CN113564169B - Japanese eel antibacterial peptide Cathelicidin2 gene promoter and application thereof - Google Patents
Japanese eel antibacterial peptide Cathelicidin2 gene promoter and application thereof Download PDFInfo
- Publication number
- CN113564169B CN113564169B CN202110942337.4A CN202110942337A CN113564169B CN 113564169 B CN113564169 B CN 113564169B CN 202110942337 A CN202110942337 A CN 202110942337A CN 113564169 B CN113564169 B CN 113564169B
- Authority
- CN
- China
- Prior art keywords
- promoter
- japanese eel
- gene
- antimicrobial peptide
- gene promoter
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/461—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from fish
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
- A01K67/027—New breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
- A01K67/0278—Humanized animals, e.g. knockin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2207/00—Modified animals
- A01K2207/15—Humanized animals
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/072—Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/40—Fish
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/01—Animal expressing industrially exogenous proteins
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention relates to a Japanese eel antibacterial peptide Cathelicidin2 gene promoter and application thereof. The invention successfully clones the gene promoter sequence of the Japanese eel antimicrobial peptide Cathelicidin2 and successfully constructs a Japanese eel antimicrobial peptide Cathelicidin2 gene promoter pGL3-Cathelicidin2-pro luciferase reporter plasmid. Experiments prove that the Japanese eel antimicrobial peptide Cathelicidin2 gene promoter can be induced and activated by important surface antigen LPS of gram negative bacteria and aeromonas hydrophila. Cloning of the Japanese eel antimicrobial peptide Cathelicidin2 gene promoter and induction expression analysis of the strong promoter activity thereof provide a good experimental system for researching the expression regulation mechanism of the Japanese eel antimicrobial peptide Cathelicidin2 gene and the natural immune response mechanism of fish against pathogenic bacteria infection, particularly the important research of the NF- κB and MAPK signal pathway network regulation mechanism related to fish inflammation, and create conditions for constructing an expression vector by using the promoter to efficiently express exogenous genes or applying the promoter to transgenic fish construction.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a Japanese eel antibacterial peptide Cathelicidin2 gene promoter and application thereof.
Background
Antibacterial peptides (antimicrobial peptides, AMPs) are a class of bioactive small molecule polypeptides, are important components of the innate immune defense system of the organism, can have better inhibition or killing effects on gram-negative bacteria, gram-positive bacteria, fungi, viruses, parasites and the like, and play an important role in natural immune response [ Chung, C.—R., J.— H.Jhong, Z.Wang, W.Chen, wan, horng and T.—Y.Lee (2020), "Characterization and Identification of Natural Antimicrobial Peptides on Different organics." International Journal of Molecular Sciences 21:986.]. Fish, like higher vertebrates such as mammals, have an innate and adaptive immune system. Antibacterial peptides, which are important components of the innate immune system of fish, are rapidly produced and spread in the body to play a defensive and killing role when the fish body is injured or affected by pathogenic microorganisms. Fish antimicrobial peptides consist essentially of Cathelicidins, liver expressed antimicrobial peptide-2 (Liverexpressed Antimicrobial Peptide, leap-2), piscidins, beta-defensins, hepcidins, and NKlysins [ Ji Zhitao, xu Yang, jun, nie Pin (2020), "aquatic animal antimicrobial peptide research progress," aquatic journal 44 (09): 1572-1583 ].
Cathelicidins are the largest family of antimicrobial peptides found at present, have broad-spectrum anti-pathogenic microorganism effects, and have good killing effects on gram-positive bacteria, gram-negative bacteria, fungi, viruses and protozoa. Studies have shown that humans have only one Cathelicidin gene, while other mammals and fish contain multiple Cathelicidin genes. Fish cathelicidins have the same structure as mammals and comprise three regions of a signal peptide (Pre region), a Pro region and a C-terminal mature peptide, but differ in the number of amino acids contained. Two antibacterial peptides, cathelicidin1 and Cathelicidin2, were currently identified in Japanese eel, rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar), and American red smolt (Salvelinus fontinalis), one antibacterial peptide of Cathelicidin2 was identified in Xiang fish (Plecoglossus altivelis) and Pimpinella Foeniculi (Thymallus thymallus), and three antibacterial peptides, cathelicidin1, cathelicidin2, and Cathelicidin3, were identified in Atlantic sturgeon (Gadus morhua) [ Zhang Dongling, guan Ruizhang (2013), "research progress on fish Cathelicidin antibacterial peptides," university of Metropolica (Natl sciences) 18 (06): 413-419 ]. However, studies on the fish antimicrobial peptide Cathelicidin2 promoter have been reported only in rainbow trout [ Zhao Zixia, xu Jian, jiang Yan, bai Qingli, jiang Likun, chen Baohua, xu Peng (2018), "analysis of the function of the rainbow trout immune inducible gene Cathelicidin2 promoter.," progress of fishery science 39 (04): 37-45 ]. The research successfully constructs a rainbow trout pGL3-Cathelicidin2 promoter luciferase expression vector, and discovers that NF- κB transcription factors can enhance the activity of the promoter, but the immune regulation mechanism of whether the luciferase expression vector is induced to be expressed by pathogenic microorganisms such as viruses, bacteria and the like is not yet reported.
Expression regulation of genes has become a hotspot in the field of molecular biology research, and promoters are important elements of gene expression regulation. In view of the importance of fish Cathelicidin2 in resisting bacterial and viral immunity and preventing and controlling diseases thereof, research on a gene expression regulation mechanism of the Cathelicidin2 provides a new thought for preventing and controlling bacterial and viral diseases of fish by regulating the expression of the Cathelicidin 2. The promoter is a key factor for determining gene expression and regulation thereof, and in order to research the expression regulation mechanism of fish Cathelicidin2 genes, we obtain possible 5' flanking regulatory region sequences of Japanese eel Cathelicidin2 genes through comparison of Japanese eel Cathelicidin2 open reading frame sequences and genome sequences, and obtain Japanese eel Cathelicidin2 gene promoter sequences through primer design PCR cloning verification, analysis shows that the promoter has reported transcription binding sites of C/EBPalp and NF-kappaB, GATA, GAAA in the Japanese eel Cathelicidin2 promoters, but lacks CREBP, MAFF, HRE transcription binding sites and exists specific transcription factor binding sites of AP1, AP-2, C-Jun, C-Fos, sp1, NF-muE, ftz, RAP1, USF, myoD and the like, and shows that the Japanese eel Cathelicidin2 gene promoter sequences are specific. The report gene detection proves that the Japanese eel Cathelicidin2 gene promoter has stronger promoter activity, and can be expressed by gram negative bacteria indicating important antigen LPS, aquatic organism important pathogenic bacteria aeromonas hydrophila and artificially synthesized double-stranded RNA polyI: C induction.
Therefore, the cloning of the Japanese eel antimicrobial peptide Cathelicidin2 gene promoter and the induced expression analysis of the strong promoter activity thereof provide a good experimental system for researching the expression regulation mechanism of the Japanese eel antimicrobial peptide Cathelicidin2 gene and the natural immune response mechanism of fish against pathogenic bacteria infection, particularly the research of important fish inflammation related NF-kappa B and MAPK signal pathway network regulation mechanism, and have important theoretical and practical significance for creating conditions for constructing expression vectors by using the promoter to efficiently express exogenous genes or applying the promoter to transgenic fish construction in application.
Disclosure of Invention
The invention aims to overcome the defects of the prior art, provides a Japanese eel antimicrobial peptide Cathelicidin2 gene promoter and application thereof, and solves the problems in the background art.
One of the technical schemes adopted for solving the technical problems is as follows: provides a Japanese eel antimicrobial peptide Cathelicidin2 gene promoter, the nucleotide sequence of which is shown in SEQ ID NO: 1.
The second technical scheme adopted by the invention for solving the technical problems is as follows: an expression cassette, recombinant vector, transgenic cell line, recombinant bacterium or recombinant virus containing the promoter is provided.
Preferably, the expression cassette is composed of the above-described promoter, a target gene whose transcription is promoted by the above-described promoter, and a terminator.
Preferably, the recombinant vector is pGL3-Basic, pGL2-Basic, pGL4.10, pGLuc.
Preferably, the recombinant bacteria are escherichia coli, bacillus subtilis, lactobacillus and saccharomycetes.
The third technical scheme adopted by the invention for solving the technical problems is as follows: provides the application of the Japanese eel antimicrobial peptide Cathelicidin2 gene promoter in constructing eukaryotic expression vectors, fish cells or mammalian cells to efficiently express exogenous genes.
The fourth technical scheme adopted for solving the technical problems is as follows: provides the application of the Japanese eel antimicrobial peptide Cathelicidin2 gene promoter in constructing transgenic fish.
The invention has the following beneficial effects: the applicant succeeds in cloning and obtaining the Japanese eel antibacterial peptide Cathelicidin2 gene promoter. According to the invention, the Japanese eel antimicrobial peptide Cathelicidin2 gene promoter sequence is obtained by comparing the first exon sequences of the open reading frames of the Japanese eel antimicrobial peptide Cathelicidin2 genes to analyze and predict the 5' flanking region sequences of the Japanese eel genome and cloning the Cathelicidin2 genes by adopting a touchdown PCR method; proved by a reporter gene analysis experiment, the Japanese eel antimicrobial peptide Cathelicidin2 gene promoter can be induced and activated by gram negative bacteria escherichia coli important surface antigen LPS and aquatic animal important pathogenic bacteria aeromonas hydrophila. Therefore, the cloning of the Japanese eel antimicrobial peptide Cathelicidin2 gene promoter and the verification of the strong promoter activity thereof theoretically provide a good experimental system for researching the expression regulation mechanism of the fish antimicrobial peptide Cathelicidin2 gene and the antibacterial infection mechanism of important fish inflammation related functional genes, particularly the research of important fish inflammation related NF- κB and MAPK signal pathway network regulation mechanism, and create conditions for constructing an expression vector to efficiently express exogenous genes or applying the promoter to the construction of transgenic fish in application, thereby having important theoretical and practical significance.
Drawings
FIG. 1 is a schematic diagram of the binding site of the promoter transcription factor of the Japanese eel antimicrobial peptide Cathelicidin2 gene.
FIG. 2 is a schematic diagram of the transcription factor binding site of the Cathelicidin2 gene promoter of the Japanese eel antibacterial peptide 2.
FIG. 3 is a schematic diagram of the transcription factor binding site of the Cathelicidin2 gene promoter of the Japanese eel antibacterial peptide, FIG. 3.
FIG. 4 is a graph showing the quantitative analysis of the activity of the promoter of the Japanese eel antimicrobial peptide Cathelicidin2 gene using a dual-luciferase reporter gene detection system.
Wherein, the abscissa pGL3 represents the relative luciferase activity of the empty vector pGL3-Basic transfected EPC cells (as a control group);
luciferase relative Activity of pGL3-Cathelicidin2-pro recombinant vector pGL3-Cathelicidin2-pro transfected EPC cells (as experimental group).
As shown in FIG. 4, the relative activity of luciferase in EPC transfected by recombinant vector pGL3-Cathelicidin2-pro is 2.1 times that of EPC transfected by empty vector pGL3-Basic, which shows that the promoter of Cathelicidin2 gene of Japanese eel can better start the transcription of luciferase reporter gene.
Three replicates were set for each experiment, each replicate being set in three parallels; error bars represent standard error of the mean. Statistical analysis of the significance differences between the experimental and control groups using the two-tailed group T-test, "x" p <0.05, "x" p <0.01.
FIG. 5 is a graph showing the change in the activity of the Cathelicidin2 gene promoter of the Japanese eel antimicrobial peptide under the stimulation of the important surface antigen LPS (30. Mu.g/mL) of Escherichia coli as a gram-negative bacterium.
Wherein, the abscissa pGL3-Basic represents the relative luciferase activity of EPC cells transfected with the empty vector pGL3-Basic (as a control group);
luciferase relative Activity of pGL3-Cathelicidin2-pro recombinant vector pGL3-Cathelicidin2-pro transfected EPC cells (as experimental group).
As shown in FIG. 5, the relative luciferase activity in EPC transfected cells transfected with 24h recombinant vector pGL3-Cathelicidin2-pro stimulated by LPS was 1.9 times that of EPC transfected with empty vector pGL3-Basic, demonstrating that the promoter of Japanese eel antimicrobial peptide Cathelicidin2 gene can be induced and activated by LPS.
Three replicates were set for each experiment, each replicate being set in three parallels; error bars represent standard error of the mean. Statistical analysis of the significance differences between the experimental and control groups using the two-tailed group T-test, "x" p <0.05, "x" p <0.01.
FIG. 6 shows the pathogenic bacteria Aeromonas hydrophila (10) 6 cfu/mL) activity change pattern of the promoter of the antibacterial peptide Cathelicidin2 gene of Japanese eel under stimulation.
Wherein, the abscissa pGL3-Basic represents the relative luciferase activity of EPC cells transfected with the empty vector pGL3-Basic (as a control group);
luciferase relative Activity of pGL3-Cathelicidin2-pro recombinant vector pGL3-Cathelicidin2-pro transfected EPC cells (as experimental group).
As shown in FIG. 6, the relative activity of luciferase in EPC transfected cells transfected with recombinant vector pGL3-Cathelicidin2-pro for 6h stimulated by Aeromonas hydrophila was 2.2 times that of EPC transfected with empty vector pGL3-Basic, demonstrating that the promoter of Japanese eel antimicrobial peptide Cathelicidin2 gene can be induced and activated by Aeromonas hydrophila.
Three replicates were set for each experiment, each replicate being set in three parallels; error bars represent standard error of the mean. Statistical analysis of the significance differences between the experimental and control groups using the two-tailed group T-test, "x" p <0.05, "x" p <0.01.
FIG. 7 is a graph showing the activity change of the promoter of the Japanese eel Cathelicidin2 gene under the stimulation of the virus mimetic artificially synthesized double-stranded RNA polyI: C (50. Mu.g/mL).
Wherein, the abscissa pGL3-Basic represents the relative luciferase activity of EPC cells transfected with the empty vector pGL3-Basic (as a control group);
luciferase relative Activity of pGL3-Cathelicidin2-pro recombinant vector pGL3-Cathelicidin2-pro transfected EPC cells (as experimental group).
As shown in FIG. 7, the luciferase relative activity in EPC transfected cells transfected with recombinant vector pGL3-Cathelicidin2-pro for 24h stimulated with poly I: C was 1.1 times that of EPC transfected with empty vector pGL3-Basic, and there was no significant difference, indicating that the Japanese eel Cathelicidin2 gene promoter could not be activated by polyI: C induction.
Three replicates were set for each experiment, each replicate being set in three parallels; error bars represent standard error of the mean. Statistical analysis of the significance differences between the experimental and control groups using the two-tailed group T-test, "x" p <0.05, "x" p <0.01.
Detailed Description
For a better understanding of the present invention, reference will now be made in detail to the following examples and accompanying drawings, which are included to provide a further understanding of the invention, and it is to be understood by those skilled in the art that the following examples are not intended to limit the scope of the invention.
The experimental methods used in the following examples are conventional methods unless otherwise specified.
Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
EXAMPLE 1 cloning of the promoter of the Cathelicidin2 Gene of the Japanese eel antibacterial peptide
1. The genomic DNA of the muscle tissue of Japanese eel was extracted and purified using TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 kit. The specific operation is as follows:
1. 10mg of Japanese eel musculature was minced with a blade and placed in a 2mL centrifuge tube, 180. Mu.L of Buffer GL, 20. Mu.L of protease K and 10. Mu.L of RNase A (10 mg/mL) were added, and the mixture was lysed overnight in a 56℃water bath.
2. 200 mu L Buffer GB and 200 mu L100% ethanol are added into the lysate, and the mixture is fully sucked and uniformly mixed. Spin Column was mounted on a Collection Tube, the solution was transferred to Spin Column, centrifuged at 12,000rpm for 2 minutes, and the filtrate was discarded.
3. mu.L of Buffer WA WAs added to Spin Column, centrifuged at 12,000rpm for 1 min, and the filtrate WAs discarded.
4. 700. Mu.L of Buffer WB (with 100% ethanol added to the indicated volume before) was added to Spin Column around the tube wall, centrifuged at 12,000rpm for 1 min and the filtrate was discarded. 700. Mu.L of Buffer WB was added again to Spin Column around the tube wall, centrifuged at 12,000rpm for 1 min and the filtrate was discarded.
5. Spin Column was mounted on a Collection Tube and centrifuged at 12,000rpm for 2 minutes. The Spin Column was placed on a new 1.5mL centrifuge tube, 150. Mu.L of sterilized water heated to 65℃was added to the center of the Spin Column membrane, and the mixture was allowed to stand at room temperature for 5 minutes. The DNA was eluted by centrifugation at 12,000rpm for 2 minutes.
6. The genomic DNA thus extracted was subjected to absorbance measurement to determine its concentration.
2. The promoter sequence of the Cathelicidin2 gene of the Japanese eel antibacterial peptide is amplified by adopting a two-round touchdown PCR method. The method comprises the following specific steps:
1. the Japanese eel genome was analyzed by comparing the first exon sequence of the open reading frame of the Japanese eel antibacterial peptide Cathelicidin2 gene (shown as SEQ ID NO: 2), and the analysis was performed to predict that the Japanese eel genome had the 5 '-flanking region sequence of the antibacterial peptide Cathelicidin2 gene, the upstream primer "5'-CTACCTGGGAAATGTGGGTGGAG-3'(shown as SEQ ID NO: 3)" was the 5' -flanking region sequence of the antibacterial peptide Cathelicidin2 gene, and the downstream primer "5'-GACATCTGTAAAGGTGAAGACGCTCC-3' (shown as SEQ ID NO: 4)" was the first exon sequence of the open reading frame of the antibacterial peptide Cathelicidin2 gene, which was synthesized by Shanghai bioengineering company.
2. The first round of PCR uses Takara high-fidelity enzymeGC Buffer(Mg 2+ plus), the reaction system: 2X PrimeSTAR HS DNA Polymerase 12.5.5. Mu.L, upstream primer 0.5. Mu.L, downstream primer 0.5. Mu. L, gDNA 0.5.5. Mu.L, sterilized water 11. Mu.L; the touchdown PCR reaction procedure was 95℃for 5min;95 ℃ for 30s,60 ℃ for 30s,72 ℃ for 4min,4 cycles; 95 ℃ for 30s,58 ℃ for 30s,72 ℃ for 4min,4 cycles; 95 ℃ for 30s,56 ℃ for 30s,72 ℃ for 4min,30 cycles; 72 ℃ for 10min; 5min at 4 ℃.
3. The second PCR was performed using Takara 10 XEx Taq Buffer (Mg 2+ plus), the reaction system: ex Taq 0.13. Mu.L, 10 XEx Taq Buffer (Mg2+plus) 2.5. Mu.L, dNTP mix (2.5 mM each) 2. Mu.L, upstream primer 0.5. Mu.L, downstream primer 0.5. Mu.L, first round PCR product 0.5. Mu.L, sterile water 18.87. Mu.L; the touchdown PCR reaction procedure was 95℃for 5min;95 ℃ for 30s,60 ℃ for 30s,72 ℃ for 4min,4 cycles; 95 ℃ for 30s,58 ℃ for 30s,72 ℃ for 4min,4 cycles; 95 ℃ for 30s,56 ℃ for 30s,72 ℃ for 4min,30 cycles; 72 ℃ for 10min; 5min at 4 ℃.
4. The PCR product obtained by the second round of PCR amplification is connected to a pMD19T-Simple vector of TaKaRa company for sequence determination and analysis, thereby obtaining the pMD19T-Cathelicidin2-pro recombinant plasmid containing the Cathelicidin2 gene promoter sequence of the Japanese eel antibacterial peptide.
The nucleotide sequence of the Japanese eel antimicrobial peptide Cathelicidin2 gene promoter is shown in SEQ ID NO:1 is shown as follows:
the first exon sequence of the open reading frame of the Cathelicidin2 gene of the Japanese eel antibacterial peptide is shown in SEQ ID NO:2 is shown in the figure
ATGAGAAGTGAGACACATAAGATGAAGAGCTCTGTTGGACCTCTGCTGCTGCTCTCCCTTGTTGCTTTTGTCTCTGTGACATTGGCCAGGAGCGTCTTCACCTTTACAGATGTCCTTGCCGCGGCCACTGCAGACTTCAACCAGAAAAGCCAGGAGACAAAAGCTTTTGGACCTCCAAAGCAGGGCGCTTTGCGGTCAATG
EXAMPLE 2 prediction of the transcription factor binding site of the antimicrobial peptide Cathelicidin2 Gene promoter from Japanese eel
On-line prediction software of the transcription factor binding site of the 5' -flanking region of the Internet login gene, namely Alibaba2 (http:// gene-regulation.com/pub/programs/Alibaba 2/index.html), copies the promoter sequence of the Cathelicidin2 gene of the antimicrobial peptide obtained through cloning test verification, then pastes the copied promoter sequence in a dialog box in a fasta format, and clicks START to perform prediction analysis of the transcription factor binding site. The results are shown in FIGS. 1 to 3:
the main transcription factor binding site of the Japanese eel antimicrobial peptide Cathelicidin2 gene promoter is as follows:
EXAMPLE 3 analysis of Activity of the promoter of the antibacterial peptide Cathelicidin2 gene of Japanese eel
1. Construction of recombinant luciferase reporter vector pGL3-Cathelicidin2-pro containing the promoter fragment of the Japanese eel antibacterial peptide Cathelicidin2 gene.
1. The recombinant vector constructed by inserting the Japanese eel antimicrobial peptide Cathelicidin2 gene promoter fragment into the Luciferase reporter gene vector pGL3-Basic of Promega company, so that the expression of firefly Luciferase (Luciferase) reporter gene is controlled by the Japanese eel antimicrobial peptide Cathelicidin2 gene promoter, is named pGL3-Cathelicidin2-pro. The method comprises the following specific steps:
the upstream primer with MluI cleavage site was synthesized:
5'-CGACGCGTCTACCTGGGAAATGTGGGTGGAG-3' (SEQ ID NO: 5),
downstream primer with SmaI cleavage site:
5'-TCCCCCGGGCTCAGTCGCACACTGGTCAATTACAG-3' (SEQ ID NO: 6). Adopts Takara high-fidelity enzymeGC Buffer(Mg 2+ plus), the reaction system: 2 XPimeSTAR HS DNA polymerase 12.5. Mu.L, upstream primer 0.5. Mu.L, downstream primer 0.5. Mu. L, pMD19T-Cathelicidin2-pro recombinant plasmid 0.5. Mu.L, sterilized water 11. Mu.L; the touchdown PCR reaction procedure was 95℃for 5min;95 ℃ for 30s,60 ℃ for 30s,72 ℃ for 4min,4 cycles; 95 ℃ for 30s,58 ℃ for 30s,72 ℃ for 4min,4 cycles; 95 ℃ for 30s,56 ℃ for 30s,72 ℃ for 4min,30 cycles; 72 ℃ for 10min; 5min at 4 ℃. PCR product recovery was performed using Omega gel recovery kit.
2. The recovered PCR product and the vector pGL3-Basic were subjected to MluI/SmaI double cleavage (Thermo Scientific Fermentas Fast Digest), respectively.
A total of 40. Mu.L of the double cleavage reaction system, including 4. Mu.L of 10X FastDigest Green Buffer, 2. Mu.L each of the enzyme MluI and the enzyme SmaI, 1.5. Mu.g each of the vector/PCR product, was added with sterilized water to 40. Mu.L.
The system is evenly mixed in a PCR tube and then subjected to enzyme digestion reaction, and the reaction procedure is as follows: 37 ℃ for 60min;80 ℃ for 20min;4 ℃ for 5min.
The above double-digested PCR product and the vector pGL3-Basic were recovered by using the Omega gel recovery kit, respectively, and the double-digested PCR product and the vector pGL3-Basic were ligated with Takara T4 ligase in a ligation reaction system of 20. Mu.L, including 2. Mu.L 10 XT 4 Buffer, 1. Mu.LT 4 DNA ligase, 40ng of double-digested vector pGL3-Basic,300ng of double-digested PCR product, sterilized water to 20. Mu.L, and the above systems were mixed in a PCR tube and ligated overnight at 16 ℃.
3. E.coli DH5 alpha competent cells are transformed by the above connection product, positive clones are screened by colony PCR, plasmids are extracted by using a small amount of endotoxin-free plasmid kit of Omega company, and the accuracy of insertion of promoter fragments is confirmed by sequencing, so that a recombinant luciferase reporter gene vector pGL3-Cathelicidin2-pro containing the promoter fragments of the antibacterial peptide Cathelicidin2 gene of Japanese eel is obtained.
2. The basic activity of the promoter of the Japanese eel antibacterial peptide Cathelicidin2 gene is analyzed by adopting a double-luciferase reporter gene detection system.
1. The EPC cells with better status were seeded into 48-well cell plates (1X 10) 5 And (3) adding an L15 culture medium (the L15 basal medium contains 10% Gibco Australian foetus calf serum), transferring into a constant temperature incubator at 28 ℃ for overnight culture, attaching the culture medium to a logarithmic phase, and carrying out transfection experiments when the attaching amount reaches about 80%. Cell culture medium was changed 2h before transfection.
For transfection, a transfection Reagent dilution was prepared with 0.5. Mu.L of Lipofectamine 3000Reagent transfection Reagent per well and 20. Mu.L of Opti-MEM low serum medium, and incubated at room temperature for 5min after mixing. Then 20 mu L of Opti-MEM low serum culture medium per well is fully mixed with the plasmids required per well, wherein a control group contains 20ng of Renilla luciferase reference reporter vector pRL-TK and 300ng of luciferase reporter vector pGL3-Basic vector, an experimental group contains 20ng of Renilla luciferase reference reporter vector pRL-TK and 300ng of recombinant luciferase reporter vector pGL3-Cathelicidin2-pro, and then 0.5 mu L P3000 is added TM And (5) mixing the reagents uniformly. The prepared plasmid diluent is dropwise added into the transfection reagent diluent,mixing to obtain transfection complex solution, incubating at room temperature for 15min, slowly adding EPC cell culture hole, and culturing in a constant temperature incubator (28deg.C).
2.24h later, collecting transfected cells, respectively reading enzyme activity values of firefly luciferase and Renilla luciferase by using a double luciferase reporter gene detection system, and calculating the ratio of the enzyme activity values of the firefly luciferase and Renilla luciferase to obtain the relative activity of the luciferase in the transfected cells. The method for measuring the luciferase activity is carried out by referring to the instruction book of a dual-luciferase reporter gene detection system of Promega company, and comprises the following specific steps:
(1) Preparing reagents required by experiments: 1 XPLB lysate: 1 volume of 5X Passive Lysis Buffer is added with 4 volumes of double distilled water to be evenly mixed and prepared; start reagent (LAR i): completely dissolving Luciferase Assay Substrate powder in 10mL Luciferase Assay Buffer II solution, subpackaging with 1.5mL centrifuge tube, and storing in refrigerator at-80deg.C; stop reagent: 1 volume of 50X Stop was used as the experimental amount&Substrate uses 49 volumes of Stop&/> Buffer dilution.
(2) Cell culture medium in 48 well cell culture plates was slowly aspirated and 65. Mu.L of 1 XPLB lysate was added to each well.
(3) The 48-well cell culture plate was placed on a cell shaker and lysed by shaking for 15min.
(3) The lysed cell fluid was transferred to a 1.5mL centrifuge tube and centrifuged (13000 rpm,4 ℃,10 min).
(4) The supernatant after centrifugation was taken in 3. Mu.L in a 1.5mL centrifuge tube having good light transmittance.
(5) 10. Mu.L of Start reagent was added and the firefly luciferase activity value in the sample was measured using a GloMax 20/20 luminescence detector. Then 10 mu L Stop reagent is added to detect the luciferase activity value of the sea cucumber in the sample. The ratio of the two activities is the relative activity of luciferase of each sample.
The relative activities of pGL3-Cathelicidin2-pro promoter were calculated using EPC cells co-transfected with empty vector pGL3-Basic and pRL-TK as control (FIG. 4).
As shown in FIG. 4, the relative activity of luciferase in EPC transfected by recombinant vector pGL3-Cathelicidin2-pro is 2.1 times that of EPC transfected by empty vector pGL3-Basic, which shows that the promoter of Cathelicidin2 gene of Japanese eel can better start the transcription of luciferase reporter gene.
3. Immunostimulatory experiments
EPC cells were co-transfected with pGL3-Basic and Japanese eel antimicrobial peptide Cathelicidin2 gene promoter recombinant vector pGL3-Cathelicidin2-pro and Renilla luciferase reference reporter gene vector pRL-TK, respectively, 12 hours after transfection, LPS (30. Mu.g/mL), poly I: C (50. Mu.g/mL) and Aeromonas hydrophila (10) were added to the cell culture solution, respectively 6 cfu/mL), transfected cells were collected for luciferase relative activity assays after 12h, and 6h of stimulation, respectively.
The change in activity of the promoter of the Cathelicidin2 gene of the Japanese eel antibacterial peptide under LPS (30. Mu.g/mL) stimulation is shown in FIG. 5.
As shown in FIG. 5, the recombinant vector pGL3-Cathelicidin2-pro transfected EPC cells had a luciferase relative activity 1.9 times that of the empty vector pGL3-Basic transfected EPC cells, indicating that the Japanese eel antibacterial peptide Cathelicidin2 gene promoter could be induced to activate by LPS, "x" p <0.05, "x" p <0.01.
In aeromonas (10) 6 cfu/mL) of the activity change of the promoter of the Cathelicidin2 gene of the Japanese eel antibacterial peptide under the stimulation condition is shown in FIG. 6.
As shown in FIG. 6, the relative luciferase activity in pGL3-Cathelicidin2-pro transfected EPC cells was 2.2 times that of empty vector pGL3-Basic transfected EPC cells, indicating that the Japanese eel Cathelicidin2 gene promoter could be induced to activate by Aeromonas hydrophila, "x" p <0.05, "x" p <0.01.
The change in activity of the promoter of the Japanese eel antimicrobial peptide Cathelicidin2 gene under stimulation of poly I: C (50. Mu.g/mL) is shown in FIG. 7.
As shown in FIG. 7, the relative luciferase activity of recombinant vector pGL3-Cathelicidin2-pro transfected EPC cells was 1.1 times that of empty vector pGL3-Basic transfected EPC cells, and no significant difference was observed, indicating that the Japanese eel antimicrobial peptide Cathelicidin2 gene promoter could not be induced to activate by polyI: C.
While specific embodiments of the invention have been described above, it will be appreciated by those skilled in the art that the specific embodiments described are illustrative only and not intended to limit the scope of the invention, and that equivalent modifications and variations of the invention in light of the spirit of the invention will be covered by the claims of the present invention.
Sequence listing
<110> university of beauty set
<120> a Japanese eel antibacterial peptide cathelicidin2 gene promoter and application thereof
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 3524
<212> DNA
<213> Anguilla japonica
<400> 1
ctacctggga aatgtgggtg gagtttaggg acaaaacgac tgtgtgtttt tttttttttt 60
ttttttttaa gctgtgaatg gagctggaga gtgaaaagtg tctaggggcg tagagaagac 120
gagtttacga aagttgcttt ggttttgcaa ggtgtggttg tgaccgacga cagccgtaat 180
aaatacacaa atcgtgtaaa ctgtatcgga tactctttaa tagtagcgga cgctacagta 240
taaagtggta tctgaggagt ggaaaaatta ggcttgtcaa atttaaaatg gaattatacg 300
tctacattgt aatagaagaa ttgttaaaaa tgacattttt atatctgaac tattaggtct 360
cccagtaaat ctaacatagc ctacacttta cgcattttgc tatttgtaat atttgaacgt 420
aaatctaccc tctaggctac ctgtgagggt ggggaagtgt taacgaccac acgcaactat 480
agtgaattca agagtgtttc ttcaagttaa ccaccaaagt ggaaaccact gggtctcagt 540
aagagacgta aggagggagt aacgaaaaga aatgactcga ctcctaagga agaatatccc 600
aacacgaagt gaacgtctca gcaggcgaac gaaactaaaa cgtaaggagg gagtagaaat 660
ttagtaaaga ctgcagtaca gtctggagaa aagcaaaaga aaaggtgcct cgtaacgaga 720
aaggcaaaaa aaatacgtat taaggaaaat aaggaataaa gctaagtgac tagcaggacc 780
gaaatcttac tactagtcaa aataaaacgc tatattcaaa atcctatacc tttttcctta 840
ccacttttct ctaagagagc ttttcactgt taccggcttt cgtgaaacgt gagtagacac 900
taagcgaaga acagagctca cgtgagcgta tataagctct ctcaatcagg tgcaaacaat 960
cggacgtaat caaaagcaat cacagagcgc cctcaggcgg tcctgaagat taccacactc 1020
ggttacctga aacaccactc cgtttcctcg acagggacac tgagtagccg attagcacta 1080
aatggggtcg attagcacaa cccacgaggc cgcacagcaa acggaataac acccgttcct 1140
gacatacagc gacgcgagcg agcgagcgag cgagcaggaa aaagttgaga accactgatc 1200
tacacaatac gccataataa caaagcgaaa acacattttt agaaaatttt gcaaatttat 1260
tgaaaataaa aaactgatat ctgatttaca taactattca ccccctttgc tgtgacgcct 1320
taaaataagc tcagatgcat ccgatttctc tgagagatca cactaaagct taaatgtgtg 1380
atcacctgtg ttaaactgta gtgattctga ttatttcaga ataaaatcag ccgttcctga 1440
gtataaaagg aggcaacaca cataagaaac caatttttta tactggaagt tccattttca 1500
tcccagcctg gcctccttgg gaagggggca gggattattc tttttttaaa atgtcttggt 1560
aagtactggt gttcatgcca tctgtcttaa aaggacctcc gggaccagca gacacaaaac 1620
aaatccaaac aaaaaagacc accagccata tttcagtcta ggcatgggcc tatttcaaca 1680
tcgtcgatgt ccctggccag tgtgggagaa atgtgaccat gtgcacagcc attggtcacc 1740
gtgaggtcat ccatcaccat gcccaacttg gtccctacaa cactgctaac caggaagagg 1800
gaccagagca gcccaactac attggcattt agggtaatgt aagtttccac cgggctgctc 1860
tggtccacaa ctggttcgct aacaacccac atttttcagt tctctacctc tcaccatatt 1920
ccccatttct aaatccgatc gaagaattcc tttcagcatg gcggtggaag gtatatgacc 1980
gcaatcccca cgagcatgtg gccctactcc aggcaatgga ggaggcgtgt gacgacatcc 2040
acgcagacgc atgccagggg tggatccgcc atgccagccg ctttttcccc cgctgcttgg 2100
ccagggagaa catcgcatgc gatattttaa gtttctttaa gaaaaaaaca tcattttggg 2160
catgtattca tgagtttact tttccaagtc accaacatgc aatagtgcag gcttgtaaac 2220
tgctggaaaa agacatcaat taaaaaaata tgtcaatgta gtgttacatc agcattcaaa 2280
attgacttta ttcacaaaaa aacattcaga tacgtatttt aaatcgatcg cttaaagatt 2340
tgtacatgag ggcaagattt gaccacctat gagttaatgt gaataccttt aggtaatatt 2400
aaccttggta acctggcttc agtgctagct ggaaaggtcc gatttgtaat tttccctttg 2460
aaaacaactg cttgattgat gccagatgag catttggatg cgttcccgag gagtttccca 2520
atgacaacat gcacaatagt tacaggaaac acagcaggaa ggtagaacgg actgtgctgc 2580
cctgtgcaaa acaccggggc ctcagcagga agggagaagg aggagcaaaa taataataat 2640
aaacaaatta aataaatgca tgcagtattt gtatgaaacc ataacattgg attttttgcc 2700
ctttattccc tgtcagaggg aattttaaaa aaaatcattc agcaccaccc tttcacctgc 2760
aagcattctc taaaatggaa acatgttttt tttatttttt tatttattta cccagggtag 2820
gttcgctgag caaggatgct cttttgcagg aacgccctgc atcacactca tacacattca 2880
cacctgggag ctgcccagta caaccacaat cctctattgt tggccactgg tcagctccac 2940
tggtgggaga gaacttttat tagccaatta aatcagggga tgattaggtg gcaagttttc 3000
ggagagccag atctgggatt ttagccagga catcggggaa ccccctactc tttgcgaata 3060
gtgtcatggg atctttatga ccacttaatg ctgtattaaa acagcattaa gatatgactt 3120
ataatggcca ctattgtaaa atatagcctg ttttttaaat actgtaaaaa atactgtatc 3180
catgcgtata ttcatttcca agtattatta cttcattata gctacatgga aacacaaggt 3240
gtactttgga cttgtggact tatttacaca gccctgattt tttcttgtgt acttccaagt 3300
ggaaaagcca ggattgcact catgatgtag tgtttgtact ggaagtcggc agaaactttc 3360
cagaatactg cgaaactgac agttttacga tatagtgata cctttctgac atgatgggcg 3420
tagatagtcc caagggggcc atgtggagtt gcttaatctt agtgttcacc tgcaccttta 3480
aaaagctcag accccatgct gtaattgacc agtgtgcgac tgag 3524
<210> 2
<211> 201
<212> DNA
<213> Anguilla japonica
<400> 2
atgagaagtg agacacataa gatgaagagc tctgttggac ctctgctgct gctctccctt 60
gttgcttttg tctctgtgac attggccagg agcgtcttca cctttacaga tgtccttgcc 120
gcggccactg cagacttcaa ccagaaaagc caggagacaa aagcttttgg acctccaaag 180
cagggcgctt tgcggtcaat g 201
<210> 3
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
ctacctggga aatgtgggtg gag 23
<210> 4
<211> 26
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
gacatctgta aaggtgaaga cgctcc 26
<210> 5
<211> 31
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
cgacgcgtct acctgggaaa tgtgggtgga g 31
<210> 6
<211> 35
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
tcccccgggc tcagtcgcac actggtcaat tacag 35
Claims (7)
1. The Japanese eel antibacterial peptide Cathelicidin2 gene promoter is characterized in that the nucleotide sequence of the promoter is shown in SEQ ID NO: 1.
2. An expression cassette, recombinant vector, transgenic cell line, recombinant bacterium or recombinant virus comprising the promoter of claim 1.
3. The expression cassette of claim 2, consisting of the promoter of claim 1, a gene of interest transcribed from the promoter of claim 1, and a terminator.
4. The recombinant vector according to claim 2, wherein the recombinant vector is pGL3-Basic, pGL2-Basic, pGL4.10, pGLuc.
5. The recombinant bacterium according to claim 2, wherein: the recombinant bacteria are escherichia coli, bacillus subtilis, lactobacillus and saccharomycetes.
6. The use of the Cathelicidin2 gene promoter of the antibacterial peptide Japanese eel according to claim 1 for the construction of eukaryotic expression vectors, fish cells or mammalian cells for the efficient expression of exogenous genes.
7. Use of the promoter of Cathelicidin2 gene, an antibacterial peptide of Japanese eel according to claim 1, in the construction of transgenic fish.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110942337.4A CN113564169B (en) | 2021-08-17 | 2021-08-17 | Japanese eel antibacterial peptide Cathelicidin2 gene promoter and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110942337.4A CN113564169B (en) | 2021-08-17 | 2021-08-17 | Japanese eel antibacterial peptide Cathelicidin2 gene promoter and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113564169A CN113564169A (en) | 2021-10-29 |
| CN113564169B true CN113564169B (en) | 2023-07-18 |
Family
ID=78171968
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110942337.4A Active CN113564169B (en) | 2021-08-17 | 2021-08-17 | Japanese eel antibacterial peptide Cathelicidin2 gene promoter and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113564169B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2020007259A (en) * | 2018-07-06 | 2020-01-16 | 花王株式会社 | Antimicrobial peptide expression promoter |
| CN113088522A (en) * | 2021-04-29 | 2021-07-09 | 集美大学 | Japanese eel transcription factor c-Rel gene promoter and application thereof |
-
2021
- 2021-08-17 CN CN202110942337.4A patent/CN113564169B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2020007259A (en) * | 2018-07-06 | 2020-01-16 | 花王株式会社 | Antimicrobial peptide expression promoter |
| CN113088522A (en) * | 2021-04-29 | 2021-07-09 | 集美大学 | Japanese eel transcription factor c-Rel gene promoter and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| Avian host defense cathelicidins: structure, expression, biological functions, and potential therapeutic applications;Yingjie Wang等;Poultry Science;第99卷;第6434-6445页 * |
| XM_035402946.1;GenBank;GenBank;全文 * |
| 日本鳗鲡I型Cathelicidin基因的克隆与原核表达;张东玲等;生物技术通报;第31卷(第7期);第124-131页 * |
| 虹鳟免疫诱导型基因Cathelicidin2启动子功能分析;赵紫霞等;渔业科学进展;第39卷(第4期);第37-45页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113564169A (en) | 2021-10-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ming et al. | Molecular cloning and expression of two HSP70 genes in the Wuchang bream (Megalobrama amblycephala Yih) | |
| Barksdale et al. | Cathelicidin antimicrobial peptide from Alligator mississippiensis has antibacterial activity against multi-drug resistant Acinetobacter baumanii and Klebsiella pneumoniae | |
| Weatherspoon-Griffin et al. | The CpxR/CpxA two-component system up-regulates two Tat-dependent peptidoglycan amidases to confer bacterial resistance to antimicrobial peptide | |
| Wang et al. | Cloning and characterization of a novel C-type lectin from Zhikong scallop Chlamys farreri | |
| Zhou et al. | Expression of HSP60 and HSP70 in white shrimp, Litopenaeus vannamei in response to bacterial challenge | |
| Zhang et al. | The Drosophila homolog of mammalian zinc finger factor MTF-1 activates transcription in response to heavy metals | |
| Niere et al. | Insect immune activation by recombinant Galleria mellonella apolipophorin III | |
| Zhao et al. | Antimicrobial activity-specific to Gram-negative bacteria and immune modulation-mediated NF-κB and Sp1 of a medaka β-defensin | |
| Park et al. | TmToll-7 plays a crucial role in innate immune responses against Gram-negative bacteria by regulating 5 AMP genes in Tenebrio molitor | |
| Altincicek et al. | Analysis of the immune-inducible transcriptome from microbial stress resistant, rat-tailed maggots of the drone fly Eristalis tenax | |
| Singh et al. | Microbial population dynamics in the hemolymph of Manduca sexta infected with Xenorhabdus nematophila and the entomopathogenic nematode Steinernema carpocapsae | |
| US20150376627A1 (en) | Inducible Expression System Transcription Modulators Comprising A Distributed Protein Transduction Domain And Methods For Using The Same | |
| Buonocore et al. | Identification, molecular characterization and functional analysis of interleukin (IL)-2 and IL-2like (IL-2L) cytokines in sea bass (Dicentrarchus labrax L.) | |
| Qu et al. | A novel molluscan Fos gene with immune defense function identified in the Hong Kong oyster, Crassostrea hongkongensis | |
| CN113088522B (en) | Japanese eel transcription factor c-Rel gene promoter and application thereof | |
| CN113234723B (en) | Japanese eel cytokine IL-6 gene promoter and application thereof | |
| Cheng et al. | Expression and characterization of the JAK kinase and STAT protein from brine shrimp, Artemia franciscana | |
| Qu et al. | The first molluscan acute phase serum amyloid A (A-SAA) identified from oyster Crassostrea hongkongensis: molecular cloning and functional characterization | |
| Lv et al. | TRAF3 of blunt snout bream participates in host innate immune response to pathogenic bacteria via NF-κB signaling pathway | |
| Chi et al. | Molecular characterizations and functional assessments of GATA-3 and its splice variant in Atlantic cod (Gadus morhua L.) | |
| CN110747199B (en) | Bee stress-resistance related gene NF-Y and application thereof | |
| CN113564169B (en) | Japanese eel antibacterial peptide Cathelicidin2 gene promoter and application thereof | |
| CN113201541B (en) | Japanese eel transcription factor AP-1 gene promoter and application thereof | |
| CN113717974B (en) | Japanese eel antibacterial peptide Cathelicidin1 gene promoter and application thereof | |
| CN108998455B (en) | Bombyx mori nuclear polyhedrosis virus inducible 39K promoter, recombinant vector and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |