CN113564093A - Escherichia coli and application thereof in high-yield preparation of D-proline - Google Patents
Escherichia coli and application thereof in high-yield preparation of D-proline Download PDFInfo
- Publication number
- CN113564093A CN113564093A CN202111143731.8A CN202111143731A CN113564093A CN 113564093 A CN113564093 A CN 113564093A CN 202111143731 A CN202111143731 A CN 202111143731A CN 113564093 A CN113564093 A CN 113564093A
- Authority
- CN
- China
- Prior art keywords
- proline
- fermentation
- escherichia coli
- glucose
- culture
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- C07K14/245—Escherichia (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/24—Proline; Hydroxyproline; Histidine
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The method screens and separates out Escherichia coli capable of metabolizing glucose to synthesize D-proline from a microbial population in a water environment, carries out continuous iterative breeding to obtain an Escherichia coli TIMDP capable of producing a small amount of D-proline, and further carries out genetic modification for enhancing the synthesis capacity of the D-proline to engineer a strain Escherichia coli TIMDP 1. The strain is preserved in China center for type microbiological culture Collection (CCTCC) at 8 months and 13 days in 2021, and the preservation number is CCTCC NO: m20211024. Experiments prove that the synthetic capacity of the proline of the modified escherichia coli TIMDP1 is greatly enhanced, and the application value is high.
Description
Technical Field
The invention relates to the technical field of biology, in particular to escherichia coli capable of producing D-proline, a method for producing D-proline by using the strain through fermentation and application of the escherichia coli.
Background
D-proline is an important unnatural amino acid, and the structural formula of the D-proline is shown as follows:
d-proline is a precursor of various bioactive compounds, can be used for synthesizing medicaments such as serum amyloid P component consuming agents, antineoplastic innovative medicaments such as pyrroltinib and migraine medicaments such as eletriptan and can also be used as a basic structural unit of antibacterial peptide. In addition, they are also frequently used as organic catalysts for asymmetric synthesis because they possess good conformational rigidity. For example, proline in D-form may be used to catalyze the cross aldol condensation reaction to give products of different conformations.
The existing D-proline is mainly synthesized by a chemical method, and is prepared by multi-step processes such as racemic proline synthesis, tartaric acid resolution and the like, so that the chemical method has complicated steps and pollutes the environment in industrial production. Therefore, the development of a more environment-friendly asymmetric synthesis method of D-proline has important application value.
Some attempts have also been made by biologists to synthesize chiral D-proline. With racemic proline as a substrate, L-proline was eliminated using Candida having chiral selectivity (JP 95-289275) or Bacillus lysimachiae xylolyticus (CN 111424060A), thereby obtaining the remaining D-proline. However, the theoretical yield of D-proline in the method of dynamic resolution is only 50% at most, which causes a great deal of waste.
Therefore, there is a need to further develop a method for efficiently producing D-proline.
Disclosure of Invention
Aiming at the defects of the prior art, the invention provides escherichia coli with high yield of D-proline and an application method for producing D-proline by fermentation of the escherichia coli.
The present invention first provides Escherichia coli strain (Escherichia coli) The strain TIMDP1, which has been preserved in China center for type microbiological Collection (Wuhan university No. 299 eight roads in Wuchang district, Wuhan city, Hubei province) at 8 months and 13 days in 2021, with the preservation number of CCTCC NO: m20211024.
The Escherichia coli of the present invention can be used for producing D-proline, and thus the present invention provides the use of the Escherichia coli for producing D-proline.
The invention further provides a method for preparing D-proline by using the Escherichia coli TIMDP1, which is characterized by comprising the following steps: the E.coli TIMDP1 was cultured by fermentation and D-proline was obtained from the fermentation broth.
Wherein the fermentation medium takes glucose as a carbon source and takes ammonium sulfate as a nitrogen source, and more preferably, the addition amount of the glucose in the fermentation medium is 2-6% (w/v); the addition amount of the ammonium sulfate is 1-3%.
In a preferred embodiment, the medium formulation used for the liquid fermentation culture is: the formula of the culture medium for fermentation culture is as follows: k2HPO4 12-16g，KH2PO4 4-8g，MgSO4·7H2O 100-300mg，(NH4) 2SO4 12-28g，MnSO4 1-3 mg，Fe2 (SO4)3 20-40 mg，ZnCl2 3-10 mg，CaCl2100-200 mg, glucose 20-60 g, H2O1L. More preferably, the formula of the culture medium used for the liquid fermentation culture is as follows: k2HPO4 14 g，KH2PO4 6 g，MgSO4·7H2O 200 mg，(NH4) 2SO4 20 g，MnSO4 1 .7 mg，Fe2 (SO4)3 25 mg，ZnCl2 7 mg , CaCl2140 mg, glucose 25 g, H2O 1L。
In a preferred embodiment, the fermentation culture is in a fermentor with a culture temperature of 30-37 ℃ and a rotation speed of 800-. More preferably, the fermentation culture is carried out at a culture temperature of 30 ℃ and a rotation speed of 1000 rpm.
The applicant screens and separates escherichia coli capable of metabolizing glucose to synthesize D-proline from a microbial population in a water environment, carries out continuous iterative breeding to obtain an escherichia coli TIMDP capable of producing a small amount of D-proline, and further carries out genetic modification for enhancing the synthesis capacity of the D-proline to engineer a strain escherichia coli TIMDP 1. Experiments prove that the synthetic capacity of the modified escherichia coli TIMDP 1D-proline is greatly enhanced, and the application value is high.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.
Example 1 construction of E.coli engineered Strain with high yield of D-proline
The inventor selects and separates out Escherichia coli capable of metabolizing glucose to synthesize D-proline and carries out continuous iterative breeding by collecting microbial populations in a water environment, conventionally separating and culturing 120 Escherichia coli colonies and detecting metabolites through a chromatography method, so as to obtain an Escherichia coli TIMDP capable of producing a small amount of D-proline (specific experimental data are shown in subsequent embodiments, and experimental processes and experimental results for producing D-proline are not repeatedly provided).
Through metabolic flux analysis, the biosynthesis pathway of D-proline is generated after glucose enters tricarboxylic acid cycle through glycolysis pathway to generate glutamic acid and then continues to carry out metabolic reaction. Therefore, after the glutamic acid metabolic pathway is strengthened by taking the escherichia coli TIMDP as an original strain, the modified strain has stronger D-proline generating capacity. Specifically, proBA (ptrc promoter) is integrated at the position of yghX and trpR, and the strain modification construction method specifically comprises the following steps:
construction of (I) ptrc99-proBA (ptrc promoter)
The sequences of proB Genbank (BA77911.2) and proA Genbank (BAA77912.2) are found at a website UniProtKB (https:// www. uniprot. org /) (proB is at the upstream of proA, a linker is added in the middle of proA, the sequence is GGAGCAGGCTG), the sequences are integrated behind a universal plasmid ptrc99 Lac operator through molecular cloning operation to obtain a complete self-ptrc 99-proBA plasmid, then the plasmid is used as a template for amplification to obtain a constitutive plasmid ptrc99-proBA eliminating the Lac operon, and the sequence from a promoter to a terminator is amplified by using the plasmid as a template.
The primer information used was as follows:
elimination of primer information for Lac operon:
Lac-F：ttgtgagcggataacaatttcacacaggaaacagacca；
Lac-R：attgttatccgctcacaat tccacacat tatacgagccgg。
PCR conditions were as follows: 3 min at 98 ℃, 30 s at 55 ℃, 3 min at 72 ℃, 25cycle, 5min at 72 ℃ and 4 ℃. Then Gbis is connected to obtain a constitutive plasmid ptrc 99-proBA.
The sequence primer information for amplifying the promoter to terminator is as follows:
ptrc-proBA-F：gccgacatcataacggttctggcaaatattctga；
ptrc-proBA-R：tcaggctgaaaatcttctctcatccgccaaaac。
PCR conditions of 98 deg.C for 3 min,98 deg.C for 30 s, 55 deg.C for 30 s,72 deg.C for 3 min, 25cycle,72 deg.C for 5min, and 4 deg.C for storage.
(II) construction of the yghX targeting fragment (yghX-up-proBA-down)
Opening from NCBI public databaseE. coliAnd (3) searching a genome, searching and marking a yghX sequence, finding an upstream and downstream homologous arm sequence (about 650p) of the yghX, introducing the sequence into both ends of a target gene (ptrc-proBA), and designing a primer. The primer information is as follows:
yghX-up-F：TTATTCCGTTGCGAAGACCTGGCAT
yghX-up-R：TAGGTTTATCTCTTACGGGATTACGTC
ptre99-proBA-F：CCCGTAAGAGATAAACCTAtggcaaatattctgaaatgagc
ptre99-proBA-R：AGTAATCCAGCAACTCTTGTGGGAAATCTTTGGCGGT
yghX-down-F：AGTAATCCAGCAACTCTTGTGGGAAATCTTTGGCGGT
yghX-down-R：TCGGCGTATTTTCATCGACGCGATGAGA。
tre-proBA PCR conditions: 3 min at 98 ℃, 30 s at 55 ℃, 3 min at 72 ℃, 25cycle, 5min at 72 ℃ and 4 ℃.
yhx-upPCR conditions 98 deg.C 3 min,98 deg.C 30 s, 55 deg.C 30 s,72 deg.C 1 min, 25 cycles, 72 deg.C 5min, 4 deg.C storage.
The yghsx-down PCR conditions are 98 ℃ for 3 min,98 ℃ for 30 s, 55 ℃ for 30 s,72 ℃ for 1 min, 25 cycles, 72 ℃ for 5min, and 4 ℃ storage.
After upstream and downstream fragments up, down and ptrc99-proBA (T1DNA) of yghX are amplified by PCR, the three fragments are taken as templates and put in the same system for PCR amplification again. An amplification system (50 muL);
template: yghX-up 1 mu L
ptrc99-proBA 1µL
yghX-down 1µL
Primer of yghX-up-F: 1 mu L
yghX-down 1µL
DDH2O: 2oµL
Enzyme primer star 25 mu L
PCR conditions were as follows: 3 min at 98 ℃, 30 s at 55 ℃, 4 min at 72 ℃, 25cycle, 5min at 72 ℃ and 4 ℃ for storage.
(III) construction of TrpR targeting fragment (TrpR-up-proBA-down)
Opening from NCBI public databaseE. coliGenome, searching the sequence and marking, finding the upstream and downstream homologous arm sequence (about 650p) of trpR, introducing the two ends of the target gene (ptrc-proBA), and designing a primer. The primer information is as follows:
trpR-up-F：TCCCGCTGGCTTACAACGATCTT
trpR-up-R：AATATGTCGCCATTGTTAGCGGGGGAAGCAAAATGCCT
ptrc99-proBA-F：ACAATGCCGACATATTtggcaaatattctgaaatgagc
ptrc99-proBA-R：ATCCGCATTCGGTGggccgttgcttcgcaacgttcaaat
trpR-down-F：CACCGAATGCCGGATGCGGCGTGAA
trpR-down-R：TCTGTGCGACCACCACCAATCCCGCTA。
PCR conditions were as follows: 3 min at 98 ℃, 30 s at 55 ℃, 3 min at 72 ℃, 25cycle, 5min at 72 ℃ and 4 ℃.
After amplifying the upstream and downstream segments up and down of trpR and ptrc99-proBA of ptrc promoter, putting the three segments as templates in the same system for PCR amplification again. Amplification targeting fragment system (50 μ L):
template: trpR-up-F1 mu L
trpR-up 1µL
ptrc99-proBA 1µL
Primer: 1 mu L of trpR-up-F
trpR-down-R 1µL
DDH2O 2oµL
Enzyme: primer star 25 mu L
PCR conditions were as follows: 3 min at 98 ℃, 30 s at 55 ℃, 4 min at 72 ℃, 25cycle, 5min at 72 ℃ and 4 ℃ for storage.
(IV) selection of N20 for yghX and trpR and construction of plasmids
Genes yghX and trpR to be knocked out are input through a CRIPsy-feb network platform, an N20 sequence is designed, and then the corresponding N20 plasmids of the yghX and trpR are constructed through PCR amplification.
N20 for yghX: AGATTTGTCATAACGGGGCG
N20 of trpR: CAGAACAGCGTCACCAGGAG
The primer information for pEcgRNA-yghX-N20 and pEcgRNA-trpR-N20 is as follows,
pEcgRNA-yghX-N20-F：AGATTTGTCATAACGGGGCGgttttagagctag
pEcgRNA-yghX-N20-R：CGCCCCGTTATGACAAATCTactaaaagccag
pEcgRNA-trpR-N2O-F：CAGAACAGCGTCACCAGGAGgttttagagctagaaat
pEcgRNA-trpR-N2O-R：CTCCTGGTGACGCTGTTCTGactaaaagcca。
PCR system yghX (50 μ L):
enzyme: primerstar 25 mu L
pEcgRNA-yghX-N20-F 1µL
pEcgRNA-yghX-N20-R 1µL
pEcgRNA 1µL
DDH2O 22µL
PCR system trpR (50 μ L):
enzyme: primerstar 25 mu L
pEcgRNA-trpR-N20-F 1µL
pEcgRNA-trpR-N20-R 1µL
pEcgRNA 1µL
DDH2O 22µL。
PCR conditions were as follows: 3 min at 98 ℃, 30 s at 60 ℃, 3 min at 72 ℃, 25cycle, 5min at 72 ℃ and 4 ℃.
Gibson self-ligation (20 µ L system):
pEcgRNA-yghX-N20 (pEcgRNA-trpR-N20) 15µL
recombinase 1 mu L
5XBuffer 4µL
Conditions are as follows: 30min at 50 DEG C
And (3) transformation: gibson products (20 μ L) were transferred to DH5 α smeared SPE plates and incubated at 37 ℃.
Single colonies are picked on SPE plates and cultured in a 5mL LB test tube overnight, the plasmid is extracted the next day, and the concentration is measured (generally at 100-200 ng/. mu.L) and sent to be measured.
The pEcgRNA of the knockdown gene was selected from the pEcgRNA-yghX-N20 and pEcgRNA-trpR-N20 sequences that were sequenced correctly.
(V) preparation of electrotransformation competence
5.1 taking out the TIMDP host bacteria with the PECcas plasmid from-80 ℃ and putting the bacteria into an ice box, streaking the bacteria on an LB plate (Kan resistance) in an ultra-clean bench, and culturing the bacteria overnight at 37 ℃.
5.2 taking out the plate and selecting single clone to shake the platform in a 5ml LB (Kan resistance) test tube for overnight culture at 37 DEG C
5.3 taking out the overnight cultured TIMDP-PECcas test tube, culturing 500 muL in a 50ml LB shake flask (Kan resistance), adding 500 muL 20% arabinose for induction, and culturing at 37 ℃ and 200 rpm. Taking out the shake flask when OD = 0.5-0.6, carrying out ice bath for 10min, centrifuging at 4000rpm at 4 ℃ for 10min, and discarding the supernatant.
An equal volume (50 ml) of 10% glycerol was added for resuspension, and the supernatant was discarded at 4000rpm and 15in high-heart at 4 ℃.
Add 50% volume (25 ml) of 10% glycerol to resuspend, centrifuge at 4 ℃ 4000rpm for 15min, discard the supernatant.
30% volume (15 ml) of 10% glycerol was added for resuspension, the core was raised at 4 ℃ at 4000rp pm for 15min, and the supernatant was discarded.
Add 20% volume (10 ml) of 10% glycerol for resuspension, centrifuge at 4 ℃ at 4000rpm for 15min, and discard the supernatant.
1% volume (500 μ L) of 10% glycerol was added for resuspension and split into 5 sterile 1.5ml EP tubes, 100 μ L each, placed in ice.
(VI) electric conversion
100 mu L of TIMDP-PECcas competent cells, 100 ng of pEcgRNA-yghX-N20) plasmid, 400 ng of targeting fragment (yghX-up-proBA-down)/trpR-up-proBA-down, all of which are transferred into an electric rotor after ice bath for 2 min, and 1 ml of LB is added after transformation and is sucked into an EP tube to be cultured for 1 hour at 37 ℃ and 180 rpm. Centrifuging at 4000rpm for 3 min, sucking out 1 ml of supernatant, resuspending 100 mu L of supernatant on a Kan + Spe + double-antibody plate, and culturing overnight at 37 ℃.
(seventhly) verification of pEcgRNA knockout of yghX and trpR
Selecting a plurality of single clones on a double-antibody plate Kan + SPE + and culturing the single clones in 300 mu L LB (10mM rhamnose + Kan) (10mM rhamnose can induce Pcas to express sgRNA for cutting pEcgRNA) at 37 ℃ for 3-4 hours, then taking 1 mu L as a PCR template, performing PCR identification by using up and down end primers, and continuously culturing the rest bacteria liquid.
And (3) verifying whether the pEcgRNA is degraded, and marking the positive clone bacterial liquid on a double-antibody plate San + Spe + and a single-antibody plate Kan + for culture at 37 ℃, wherein if the double-antibody plate Kan + Spe + does not grow bacteria on the plate, the single-antibody plate Kan + grows bacteria on the plate, which indicates that the pEcgRNA is successfully cut off.
(eighth) PECcas eliminating yghX and trpR
Respectively picking two monoclones on a Kan + plate to be cultured in two 50mL LB (containing 5g/L glucose) test tubes overnight, then taking 10 mu L to be coated on a flat plate containing 5g/L glucose and 10 g/L sucrose, carrying out liquid culture, then picking the monoclones to be cultured in 300 mu L LB for 3-4 hours at 37 ℃, carrying out streaking on a Kan resistant and non-resistant flat plate, wherein the successful elimination of PECcas is shown when no bacteria grow on the Kan + flat plate but no bacteria grow on the anti-resistant plate, picking the monoclones on the non-resistant plate in 5mL LB, and carrying out bacteria preservation after overnight culture at 37 ℃. The strain is TIMDP 1.
Selecting strains which are verified to be correct, and storing the strains in China center for type microbiological culture Collection (CCTCC) at 8 months and 13 days in 2021, wherein the storage number is CCTCC NO: m20211024.
Example 2 shake flask fermentation validation of high D-proline producing strains
The Escherichia coli strain TIMDP1 preserved in glycerin tube was streaked and inoculated to LB solid medium plate, and the Escherichia coli strain TIMDP was inoculated as a control, and cultured in an incubator at 37 ℃ for 12-24 hours. And (3) selecting the escherichia coli on the LB solid culture medium to form a loop, inoculating the loop into a 30 mL test tube filled with 5mL of LB liquid culture medium, culturing at 37 ℃, and placing the test tube on a shaking table with the rotating speed of 100 rpm for culturing for 12-16 h to the later logarithmic phase to obtain a strain seed solution.
In a medium containing 30 mL of fermentation medium (K)2HPO4 14 g/L，KH2PO4 6 g/L，MgSO4·7H2O 200 mg/L，(NH4) 2SO4 20 g/L，MnSO4 1 .7 mg/L，Fe2 (SO4)3 25 mg/L，ZnCl2 7 mg/L, CaCl2140 mg/L, 25 g/L glucose) was inoculated into a 250 mL Erlenmeyer flask with 1% seed solution, incubated on a shaker at 30 ℃ and 150 rpm, and when the OD600 of the cells reached 0.5, 0.02% arabinose was added to induce the expression of glutamate metabolic pathway related enzymes. And then, measuring the content of the D-proline in the fermentation liquor by timing sampling and carrying out HPLC detection.
Through detection, three times of repeated experiments show that after 24 hours of fermentation, the shake flask inoculated with the Escherichia coli TIMDP1 produces 1.8 +/-0.2 g/L of D-proline, while the medicine bottle of the Escherichia coli TIMDP serving as a control group only has the content of the D-proline of 0.06 +/-0.01 g/L. The strengthening of the D-proline precursor synthesis pathway has an important promotion effect on the biosynthesis of D-proline, and the yield of D-proline is greatly increased.
Example 3 high-Density fermentation of high-yield D-proline Strain to produce D-proline
The Escherichia coli strain TIMDP1 stored in Glycerin pipes was streaked onto LB solid medium plates and cultured in an incubator at 37 ℃ for 16 hours. And (3) selecting the escherichia coli on the LB solid culture medium to form a loop, inoculating the loop into a 30 mL test tube filled with 5mL of LB liquid culture medium, culturing at 37 ℃, and placing the test tube on a shaking table with the rotation speed of 100 rpm for culturing for 12-16 h until the OD600 reaches 1 to obtain a strain seed solution.
The seed liquid was added to a medium containing 1L (K) of the seed liquid in an amount of 5%2HPO4 14 g/L，KH2PO4 6 g/L，MgSO4·7H2O 200 mg/L，(NH4) 2SO4 20 g/L，MnSO4 1 .7 mg/L，Fe2 (SO4)3 25 mg/L，ZnCl2 7 mg/L, CaCl2140 mg/L, glucose 25 g/L) fermentation Medium in a 2L fermenter. Then, the mixture was subjected to fermentation culture at 30 ℃ and 1000 rpm with a melting oxygen degree of 30% saturation. When the glucose is exhausted, a small amount of glucose is supplemented in a proper amount, and the concentration of the glucose is kept not to exceed 1 g/L. When the cell OD600 reached around 30, 0.02% arabinose was added to induce the precursor supply pathway and the pH was maintained at 7.0 during fermentation using ammonium sulfate. And sampling at proper time during the fermentation process to determine the content of D-proline and carrying out HPLC detection.
The results of three repeated experiments through detection show that the OD600 of the cells reaches 60 +/-5 after fermentation for 36 hours. The detection result shows that the content of the D-proline reaches 36 +/-3 g/L.
The above embodiments are merely illustrative of the technical ideas and features of the present invention, and the purpose thereof is to enable those skilled in the art to understand the contents of the present invention and implement the present invention, and not to limit the protection scope of the present invention. All equivalent changes and modifications made according to the spirit of the present invention should be covered within the protection scope of the present invention.
Sequence listing
<110> Tianjin Industrial microorganism science and technology Co., Ltd
<120> Escherichia coli and application thereof in high-yield preparation of D-proline
<160> 22
<170> PatentIn version 3.5
<210> 1
<211> 38
<212> DNA
<213> Artificial sequence
<400> 1
ttgtgagcggataacaatttcacacaggaaacagacca 38
<210> 2
<211> 40
<212> DNA
<213> Artificial sequence
<400> 2
attgttatccgctcacaattccacacattatacgagccgg 40
<210> 3
<211> 34
<212> DNA
<213> Artificial sequence
<400> 3
gccgacatcataacggttctggcaaatattctga 34
<210> 4
<211> 33
<212> DNA
<213> Artificial sequence
<400> 4
tcaggctgaaaatcttctctcatccgccaaaac 33
<210> 5
<211> 25
<212> DNA
<213> Artificial sequence
<400> 5
ttattccgttgcgaagacctggcat 25
<210> 6
<211> 27
<212> DNA
<213> Artificial sequence
<400> 6
taggtttatctcttacgggattacgtc 27
<210> 7
<211> 41
<212> DNA
<213> Artificial sequence
<400> 7
cccgtaagagataaacctatggcaaatattctgaaatgagc 41
<210> 8
<211> 37
<212> DNA
<213> Artificial sequence
<400> 8
agtaatccagcaactcttgtgggaaatctttggcggt 37
<210> 9
<211> 37
<212> DNA
<213> Artificial sequence
<400> 9
agtaatccagcaactcttgtgggaaatctttggcggt 37
<210> 10
<211> 28
<212> DNA
<213> Artificial sequence
<400> 10
tcggcgtattttcatcgacgcgatgaga 28
<210> 11
<211> 23
<212> DNA
<213> Artificial sequence
<400> 11
tcccgctggcttacaacgatctt 23
<210> 12
<211> 38
<212> DNA
<213> Artificial sequence
<400> 12
aatatgtcgccattgttagcgggggaagcaaaatgcct 38
<210> 13
<211> 38
<212> DNA
<213> Artificial sequence
<400> 13
acaatgccgacatatttggcaaatattctgaaatgagc 38
<210> 14
<211> 39
<212> DNA
<213> Artificial sequence
<400> 14
atccgcattcggtgggccgttgcttcgcaacgttcaaat 39
<210> 15
<211> 25
<212> DNA
<213> Artificial sequence
<400> 15
caccgaatgccggatgcggcgtgaa 25
<210> 16
<211> 27
<212> DNA
<213> Artificial sequence
<400> 16
tctgtgcgaccaccaccaatcccgcta 27
<210> 17
<211> 20
<212> DNA
<213> Artificial sequence
<400> 17
agatttgtcataacggggcg 20
<210> 18
<211> 20
<212> DNA
<213> Artificial sequence
<400> 18
cagaacagcgtcaccaggag 20
<210> 19
<211> 33
<212> DNA
<213> Artificial sequence
<400> 19
agatttgtcataacggggcggttttagagctag 33
<210> 20
<211> 32
<212> DNA
<213> Artificial sequence
<400> 20
cgccccgttatgacaaatctactaaaagccag 32
<210> 21
<211> 37
<212> DNA
<213> Artificial sequence
<400> 21
cagaacagcgtcaccaggaggttttagagctagaaat 37
<210> 22
<211> 31
<212> DNA
<213> Artificial sequence
<400> 22
ctcctggtgacgctgttctgactaaaagcca 31
Claims (11)
1. Escherichia coli strain (E.coli) capable of producing D-prolineEscherichia coli) Characterized by being described inThe strain is preserved in China center for type microbiological culture Collection with the preservation number of CCTCC NO: m20211024.
2. Use of an E.coli strain according to claim 1 for the production of D-proline.
3. A process for producing D-proline, characterized by using the Escherichia coli strain of claim 1, fermenting to produce D-proline using glucose as a carbon source and ammonium sulfate as a nitrogen source, and obtaining D-proline from the fermentation broth.
4. The method of claim 3, wherein the amount of glucose added to the fermentation medium is 2% to 6% (w/v); the addition amount of the ammonium sulfate is 1-3%.
5. The method of claim 4, wherein the culture composition of the fermentation is: the formula of the culture medium for fermentation culture is as follows: k2HPO4 12~16g，KH2PO4 4~8g，MgSO4·7H2O 100~300mg，(NH4) 2SO4 12~28g，MnSO41~3 mg，Fe2 (SO4)3 20~40 mg，ZnCl2 3~10 mg，CaCl2100-200 mg, 20-60 g glucose, H2O 1L。
6. The method of claim 5, wherein the liquid fermentation culture is performed using a medium formulation comprising: k2HPO4 14 g，KH2PO4 6 g，MgSO4·7H2O 200 mg，(NH4) 2SO4 20 g，MnSO4 1 .7 mg，Fe2(SO4)3 25 mg，ZnCl2 7 mg , CaCl2140 mg, glucose 25 g, H2O 1L。
7. The method as claimed in claim 4, wherein the fermentation culture is carried out at 30-37 ℃ and 800-1200 rpm with a melting oxygen degree of 25% -35% saturation.
8. The method of claim 4, wherein the amount of glucose in the fermentation broth is measured during fermentation, and when it is depleted, glucose is supplemented to maintain a sugar concentration of no more than 1 g/L, and ammonium sulfate is used to maintain the pH at 7.0 during fermentation.
9. The method of claim 4, wherein the arabinose inducer is added when the strain cell OD600 reaches 25-35 at fermentation.
10. The method of claim 8, wherein arabinose is added in an amount of up to 0.02% of the total amount of the fermentation broth.
11. The method of any one of claims 3 to 10, wherein the fermentation time is 28 to 44 hours.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111143731.8A CN113564093B (en) | 2021-09-28 | 2021-09-28 | Escherichia coli and application thereof in high-yield preparation of D-proline |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111143731.8A CN113564093B (en) | 2021-09-28 | 2021-09-28 | Escherichia coli and application thereof in high-yield preparation of D-proline |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113564093A true CN113564093A (en) | 2021-10-29 |
| CN113564093B CN113564093B (en) | 2021-12-10 |
Family
ID=78174863
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111143731.8A Active CN113564093B (en) | 2021-09-28 | 2021-09-28 | Escherichia coli and application thereof in high-yield preparation of D-proline |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113564093B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111424060A (en) * | 2020-03-30 | 2020-07-17 | 重庆邮电大学 | Biological method for simultaneously preparing D-proline and L-1-pyrroline-5-carboxylic acid |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105602978A (en) * | 2016-01-19 | 2016-05-25 | 江南大学 | Method for producing L-proline by means of fermentation by aid of genome-modified recombinant Escherichia coli |
| CN107827802A (en) * | 2017-10-17 | 2018-03-23 | 南京红杉生物科技有限公司 | A kind of synthetic method of D proline |
| CN108949706A (en) * | 2018-06-29 | 2018-12-07 | 天津科技大学 | A kind of L-PROLINE -4- hydroxylase and its genetic engineering bacterium, construction method and application |
| CN111424060A (en) * | 2020-03-30 | 2020-07-17 | 重庆邮电大学 | Biological method for simultaneously preparing D-proline and L-1-pyrroline-5-carboxylic acid |
| CN112779205A (en) * | 2021-03-29 | 2021-05-11 | 江南大学 | Method for producing L-proline by microbial fermentation |
-
2021
- 2021-09-28 CN CN202111143731.8A patent/CN113564093B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105602978A (en) * | 2016-01-19 | 2016-05-25 | 江南大学 | Method for producing L-proline by means of fermentation by aid of genome-modified recombinant Escherichia coli |
| CN107827802A (en) * | 2017-10-17 | 2018-03-23 | 南京红杉生物科技有限公司 | A kind of synthetic method of D proline |
| CN108949706A (en) * | 2018-06-29 | 2018-12-07 | 天津科技大学 | A kind of L-PROLINE -4- hydroxylase and its genetic engineering bacterium, construction method and application |
| CN111424060A (en) * | 2020-03-30 | 2020-07-17 | 重庆邮电大学 | Biological method for simultaneously preparing D-proline and L-1-pyrroline-5-carboxylic acid |
| CN112779205A (en) * | 2021-03-29 | 2021-05-11 | 江南大学 | Method for producing L-proline by microbial fermentation |
Non-Patent Citations (1)
| Title |
|---|
| 陈建波等: "D-型氨基酸的生物法制备", 《分子催化》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111424060A (en) * | 2020-03-30 | 2020-07-17 | 重庆邮电大学 | Biological method for simultaneously preparing D-proline and L-1-pyrroline-5-carboxylic acid |
| CN111424060B (en) * | 2020-03-30 | 2023-03-28 | 重庆邮电大学 | Biological method for simultaneously preparing D-proline and L-1-pyrroline-5-carboxylic acid |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113564093B (en) | 2021-12-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3556860B1 (en) | Type i-b crispr-cas system gene cas3-based gene editing method | |
| CN110373370B (en) | Catalytic system coupled with ATP regeneration system and application of catalytic system in glutathione production process | |
| CN112813085A (en) | Use of pyrophosphatase gene | |
| CN113564093B (en) | Escherichia coli and application thereof in high-yield preparation of D-proline | |
| Tang et al. | The overexpression of phasin and regulator genes promoting the synthesis of polyhydroxybutyrate in Cupriavidus necator H16 under nonstress conditions | |
| CN110791439B (en) | Recombinant aspergillus niger strain for fermentation production of malic acid by genetic engineering construction and application | |
| CN114854659B (en) | Ergothioneine production process and application thereof | |
| CN107299074B (en) | Construction method and application of formate dehydrogenase engineering strain | |
| CN113684163B (en) | Genetically engineered bacterium for improving lactoyl-N-tetraose yield and production method thereof | |
| CN114277068B (en) | Microbial fermentation preparation method of R-3-ethyl hydroxybutyrate | |
| CN110218691A (en) | One plant of genetic engineering bacterium for synthesizing altheine and its construction method and application | |
| CN112779205A (en) | Method for producing L-proline by microbial fermentation | |
| CN111826372B (en) | Engineering strain for producing butanol by using xylose and construction method and application thereof | |
| CN115612694A (en) | Construction method and application of recombinant strain for producing tetrahydropyrimidine by efficiently converting glucose | |
| CN114317582A (en) | Method for improving stability of arginine producing capacity of strain | |
| CN114134095B (en) | Method for producing L-lysine and/or 1, 5-pentanediamine by using halophilic bacteria | |
| CN114350688B (en) | Application of guaA gene, plasmid and strain in expression of azotobacter ferrite | |
| CN117106836B (en) | Application of phosphatidyl glycerol phosphatase coding gene in fermentation production of cytidine | |
| CN111334445B (en) | Long-chain dicarboxylic acid producing strain and preparation method and application thereof | |
| CN114015634B (en) | Recombinant escherichia coli for high yield of succinic acid and construction method and application thereof | |
| CN115948402A (en) | Recombinant Shewanella capable of producing 5-aminolevulinic acid and application thereof | |
| CN118048285A (en) | Genetically engineered bacterium for stably producing L-methionine and construction method and application thereof | |
| CN115927500A (en) | Method for preparing scopoletin lactone by enzyme method | |
| CN117660277A (en) | Metabolic engineering modified escherichia coli and application thereof in fermentation preparation of salidroside | |
| CN117551595A (en) | Genetically engineered bacterium for high yield of D-pantothenic acid, construction method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |