent cells are transformed by the ligation product, positive clones are screened by colony PCR, plasmids are extracted by an Omega small-scale endotoxin-free plasmid kit, and the correctness of the insertion of a promoter fragment is confirmed by sequencing, so that the recombinant luciferase reporter gene vector pGL3-Cathelicidin2-pro containing the promoter fragment of the Japanese eel antibacterial peptide Cathelicidin2 gene is obtained.

Secondly, analyzing the basic activity of the promoter of the antibacterial peptide Cathelicidin2 gene of the anguilla japonica by adopting a dual-luciferase reporter gene detection system.

1. The well-conditioned EPC cells were seeded into 48-well cell plates (1X 10)⁵And/well), adding an L15 culture medium (an L15 basic culture medium contains 10% Gibco Australia fetal bovine serum), transferring into a constant-temperature incubator at 28 ℃ for overnight culture, allowing the cells to adhere to the wall and recovering to the state of logarithmic growth phase, and performing a transfection experiment when the adherence amount reaches about 80%. Cell culture medium was changed 2h before transfection.

For transfection, 0.5. mu.L Lipofectamine 3000Reagent transfection Reagent and 20. mu.L Opti per well were usedAnd (4) preparing a transfection reagent diluent by using a MEM low-serum culture medium, uniformly mixing, and then incubating at room temperature for 5 min. Then, 20 mu.L of Opti-MEM low serum culture medium per well is fully mixed with the required plasmid per well, wherein a control group contains 20ng of renilla luciferase internal reference reporter gene vector pRL-TK and 300ng of luciferase reporter gene vector pGL3-Basic vector, an experimental group contains 20ng of renilla luciferase internal reference reporter gene vector pRL-TK and 300ng of recombinant luciferase reporter gene vector pGL3-Cathelicidin2-pro, and then 0.5 mu L P3000 is added^TMAnd mixing the reagents. The prepared plasmid diluent is dropwise added into the transfection reagent diluent, mixed uniformly to form a transfection compound solution, incubated at room temperature for 15min, slowly added into EPC cell culture wells, and cultured in a constant-temperature incubator (28 ℃).

And 2.24h later, collecting transfected cells, respectively reading enzyme activity values of firefly luciferase and renilla luciferase by using a dual-luciferase reporter gene detection system, and calculating the ratio of the enzyme activity values of the firefly luciferase and the renilla luciferase to obtain the relative activity of the luciferase in the transfected cells. The luciferase enzyme activity determination method is carried out by referring to the specification of a dual-luciferase reporter gene detection system of Promega company, and comprises the following specific steps:

(1) preparing reagents required by the experiment: 1 XPLB lysate: 1 volume of 5 multiplied by Passive powders Buffer and 4 volumes of double distilled water are mixed evenly to prepare the product; start reagent (LARI): completely dissolving the Luciferase Assay Substrate powder in 10mL Luciferase Assay Buffer II solution, subpackaging by using 1.5mL centrifuge tubes, and storing in a refrigerator at-80 ℃; stop reagent: 1 volume of 50 × Stop according to experimental amount&

Substrate uses a 49 volume Stop&

And (4) diluting by using Buffer.

(2) Cell culture medium was slowly aspirated from 48 well cell culture plates and 65. mu.L of 1 XPLB lysate was added to each well.

(3) The 48-well cell culture plate was placed on a cell shaker and lysed for 15min with shaking.

(3) The lysed cell fluid was transferred to a 1.5mL centrifuge tube and centrifuged (13000rpm, 4 ℃, 10 min).

(4) mu.L of the centrifuged supernatant was taken out and placed in a 1.5mL centrifuge tube having a good light transmittance.

(5) Add 10. mu.L of Start reagent and measure the amount of firefly luciferase activity in the sample using a GloMax 20/20 luminometer. Subsequently, 10. mu.L of Stop reagent was added to measure the luciferase activity value of sea cucumber in the sample. The ratio of the activities of the two is the relative activity of the luciferase in each sample.

The relative activity of the pGL3-Cathelicidin2-pro promoter was calculated using EPC cells co-transfected with the empty vector pGL3-Basic and pRL-TK as a control (FIG. 4).

Third, immunostimulation experiment

pGL3-Basic and Japanese eel antibacterial peptide Cathelicidin2 gene promoter recombinant vector pGL3-Cathelicidin2-pro were transfected into EPC cells together with the internal reference reporter gene vector pRL-TK of Renilla luciferase respectively, and after 12h of transfection, LPS (30. mu.g/mL), poly I: C (50. mu.g/mL) and Aeromonas hydrophila (10. mu.g/mL) were added to the cell culture medium⁶cfu/mL), transfected cells were collected for luciferase relative activity assays 12h, 12h and 6h after stimulation, respectively.

The activity of the promoter of the peptide Cathelicidin2 gene from anguilla japonica under LPS (30. mu.g/mL) stimulation was changed as shown in FIG. 5.

As shown in FIG. 5, the relative activity of luciferase in the recombinant vector pGL3-Cathelicidin2-pro transfected EPC cells was 1.9 times that of the empty vector pGL3-Basic transfected EPC cells, indicating that the promoter of the peptide Cathelicidin2 gene of anguilla japonica was activated by LPS induction, ". sup." p <0.05, ". sup." p < 0.01.

In Aeromonas hydrophila (10)⁶cfu/mL) of the promoter activity of the peptide Cathelicidin2 gene of anguilla japonica under the stimulation condition is shown in FIG. 6.

As shown in FIG. 6, the relative activity of luciferase in pGL3-Cathelicidin2-pro transfected EPC cells was 2.2 times that of the empty vector pGL3-Basic transfected EPC cells, indicating that the promoter of the Japanese eel Cathelicidin2 gene was inducible by Aeromonas hydrophila, ". p <0.05,". p < 0.01.

The activity of the promoter of the peptide Cathelicidin2 gene from Anguilla japonica under poly I: C (50. mu.g/mL) stimulation is shown in FIG. 7.

As shown in FIG. 7, the relative activity of luciferase in the EPC cells transfected by the recombinant vector pGL3-Cathelicidin2-pro was 1.1 times that of the EPC cells transfected by the empty vector pGL3-Basic, and there was no significant difference, indicating that the promoter of the peptide Cathelicidin2 gene of anguilla japonica could not be induced to be activated by poly I: C.

Although specific embodiments of the invention have been described above, it will be understood by those skilled in the art that the specific embodiments described are illustrative only and are not limiting upon the scope of the invention, and that equivalent modifications and variations can be made by those skilled in the art without departing from the spirit of the invention, which is to be limited only by the appended claims.

Sequence listing

<110> college university

<120> Japanese eel antibacterial peptide cathelicidin2 gene promoter and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3524

<212> DNA

<213> Anguilla japonica

<400> 1

ctacctggga aatgtgggtg gagtttaggg acaaaacgac tgtgtgtttt tttttttttt 60

ttttttttaa gctgtgaatg gagctggaga gtgaaaagtg tctaggggcg tagagaagac 120

gagtttacga aagttgcttt ggttttgcaa ggtgtggttg tgaccgacga cagccgtaat 180

aaatacacaa atcgtgtaaa ctgtatcgga tactctttaa tagtagcgga cgctacagta 240

taaagtggta tctgaggagt ggaaaaatta ggcttgtcaa atttaaaatg gaattatacg 300

tctacattgt aatagaagaa ttgttaaaaa tgacattttt atatctgaac tattaggtct 360

cccagtaaat ctaacatagc ctacacttta cgcattttgc tatttgtaat atttgaacgt 420

aaatctaccc tctaggctac ctgtgagggt ggggaagtgt taacgaccac acgcaactat 480

agtgaattca agagtgtttc ttcaagttaa ccaccaaagt ggaaaccact gggtctcagt 540

aagagacgta aggagggagt aacgaaaaga aatgactcga ctcctaagga agaatatccc 600

aacacgaagt gaacgtctca gcaggcgaac gaaactaaaa cgtaaggagg gagtagaaat 660

ttagtaaaga ctgcagtaca gtctggagaa aagcaaaaga aaaggtgcct cgtaacgaga 720

aaggcaaaaa aaatacgtat taaggaaaat aaggaataaa gctaagtgac tagcaggacc 780

gaaatcttac tactagtcaa aataaaacgc tatattcaaa atcctatacc tttttcctta 840

ccacttttct ctaagagagc ttttcactgt taccggcttt cgtgaaacgt gagtagacac 900

taagcgaaga acagagctca cgtgagcgta tataagctct ctcaatcagg tgcaaacaat 960

cggacgtaat caaaagcaat cacagagcgc cctcaggcgg tcctgaagat taccacactc 1020

ggttacctga aacaccactc cgtttcctcg acagggacac tgagtagccg attagcacta 1080

aatggggtcg attagcacaa cccacgaggc cgcacagcaa acggaataac acccgttcct 1140

gacatacagc gacgcgagcg agcgagcgag cgagcaggaa aaagttgaga accactgatc 1200

tacacaatac gccataataa caaagcgaaa acacattttt agaaaatttt gcaaatttat 1260

tgaaaataaa aaactgatat ctgatttaca taactattca ccccctttgc tgtgacgcct 1320

taaaataagc tcagatgcat ccgatttctc tgagagatca cactaaagct taaatgtgtg 1380

atcacctgtg ttaaactgta gtgattctga ttatttcaga ataaaatcag ccgttcctga 1440

gtataaaagg aggcaacaca cataagaaac caatttttta tactggaagt tccattttca 1500

tcccagcctg gcctccttgg gaagggggca gggattattc tttttttaaa atgtcttggt 1560

aagtactggt gttcatgcca tctgtcttaa aaggacctcc gggaccagca gacacaaaac 1620

aaatccaaac aaaaaagacc accagccata tttcagtcta ggcatgggcc tatttcaaca 1680

tcgtcgatgt ccctggccag tgtgggagaa atgtgaccat gtgcacagcc attggtcacc 1740

gtgaggtcat ccatcaccat gcccaacttg gtccctacaa cactgctaac caggaagagg 1800

gaccagagca gcccaactac attggcattt agggtaatgt aagtttccac cgggctgctc 1860

tggtccacaa ctggttcgct aacaacccac atttttcagt tctctacctc tcaccatatt 1920

ccccatttct aaatccgatc gaagaattcc tttcagcatg gcggtggaag gtatatgacc 1980

gcaatcccca cgagcatgtg gccctactcc aggcaatgga ggaggcgtgt gacgacatcc 2040

acgcagacgc atgccagggg tggatccgcc atgccagccg ctttttcccc cgctgcttgg 2100

ccagggagaa catcgcatgc gatattttaa gtttctttaa gaaaaaaaca tcattttggg 2160

catgtattca tgagtttact tttccaagtc accaacatgc aatagtgcag gcttgtaaac 2220

tgctggaaaa agacatcaat taaaaaaata tgtcaatgta gtgttacatc agcattcaaa 2280

attgacttta ttcacaaaaa aacattcaga tacgtatttt aaatcgatcg cttaaagatt 2340

tgtacatgag ggcaagattt gaccacctat gagttaatgt gaataccttt aggtaatatt 2400

aaccttggta acctggcttc agtgctagct ggaaaggtcc gatttgtaat tttccctttg 2460

aaaacaactg cttgattgat gccagatgag catttggatg cgttcccgag gagtttccca 2520

atgacaacat gcacaatagt tacaggaaac acagcaggaa ggtagaacgg actgtgctgc 2580

cctgtgcaaa acaccggggc ctcagcagga agggagaagg aggagcaaaa taataataat 2640

aaacaaatta aataaatgca tgcagtattt gtatgaaacc ataacattgg attttttgcc 2700

ctttattccc tgtcagaggg aattttaaaa aaaatcattc agcaccaccc tttcacctgc 2760

aagcattctc taaaatggaa acatgttttt tttatttttt tatttattta cccagggtag 2820

gttcgctgag caaggatgct cttttgcagg aacgccctgc atcacactca tacacattca 2880

cacctgggag ctgcccagta caaccacaat cctctattgt tggccactgg tcagctccac 2940

tggtgggaga gaacttttat tagccaatta aatcagggga tgattaggtg gcaagttttc 3000

ggagagccag atctgggatt ttagccagga catcggggaa ccccctactc tttgcgaata 3060

gtgtcatggg atctttatga ccacttaatg ctgtattaaa acagcattaa gatatgactt 3120

ataatggcca ctattgtaaa atatagcctg ttttttaaat actgtaaaaa atactgtatc 3180

catgcgtata ttcatttcca agtattatta cttcattata gctacatgga aacacaaggt 3240

gtactttgga cttgtggact tatttacaca gccctgattt tttcttgtgt acttccaagt 3300

ggaaaagcca ggattgcact catgatgtag tgtttgtact ggaagtcggc agaaactttc 3360

cagaatactg cgaaactgac agttttacga tatagtgata cctttctgac atgatgggcg 3420

tagatagtcc caagggggcc atgtggagtt gcttaatctt agtgttcacc tgcaccttta 3480

aaaagctcag accccatgct gtaattgacc agtgtgcgac tgag 3524

<210> 2

<211> 201

<212> DNA

<213> Anguilla japonica

<400> 2

atgagaagtg agacacataa gatgaagagc tctgttggac ctctgctgct gctctccctt 60

gttgcttttg tctctgtgac attggccagg agcgtcttca cctttacaga tgtccttgcc 120

gcggccactg cagacttcaa ccagaaaagc caggagacaa aagcttttgg acctccaaag 180

cagggcgctt tgcggtcaat g 201

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ctacctggga aatgtgggtg gag 23

<210> 4

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gacatctgta aaggtgaaga cgctcc 26

<210> 5

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cgacgcgtct acctgggaaa tgtgggtgga g 31

<210> 6

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tcccccgggc tcagtcgcac actggtcaat tacag 35

Claims

1. The promoter is characterized by being a promoter of a Japanese eel antibacterial peptide Cathelicidin2 gene, wherein the nucleotide sequence of the promoter is shown as SEQ ID NO: 1 is shown.

2. An expression cassette, recombinant vector, transgenic cell line, recombinant bacterium or recombinant virus comprising the promoter of claim 1.

3. The expression cassette of claim 3, wherein the expression cassette consists of the promoter of claim 1, the gene of interest whose transcription is initiated by the promoter of claim 1, and a terminator.

4. The recombinant vector of claim 3, wherein the recombinant vector is pGL3-Basic, pGL2-Basic, pGL4.10, pGLuc.

5. The recombinant bacterium according to claim 3, wherein: the recombinant bacteria are escherichia coli, bacillus subtilis, lactobacillus and saccharomycetes.

6. The application of the promoter of the Japanese eel antibacterial peptide Cathelicidin2 gene according to claim 1 in constructing eukaryotic expression vectors, fish cells or mammalian cells to efficiently express exogenous genes.

7. The application of the promoter of the Japanese eel antibacterial peptide Cathelicidin2 gene according to claim 1 in constructing transgenic fish.