CN118048285A - Genetically engineered bacterium for stably producing L-methionine and construction method and application thereof - Google Patents

Genetically engineered bacterium for stably producing L-methionine and construction method and application thereof Download PDF

Info

Publication number
CN118048285A
CN118048285A CN202410095126.5A CN202410095126A CN118048285A CN 118048285 A CN118048285 A CN 118048285A CN 202410095126 A CN202410095126 A CN 202410095126A CN 118048285 A CN118048285 A CN 118048285A
Authority
CN
China
Prior art keywords
plasmid
methionine
metz
pam
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202410095126.5A
Other languages
Chinese (zh)
Inventor
柳志强
郭盈盈
王丽娟
逄爱萍
牛坤
郑裕国
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University of Technology ZJUT
Original Assignee
Zhejiang University of Technology ZJUT
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University of Technology ZJUT filed Critical Zhejiang University of Technology ZJUT
Priority to CN202410095126.5A priority Critical patent/CN118048285A/en
Publication of CN118048285A publication Critical patent/CN118048285A/en
Pending legal-status Critical Current

Links

Landscapes

  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention relates to the technical field of microbial metabolism engineering, and discloses a genetically engineered bacterium for stably producing L-methionine, and a construction method and application thereof. The invention uses strain E.coli W3110M2/pAm as an initial strain to knock down a key gene thrB (homoserine kinase) involved in threonine biosynthesis through balanced growth and production, overexpresses a gene sucA (alpha-ketoglutarate dehydrogenase) in tricarboxylic acid cycle and a gene metZ (O-succinyl sulfhydryltransferase mutant) derived from purple bacillus through a plasmid pA x HAm, introduces a hok/sok system on the plasmid to increase the stability of the plasmid, and finally obtains a recombinant escherichia coli strain containing the plasmid. The strain can realize stable production of L-methionine without adding antibiotics in the fermentation process, and avoid the problem of plasmid loss caused by adding antibiotics.

Description

Genetically engineered bacterium for stably producing L-methionine and construction method and application thereof
Technical Field
The invention relates to the technical field of microbial metabolism engineering, in particular to genetically engineered bacteria for stably producing L-methionine, and a construction method and application thereof.
Background
Methionine (L-methionine), the only sulfur-containing essential Amino acid in organisms, is also known as methionine or 2-Amino-4-methylthiobutanoic acid ((S) -2Amino-4- (methylthio) butanoic acid). S-adenosylmethionine (SAM) is a main biological methyl donor for synthesizing biological macromolecules such as DNA, RNA and the like and supplements or therapeutic medicines, and L-methionine can be used as a precursor of SAM to indirectly participate in various metabolic processes, so that the SAM has commercial value in the aspects of animal feed, human nutrition, cosmetics and the like. The synthesis method mainly comprises a chemical synthesis method, an enzyme catalysis method and a microbial fermentation method. In recent years, the technology for synthesizing L-methionine by a chemical synthesis method is mature and low in cost, but the steps are complicated, and the problems of environmental pollution and the like are often caused; the enzyme catalysis method has stronger specificity and stereoselectivity, has simple reaction, but the price of the raw materials is higher, and is not suitable for large-scale production; the microbial fermentation method is green, efficient and low in pollution, and the reaction condition is mild, so that the microbial fermentation method is widely focused by researchers.
At present, many scholars have conducted intensive studies on the synthetic pathway and mechanism of L-methionine in Corynebacterium glutamicum (Corynebacterium glutamicum) and Escherichia coli (ESCHERICHIA COLI), and applied metabolic engineering strategies and synthetic biological means to the construction of L-methionine high-producing strains. These strategies can be broadly divided into the following: (1) Removing feedback regulation of key enzymes in metabolic pathways, such as removing transcription negative regulation genes, removing feedback inhibition of lysine and threonine by site-directed mutagenesis aspartokinase, removing feedback inhibition of final products L-methionine and SAM, increasing homoserine O-succinyl transferase activity, and the like; (2) Impairing the competitive and degradation pathways to allow more flow to L-methionine synthesis, such as knocking out lysine branching key genes or initiating transcription of the genes using growth-coupled promoter P fliA, knocking out threonine branching pathway genes to reduce consumption of precursor homoserine, reducing SAM synthase activity or expression level to reduce consumption of L-methionine; (3) Enhancing biosynthetic pathways, such as overexpression of key genes in the synthetic pathway, introducing exogenous pathways, such as introducing betaine pathways, to increase the supply of methyl donors during L-methionine synthesis; (4) Optimizing the transport system, e.g., overexpressing the gene encoding the L-methionine efflux protein by a plasmid or genome, disrupting the internal transport system MetD of L-methionine to reduce internal transport of L-methionine, reducing external transport of the precursor substance L-homoserine, etc.; (5) Increasing the supply of cofactor, ensuring the sufficient amount of the cofactor of the thalli, such as over-expressing pntA and pntB genes in the escherichia coli to promote the generation of NADPH; (6) Optimizing fermentation conditions, such as optimizing culture medium components, adjusting and amplifying dissolved oxygen value, feeding mode, feeding rate and the like in the fermentation process.
However, in the above strategy, the biosynthesis pathway of L-methionine in microorganisms is complex and is regulated at multiple levels, so that the relationship between growth and production is difficult to coordinate, and therefore, optimal regulation of the process is still impossible to achieve reasonably. In addition, plasmid loss, inducer and antibiotic addition during fermentation also bring about a corresponding series of problems, such as unstable yield and increased production cost, which prevent the industrial production of L-methionine by microbial fermentation.
Disclosure of Invention
In order to solve the technical problem of synthesizing L-methionine by the microbial fermentation method, the invention provides a genetically engineered bacterium for stably producing L-methionine, and a construction method and application thereof. The invention introduces exogenous path from homoserine to homocysteine in E.coli to increase the production of L-methionine through balancing growth and production, and introduces toxin-antitoxin system hok/sok at different positions of plasmid, so that the recombinant strain formed after plasmid transformation realizes stable production of L-methionine without antibiotic addition.
The specific technical scheme of the invention is as follows:
In a first aspect, the present invention provides a genetically engineered bacterium that stably produces L-methionine. Specifically, the genetically engineered bacterium is obtained by knocking down thrB genes on chassis bacterium genome, overexpressing sucA genes and metZ genes, and introducing a toxin-antitoxin system hok/sok.
The principle of the invention that the genetically engineered bacterium can stably produce L-methionine is as follows:
① The threonine branching pathway is attenuated by knocking down thrB gene, thereby reducing consumption of homoserine while keeping bacterial growth unaffected. The thrB gene is reduced to be beneficial to balancing the growth of the strain and the production of L-methionine, and if the thrB gene is completely knocked out, the thrB gene is unfavorable for the growth of the strain, so that the thrB gene cannot be completely knocked out; however, if thrB gene is expressed normally, it is disadvantageous for L-methionine production.
② The invention enhances the supply of succinyl-CoA by overexpressing the sucA gene in the tricarboxylic acid cycle, introduces an exogenous O-succinyl sulfhydryl transferase mutant metZ gene, increases the path from homoserine to homocysteine, balances the growth and the production, and thereby improves the production amount of L-methionine.
③ The introduction of the toxin-antitoxin system hok/sok enables the strain to keep plasmid stable under the condition of no addition of antibiotics, avoids the problem of plasmid loss caused by the addition of antibiotics, and simultaneously enables the O-succinyl sulfhydryltransferase mutant metZ gene to realize stable increase of homoserine to homocysteine pathway under the expression of the toxin-antitoxin system hok/sok without the addition of antibiotics.
Based on the principle, the invention obtains the genetically engineered bacterium for stably producing L-methionine by knocking down thrB genes on chassis bacterium genome, overexpressing sucA genes and metZ genes and introducing a toxin-antitoxin system hok/sok.
As a preferred embodiment of the present invention, the Chaetomium is E.coli W3110 ΔmetJ ΔmetI ΔlysA Trc-metH Trc-metF Trc-cysE Trc-serB Trc-serC/pA Ham.
As the optimization of the technical scheme, the thrB gene nucleotide sequence of the chassis fungus genome after knocking down is shown as SEQ ID No.1, the sucA gene nucleotide sequence is shown as SEQ ID No.2, and the nucleotide sequence of the toxin-antitoxin system hok/sok is shown as SEQ ID No. 4.
As a preferable mode of the above technical scheme of the invention, the amino acid sequence encoded by metZ gene is an amino acid sequence obtained by mutating the amino acid sequence encoded by metZ gene derived from Chromobacterium violaceum:
(a) Glutamine at position 306 is mutated to alanine;
(b) Alanine at position 311 is mutated to glycine;
(c) Arginine at position 365 is mutated to alanine.
After the mutation of the above sites, the encoded O-succinyl sulfhydryl transferase mutant can be stably and efficiently expressed after being exogenously introduced into chassis bacteria, and meanwhile, the stable increase of homoserine to homocysteine pathway can be realized under the expression of a toxin-antitoxin system hok/sok without antibiotics.
Further preferably, metZ gene nucleotide sequence is shown in SEQ ID No. 3.
The O-succinyl sulfhydryl transferase mutant coded by the nucleotide sequence shown in SEQ ID No.3 can obtain stable and efficient expression after exogenesis is introduced into chassis bacteria, and can realize stable increase of homoserine to homocysteine pathway under the expression of a toxin-antitoxin system hok/sok without antibiotics.
In a second aspect, the present invention provides a method for constructing the genetically engineered bacterium for stable production, comprising the steps of:
(1) Knocking down thrB gene on chassis fungus genome;
(2) Overexpressing the sucA gene from E.coli W3110 on the plasmid and transforming into Chaetomium;
(3) The metZ gene from Chromobacterium violaceum was overexpressed on the plasmid and mutated and then transformed into Chaetomium;
(4) Introducing a toxin-antitoxin system hok/sok on the plasmid, and then converting the bacterial strain into chassis bacteria to obtain the genetically engineered bacteria.
The invention knocks down a key gene thrB (homoserine kinase) involved in threonine biosynthesis in a genome of a chassis fungus by balancing growth and production, overexpresses a gene sucA (alpha-ketoglutarate dehydrogenase) in tricarboxylic acid cycle and a mutant gene (O-succinyl sulfhydryltransferase mutant) of a gene metZ derived from purple bacillus in the chassis fungus by a plasmid, introduces a hok/sok system on the plasmid to increase the stability of the plasmid, and finally obtains a recombinant strain containing the plasmid. The constructed strain can realize stable production of L-methionine without adding antibiotics in the fermentation process, avoid the problem of plasmid loss caused by adding antibiotics, solve the problem of instability of fermentation of the plasmid-containing strain, and improve the yield of L-methionine from 2.4g/L to 3.00+/-0.02 g/L by 25 percent compared with chassis bacteria.
As the optimization of the technical scheme of the method, the method for knocking down thrB genes comprises the following steps: the initiation codon ATG of thrB gene was mutated to GTG.
By mutating the ATG of the initiation codon of thrB gene to GTG, the thrB gene can be well reduced in expression, which is beneficial to balance the growth of strain and the production of L-methionine. If thrB gene is completely knocked out, the thrB gene is unfavorable for the growth of the strain, so that the thrB gene cannot be completely knocked out; however, if thrB gene is expressed normally, it is disadvantageous for L-methionine production.
As a preferred mode of the method of the present invention, after the metZ gene is mutated, the encoded amino acid sequence is mutated at the following positions relative to the encoded amino acid sequence of the metZ gene:
(a) Glutamine at position 306 is mutated to alanine;
(b) Alanine at position 311 is mutated to glycine;
(c) Arginine at position 365 is mutated to alanine.
As the optimization of the technical scheme of the method, the chassis fungus is E.coli W3110 delta metJ delta metI delta lysA Trc-metH Trc-metF Trc-cysE Trc-serB Trc-serC/pA Ham; the plasmid is pAm.
In a third aspect, the invention provides the use of the genetically engineered bacterium described above in the production of L-methionine.
Furthermore, the invention provides a method for applying the genetically engineered bacterium to the production of L-methionine. The method comprises the following steps: and streaking the constructed genetically engineered bacteria on a flat plate without antibiotics, picking single bacterial colonies, inoculating the single bacterial colonies into a test tube without antibiotics and containing 10mL of LB culture medium, and culturing at 37 ℃ for 12 hours to obtain genetically engineered bacteria seed liquid. The seed is inoculated into a shake flask containing 20mL of fermentation medium at 5% transfer amount, each strain is subjected to three parallel fermentation culture for 48h at 30 ℃ and 200rpm, 2mL of fermentation liquor is taken after fermentation is finished, and the supernatant containing L-methionine is obtained by centrifugation at 12000rpm for 2 min.
The LB culture medium comprises the following components: peptone 10g/L, yeast powder 5g/L, naCl 10g/L, deionized water to 1L. The fermentation medium is as follows: 20g/L of glucose, 16g/L of ammonium sulfate, 1g/L of monopotassium phosphate, 2g/L of sodium thiosulfate, 2g/L of yeast powder, 1mL/L of microelement solution and deionized water to a volume of 1L; 0.2g (final concentration of 0.2 mg/L) of calcium carbonate, 0.1M IPTG 20. Mu.L (final concentration of 0.1 mM), 0.2g/L VB 12. Mu.L (final concentration of 0.2 mg/L), 10g/L lysine 20. Mu.L (final concentration of 0.01 g/L) were added at the time of inoculation after sterilization.
Compared with the prior art, the invention has the following technical effects:
The invention knocks down a key gene thrB (homoserine kinase) involved in threonine biosynthesis in a genome of a chassis fungus by balancing growth and production, overexpresses a gene sucA (alpha-ketoglutarate dehydrogenase) in tricarboxylic acid cycle and a mutant gene (O-succinyl sulfhydryltransferase mutant) of a gene metZ derived from purple bacillus in the chassis fungus by a plasmid, introduces a hok/sok system on the plasmid to increase the stability of the plasmid, and finally obtains a recombinant strain containing the plasmid. The constructed strain can realize stable production of L-methionine without adding antibiotics in the fermentation process, avoid the problem of plasmid loss caused by adding antibiotics, solve the problem of instability of fermentation of the plasmid-containing strain, and improve the yield of L-methionine from 2.4g/L to 3.00+/-0.02 g/L by 25 percent compared with chassis bacteria.
Drawings
FIG. 1 is a schematic diagram showing the metabolic pathway modification of L-methionine according to the present invention;
FIG. 2 is a graph showing the L-methionine production and the bacterial growth OD 600 of the starting strain E.coli W3110M 2/pAm and the recombinant strain E.coli W3110M 2thrB A1G/pAm in example 1 of the present invention;
FIG. 3 is a graph showing the L-methionine production of the starting strain E.coli W3110M2/pAm and the recombinant strain E.coli W3110M2/pAm-sucA and the cell growth OD 600 in example 2 of the present invention;
FIG. 4 is a graph showing the L-methionine production and the bacterial growth OD 600 of the starting strain E.coli W3110M 2/pAm, recombinant strain E.coli W3110M2/pAm-metZ、E.coli W3110 M2/pAm-metZ*、E.coli W3110 M2/pAm-sucA-metZ、E.coli W3110M2/pAm-sucA-metZ* and E.coli W3110M 2 thrB A1G/pAm-sucA-metZ according to example 3 of the present invention;
FIG. 5 is a graph showing the L-methionine production of the starting strain E.coli W3110M 2/pAm, the recombinant strain E.coli W3110M 2/pAm-HS in shake flask fermentation according to example 4 of the invention;
FIG. 6 is a graph showing the results of L-methionine production by recombinant strains E.coli W3110M2 thrB A1G/pAm-sucA-metZ and E.coli W3110M2 thrB A1G/pAm-sucA-metZ-HS with/without kanamycin addition, respectively, according to example 5 of the present invention.
Detailed Description
The invention is further described below with reference to examples. Those of ordinary skill in the art will be able to implement the invention based on these descriptions. In addition, the embodiments of the present invention referred to in the following description are typically only some, but not all, embodiments of the present invention. Therefore, all other embodiments, which can be made by one of ordinary skill in the art without undue burden, are intended to be within the scope of the present invention, based on the embodiments of the present invention.
The starting strain E.coli W3110M2/pAm and the starting plasmid pAm according to the examples of the invention can be obtained by the prior art, for example E.coli W3110 IJAHFEBC/pAm in literature "Jian-Feng Huang et al 2018,Systematic Analysis of Bottlenecks in aMultibranched and Multilevel Regulated Pathway:The Molecular Fundamentals ofL-Methionine Biosynthesis in Escherichia coli".
By taking E.coli W3110 ΔmetJΔmetI ΔlysA Trc-MetH Trc-metF Trc-cysE Trc-serB Trc-serC/pA as the chassis bacterium (namely E.coli W3110M 2/pAm), the invention knocks down the key gene thrB (homoserine kinase) involved in threonine biosynthesis in the genome of the chassis bacterium by balancing growth and production, and overexpresses the gene sucA (alpha-ketoglutarate dehydrogenase) in the tricarboxylic acid cycle and the gene metZ (O-succinylthiotransferase mutant) derived from Violete in the chassis bacterium by plasmid pA-HAm, and introduces a hok/sok system on the plasmid to increase the stability of the plasmid, and finally obtains the recombinant E.coli strain containing the plasmid. The strain constructed by the invention can realize stable production of L-methionine without adding antibiotics in the fermentation process, avoid the problem of plasmid loss caused by adding antibiotics, solve the problem of instability of fermentation of plasmid-containing strains, and improve the yield of L-methionine from 2.4g/L to 3.00+/-0.02 g/L by 25% compared with chassis bacteria. FIG. 1 shows a schematic diagram of the metabolic pathway modification of L-methionine according to the present invention.
The sources/sequences of genes and the functions involved in the examples of the present invention are shown in Table 1.
TABLE 1
Gene name Gene source Nucleotide sequence Relates to functions
thrBA1G Escherichia coli SEQ ID No.1 Synthesis of threonine
sucA Escherichia coli SEQ ID No.2 Succinyl-coa production
metZ*(metZQ306A/A311G/R365A) Chromobacterium violaceum SEQ ID No.3 Homocysteine production
hok/sok Escherichia coli plasmid R1 SEQ ID No.4 Toxin-antitoxin system
The names and sequences of the primers involved in the examples of the present invention are shown in Table 2.
TABLE 2
Primer name Primer sequence (5 '-3')
pTarget-thrBA1G-F CTAGTCATGGTTAAAGTTTATGCCCGTTTTAGAGCTAGAAATAGCAAG
pTarget-thrBA1G-R CTAAAACGGGCATAAACTTTAACCATGACTAGTATTATACCTAGGACTGAG
XXHF CTGCAGAAGCTTAGATCTATTACCCTG
XXHR TCTAGAGAATTCAAAAAAAGCACCGACTC
Donor-thrBA1G-1 CTTTTTTTGAATTCTCTAGAGAAGGCATGAGTTTCTCCGAG
Donor-thrBA1G-2 CCTTCACCACGTCAGACTCCTAACTTCCATGAG
Donor-thrBA1G-3 GAGTCTGACGTGGTGAAGGTTTATGCCCCGGCTTCC
Donor-thrBA1G-4 GATCTAAGCTTCTGCAGCATCAAACCCTGGCACTTGC
pTarget-YZF GGCCTTTTGCTCACATGTTC
pTarget-YZR TAGCACGATCAACGGCACTG
thrBA1G-YZF GTTGGGGCTGGATTACCG
thrBA1G-YZR GGCGTGAATGAAGCCTGC
PAM-F GGCTGTTTTGGCGGATGAG
PAM-R TTAGTACAGCAGACGGGCG
sucA-1 CACACAGGAAACAGACCATGCAGAACAGCGCTTTGAAAG
sucA-2 CATCCGCCAAAACAGCCTTATTCGACGTTCAGCGCG
99A-F GGCTGTTTTGGCGGATGAG
99A-R GGTCTGTTTCCTGTGTGAAATTG
RBS-sucA-1 GCCCGTCTGCTGTACTAATGTGGAATTGTGAGCGGATAAC
RBS-sucA-2 CATCCGCCAAAACAGCCTTATTCGACGTTCAGCGCG
sucA-F GCAATATCTGCAAACTTCCGCC
sucA-R TGCCTGGCAGTTCCCTACTCT
AZ-F CAATTCCACATTATTCGACGTTCAGCGCG
AZ-R GTTGCGGGGCCTTGACTAAGGCTGTTTTGGCGGATGAG
metZ-1 ATGGCATCCGACGCGCCGTATCTTCCGCTGCACCCTGAAACCCTGG
metZ-2 TTAGTCAAGGCCCCGCAACAGATCTTGTTGAAGGTCCCGCACATTTTC
RBS-metZ-1 CGTCGAATAATGTGGAATTGTGAGCGGATAAC
RBS-metZ-2 CAGCCTTAGTCAAGGCCC
metZ-F CGCCCAGATGGGTTATGTG
metZ-R TGCCTGGCAGTTCCCTACTCT
AZ-1 GAAGAGCGGCGGAGGCGTGGTGTCCTTCGTGGTC
AZ-2 CGCCTCCGCCGCTCTTCGCCTGGCGCAGCGCCAGCTC
AZ-3 GAGGCGCGCGAGGCCGCCGGCATCGTCGAGG
AZ-4 TGCCGGCGGCCTCGCGCGCCTCCTGCG
PAM-1 CTTTCTCCTTGCTGATGTTGTCTGTCAGACCAAGTTTACTCATATATAC
PAM-2 GGGCTTTGTTAGCAGTCAGAAGAACTCGTCAAGAAGGC
HS-1 GTTCTTCTGACTGCTAACAAAGCCCGAAAGG
HS-2 GGTCTGACAGACAACATCAGC
Pam-YZ-F GCAATATCTGCAAACTTCCGCC
Pam-YZ-R CAGTGGAACGAAAACTCACGTTAAG
The liquid phase elution procedure used to detect L-methionine content in the examples of the present invention is shown in Table 3.
TABLE 3 Table 3
In the embodiment of the invention, the method for measuring the L-methionine content in the fermentation broth comprises the following steps:
(1) Detection of L-methionine production: preparing derivatization reagent, namely CNBF 0.27.27 g, and using acetonitrile to fix the volume to 10mL; sodium borate buffer, i.e., adjusting the final pH to 9.0 using 0.2mol/L boric acid and 0.05mol/L borax (wherein 0.2mol/L boric acid: 1.2368g, distilled water: 100mL;0.05mol/L sodium borate: 1.907g, distilled water: 100 mL); weighing 0.1g of L-methionine standard solution, diluting the L-methionine standard solution to 0.5g/L, 1g/L, 1.5g/L, 2g/L, 2.5g/L and 3g/L respectively by distilled water to a volume of 10mL, namely 10g/L, and preparing a standard curve; the mobile phase, phase A (pure acetonitrile), phase B (850 mL ddH 2 O,150mL acetonitrile, 2mL triethylamine, 7mL acetic acid) was sonicated for 30min after suction filtration with an organic membrane. Carrying out derivatization reaction on the sample supernatant, namely sequentially adding 500 mu L of sodium borate buffer solution, 100 mu L of sample or standard sample supernatant and 300 mu L CNBF into a 1.5mL ep tube, and carrying out light-shielding reaction at 60 ℃ at 400rpm for 1h; after the reaction liquid was subjected to membrane filtration using a 0.22 μm organic filter, the concentration of L-methionine was detected by eluting with a C18 column (250X 4.6mm,5 μm), an ultraviolet detector, a detection wavelength of 260nm, a column temperature of 30℃and a sample injection amount of 10. Mu.L at a flow rate of 0.8mL/min according to the liquid phase elution procedure of Table 3.
(2) Detection OD 600 value: 1mL of 20% glacial acetic acid was added to the centrifuged precipitate, the mixture was centrifuged at 12000rpm for 2min, resuspended in 1mL of water, and the mixture was diluted 20 times and the OD 600 was measured at a wavelength of 600 nm.
EXAMPLE 1 construction of recombinant E.coli Strain E.coli W3110M 2 thrB A1G/pAm and shake flask fermentation this example uses E.coli W3110M 2/pAm as starting strain, using CRISPR-Cas9 gene editing technology (reference ：Yu Jiang et al.2015Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9System.Applied Environmental Microbiology.81:2506-2514), implements replacement of thrB gene start codon on the genome.
The specific operation is as follows:
1-1: construction of plasmid backbone pTarget-thrB A1G
PTarget F plasmid (ADDGENE PLASMID # 62226) is used as a template, pTarget-thrB A1G -F and pTarget-thrB A1G -R are used as primers in table 2 to mutate the pTarget plasmid, electrophoresis detection is carried out after PCR amplification, the size of the band of the PCR amplified product is observed by a gel imager, 1 mu L of DpnI endonuclease is added to the PCR amplified product for digestion for 1h at 37 ℃ after success, and the pTarget template plasmid is eliminated. The pTarget-thrB A1G skeleton purified by the Clean up purification kit is used as a template, and is linearized by using XXHF/XXHR primers in Table 2, and the amplified linearized product is subjected to agarose gel electrophoresis detection and purification recovery to obtain a linearized pTarget-thrB A1G skeleton.
1-2: Obtaining Donor DNA fragments
PCR amplification was performed using the genome of E.coli W3110 strain as a template and the primers Donor-thrB A1G-1/Donor-thrBA1G -2 and Donor-thrB A1G-3/Donor-thrBA1G -4 in Table 2, respectively, to obtain the fragments Donor-thrB A1G -up and Donor-thrB A1G -down; and carrying out electrophoresis detection and purification recovery on the PCR product.
1-3: Plasmid pTD-thrB used for constructing thrB gene critical to knockdown threonine pathway A1G
The linearized pTarget-thrB A1G backbone of step 1-1, the Donor-thrB A1G -up fragment of step 1-2 and the Donor-thrB A1G -down fragment were passed through Nanjinopranzan RenzanMultiS One Step Cloning Kit carrying out recombinant seamless cloning by using a kit; the connected product is transformed into transformation competent DH5 alpha and placed in a 37 ℃ incubator for culturing for 12-16h; single colonies on the plates were picked as templates and colony PCR was verified using pTarget-YZF and pTarget-YZR as primers in Table 2. The PCR amplified product is detected by agarose gel electrophoresis to verify the size of the band, and the PCR product with the same size as the target band is sent to the company of the Optimago (Hangzhou) for further verification by sequencing. After the correct sequencing verification, picking single colony with correct sequencing, shake culturing in LB test tube containing spectinomycin resistance at 37 ℃ for 14-16h, extracting plasmid, and obtaining plasmid pTD-thrB A1G for knocking down thrB gene.
1-4: Preparation of M2 competent cells and transformation pCas plasmid
Dipping a small amount of M2 bacterial liquid by an inoculating loop from a glycerol cryopreservation tube, streaking on an antibiotic-free LB solid medium, and culturing overnight in a constant temperature incubator at 37 ℃ (14-16 h); single colony on the plate is picked and inoculated into a test tube containing 5mL LB culture medium, and the culture is carried out in a shaking incubator at a constant temperature of 200rpm at 37 ℃ for overnight (14-16 h); 1mL of bacterial liquid is absorbed and transferred into 50mL of non-antibiotic LB culture medium (the bacterial liquid amount is 2%), shaking culture is carried out at the constant temperature of 37 ℃ and 200rpm until the OD 600 is between 0.4 and 0.6, and the shaking bottle is taken out and placed on ice for 10 to 15min; pouring the bacterial liquid into a 50mL centrifuge tube under the aseptic condition, centrifuging at 4 ℃ and 4000rpm for 10min to collect bacterial bodies, adding 20mL of 0.1M CaCl 2, re-suspending the bacterial bodies in ice, and carrying out ice bath for 30min; the cells were collected by centrifugation at 4000rpm for 10min at 4℃and 1mL of a pre-chilled sterile solution containing 0.1M CaCl 2 and 15% glycerol was added, and the cells were resuspended and then packed into 1.5mL sterile ep tubes (100. Mu.L per tube) to give M2 competent cells. 3 mu L pCas plasmid (ADDGENE PLASMID # 62225) is placed into a centrifuge tube containing 100 mu L M2 competent cells, ice bath is carried out for 30min, heat shock is carried out for 90s at 42 ℃ for 2-3min (rapid placement and timing), 700 mu L LB culture solution is added into an ultra-clean workbench after ice bath is carried out for 2-3min, an incubator at 30 ℃ is used for 2.5-3h, centrifugation is carried out for 2-3min at 5000rpm, 200 mu L supernatant is taken, the supernatant is coated on a plate containing 50mg/L kanamycin after heavy suspension, and culture is carried out for 12-20h at 30 ℃ to obtain the M2/pCas strain.
1-5: Preparation of M2/pCas competent cells and transformation of pTD-thrB A1G plasmid completion of thrB Gene knockout Single colonies were picked from the M2/pCas plates of steps 1-4, inoculated into 10mL LLB tubes containing 50mg/L kanamycin and 100. Mu.L 1M arabinose, incubated at 30℃for 12-20h, 200. Mu.L were inoculated into LLB shake flasks, and the same final concentrations of kanamycin and arabinose were added as well, incubated at 30℃for 3-4h until OD 600 was between 0.4-0.6. The precooled bacterial liquid is centrifuged for 2min at 4 ℃ and 4000 rpm. The supernatant was discarded, an equal volume of pre-chilled sterile ultra-pure water was added, and after resuspension, centrifuged at 4500rpm for 2min at 4 ℃. This procedure was repeated twice, and pre-chilled 10% glycerol was added and the mixture was resuspended in 1.5mLep tubes (100. Mu.L per tube) to obtain M2/pCas competent cells. Adding 10 mu L of the plasmid pTD-thrB A1G in the step 1-3 into an ultra-clean bench, uniformly mixing for 1min in an ice bath, transferring to a precooled 2mm electric shock cup, placing into an electric transfer instrument, rapidly completing electric shock by using ECO2 gear, adding 1mL of precooled LLB culture medium into a groove of the electric shock cup after electric shock is completed, sucking all bacterial liquid to a 2mL sterile ep tube by the inclined electric shock cup, and resuscitating for 3h at 30 ℃ at 180 rpm. Centrifugation at 5000rpm for 2-3min, taking 200 μl of supernatant, re-suspending, and plating onto a plate containing spectinomycin and kanamycin, and culturing at 30deg.C for about 24 hr. The verification primers thrB A1G -YZF and thrB A1G -YZR in Table 2 are designed at the position of about 100bp outside Donor DNA, single colony on a flat plate is selected as a template, colony PCR verification is carried out, after agarose gel electrophoresis detection, PCR products are sent to the company of the Optimus in the Qingzhou, sequencing is further verified, and thrB gene knocking-down is completed.
1-6: Elimination of pTD-thrB A1G plasmid and pCas plasmid
Positive clones were inoculated into 10mL LLB tubes containing kanamycin, 10. Mu.L of 1M IPTG mother liquor was added, and the mixture was left to stand at 30℃for 8-16h in a shaker at 180 rpm; streaking on kanamycin LLB solid medium, and culturing overnight at 30deg.C; numbering single colonies, picking part of the single colonies by using a small gun head, respectively streaking on LLB solid culture media of kanamycin and spectinomycin, and respectively placing the single colonies at 30 ℃ and 37 ℃ for overnight culture; single colonies which failed to grow in the region corresponding to the LLB solid medium of spectinomycin were those which were successfully deleted by pTD-thrB A1G, i.e., M2 thrB A1G/pCas. Clone M2 thrB A1G/pCas, from which pTD-thrB A1G was successfully eliminated, was inoculated into 10mL of non-resistant LLB tubes and incubated at 37℃for 8-16h with shaking at 180 rpm; streaking on a non-resistant LLB solid medium, and culturing overnight at 37 ℃; numbering single colonies, picking part of single colonies by using a small gun head, respectively streaking on kanamycin and a non-resistant LLB solid culture medium, and respectively placing the single colonies at 30 ℃ and 37 ℃ for culture overnight; the single colony incapable of growing in the area corresponding to the LLB solid medium without resistance is a clone which is eliminated successfully by pCas, namely the strain M2 thrB A1G.
1-7: Preparation of M2 thrB A1G competent cell transformation pAm plasmid
The strain M2 thrB A1G of steps 1-6 was transformed into plasmid pAm to obtain M2 thrB A1G competent cells according to the method for preparing M2 competent cells described in 1-4 to obtain strain E.coli W3110M 2 thrB A1G/pAm.
1-8: Recombinant strain shake flask fermentation and yield detection
To verify the ability of the strain E.coli W3110M 2 thrB A1G/pAm obtained in steps 1-7 to produce L-methionine, single colonies E.coli W3110M 2 thrB A1G/pAm were picked up and inoculated in 10LB tubes, incubated overnight at 37℃with shaking table 180rpm, transferred to sterilized MS fermentation medium at 5% transfer rate, while adding 0.2g,0.1M IPTG 20. Mu.L (final concentration 0.1 mM); 50g/L Kan 20. Mu.L (final concentration 50 mg/L); VB 12 at 0.2g/L (final concentration 0.2 mg/L); 10g/L lysine 20. Mu.L (final concentration 0.01 g/L). Each strain was cultured in triplicate at 30℃in a shaker at 180rpm for 48 hours. After fermentation, 2mL of fermentation broth was taken, centrifuged at 12000rpm for 2min, the supernatant was used for high performance liquid chromatography to detect the yield of L-methionine, and the precipitate was used for detecting OD 600. The results are shown in FIG. 2, wherein M2/pAm represents E.coli W3110M 2/pAm and M2 thrBA G/pAm represents recombinant strain E.coli W3110M 2 thrB A1G/pAm.
As can be seen from FIG. 2, the starting strain M2/pAm of this example produced L-methionine with a yield of 2.4g/L, and when thrB gene was knocked down on the genome by substitution of the initiation codon, a threonine-branching-pathway-impaired strain was obtained, which had not grown poorly after shake flask fermentation with the addition of antibiotics, had OD 600 up to 5.02 and 5.75, respectively, and had a yield of 2.63g/L of L-methionine after substitution of the initiation codon of thrB gene. This suggests that attenuation of the threonine pathway leads to reduced consumption of homoserine and thus more L-methionine production.
EXAMPLE 2 construction of recombinant E.coli strain E.coli W3110M 2/pAm-sucA and shake flask fermentation this example was followed by construction of recombinant E.coli strain E.coli W3110M 2/pAm-sucA and shake flask fermentation.
The specific operation is as follows:
2-1: construction of pAm-sucA plasmid
Extracting plasmid pA (pAm) as a template, carrying out PCR (polymerase chain reaction) amplification by using linearization primers PAM-F and PAM-R in table 2, carrying out agarose gel electrophoresis detection on amplified PCR products, observing the size of a strip by using a gel imager, and recovering the PCR products after the strip is correct, thus obtaining linearization pA HAm; designing primers sucA-1 and sucA-2 by taking a wild type W3110 genome as a template to amplify a complete sucA fragment; primers 99A-F/99A-R of table 2 were designed to obtain linearized pTrc99A fragments in the same manner as linearized pA HAm; through NanjinouzanMultiS One Step Cloning Kit carrying out recombinant seamless cloning by using a kit; transforming the product into DH5 alpha competence, carrying out colony PCR verification and sequencing correctly on single colony, extracting plasmid pTrc99A-sucA, and carrying out PCR amplification by taking the plasmid as a template and RBS-sucA-1 and RBS-sucA-2 as primers in table 2 to obtain a sucA fragment connected with RBS on the pTrc99A plasmid, namely RBS-sucA; and (3) performing seamless cloning on the obtained linearization pA HAm fragment and RBS-sucA fragment, converting the obtained linearization pA HAm fragment and RBS-sucA fragment into DH5 alpha competence, performing colony PCR verification and sequencing correctness on single colony by using primers sucA-F and sucA-R in Table 2, and extracting plasmids to obtain pAm-sucA plasmids.
2-2: Obtaining E.coli W3110M 2/pAm-sucA Strain
3 Mu L of plasmid pAm-sucA obtained in the step 2-1 is placed in an ep tube containing 100 mu L M < 2 > competent cells obtained in the step 1-4, ice bath is carried out for 30min, heat shock is carried out for 90s at 42 ℃ (rapid placement and timing), 700 mu LLB culture solution is added into an ultra clean workbench after 2-3min, an incubator at 37 ℃ is used for 1-1.5h,5000rpm is used for centrifugation for 2-3min, 200 mu L of supernatant is taken, the supernatant is coated on a plate containing 50mg/L kanamycin after resuspension, and E.coli W3110M 2/pAm-sucA strain can be obtained after 12-20h culture at 37 ℃.
The results of shake flask fermentation and detection of the production strain E.coli W3110M 2/pAm-sucA constructed in step 2-2 were performed as in steps 1-7 of example 1, and the results of L-methionine content in E.coli W3110M 2/pAm control, OD 600 and supernatant of fermentation broth are shown in FIG. 3. In FIG. 3, M2/pAm-sucA represents the recombinant strain E.coli W3110M 2/pAm-sucA.
As is clear from FIG. 3, the L-methionine production was increased from 2.4g/L to 2.62g/L after the sucA gene was overexpressed by the plasmid, and thus it was presumed that the supply of succinyl-CoA was another limiting factor, and methionine synthesis was significantly enhanced after the gene was overexpressed.
EXAMPLE 3 construction of recombinant E.coli Strain E.coli W3110M 2 thrB A1G/pAm-sucA-metZ the construction of recombinant E.coli strain E.coli W3110M 2 thrB A1G/pAm-sucA-metZ and shake flask fermentation were carried out.
The specific operation is as follows:
3-1: construction of pAm-sucA-metZ plasmid
Extracting plasmid pAm-sucA obtained in the step 2-1 of example 2 as a template, carrying out PCR amplification by using linearization primers AZ-F and AZ-R in the table 2, carrying out agarose gel electrophoresis detection on amplified PCR products, observing the size of a strip by using a gel imager, and recovering the PCR products after the strip is correct, thus obtaining linearization pAm-sucA; designing primers metZ-1 and metZ-2 to amplify complete metZ fragments by using the genome of the strain Chromobacterium violaceum as a template; primers 99A-F/99A-R of table 2 were designed to obtain linearized pTrc99A fragments in the same manner as linearized pA HAm; through NanjinouzanMultiS One Step Cloning Kit carrying out recombinant seamless cloning by using a kit; transforming the product into DH5 alpha competence, carrying out colony PCR verification and sequencing correctly on single colony, extracting plasmid pTrc99A-metZ, and carrying out PCR amplification by taking the plasmid as a template and taking RBS-metZ-1 and RBS-metZ-2 as primers in table 2 to obtain a metZ fragment connected with RBS on the pTrc99A plasmid, namely RBS-metZ; the linearized pA HAm fragment and RBS-metZ fragment obtained above were subjected to seamless cloning and transformed into DH 5. Alpha. Competence, and after colony PCR verification and sequencing were correct, the plasmid was extracted by using primers metZ-F and metZ-R of Table 2, thus obtaining pAm-sucA-metZ plasmid.
3-2: Construction of pAm-sucA-metZ plasmid
Extracting plasmid pAm-sucA-metZ as a template, carrying out PCR amplification by using linearization primers AZ-1 and AZ-2 in Table 2, detecting amplified PCR products by agarose gel electrophoresis, observing the size of a strip by using a gel imager, recovering the PCR products after the strip is correct, converting the strip into DH5 alpha competence, and extracting the plasmid after colony PCR verification and sequencing are correct by using primers metZ-F and metZ-R in Table 2 on a single colony, namely pAm-sucA-metZ Q306A/A311G plasmid; extracting plasmid pAm-sucA-metZ Q306A/A311G as a template, carrying out PCR amplification by using linearized primers AZ-3 and AZ-4 in table 2, introducing double mutation, detecting amplified PCR products by agarose gel electrophoresis, observing the size of the bands by using a gel imager, recovering the PCR products after the bands are correct, converting into DH5 alpha competence, carrying out colony PCR verification and sequencing by using primers metZ-F and metZ-R in table 2 on single colony, and extracting the plasmid to obtain plasmid pAm-sucA-metZ Q306A/A311G/R365A, namely plasmid pAm-sucA-metZ.
3-3: Obtaining pAm-sucA-metZ plasmid constructed in step 3-2 by taking 3 mu L of E.coli W3110M 2/pAm-sucA-metZ strain and E.coli W3110M 2thrB A1G/pAm-sucA-metZ strain, respectively placing the plasmid into ep tubes containing 100 mu L M2 competent cells obtained in step 1-4 and M2thrB A1G competent cells obtained in step 1-7, carrying out heat shock at 42 ℃ for 90s (quick placement and timing), adding 700 mu L of LB culture solution in an ultra-clean workbench after 2-3min of ice bath, centrifuging at 37 ℃ for 2-3min at 500 rpm, taking 200 mu L of supernatant, respectively coating the supernatant on plates containing 50mg/L, and carrying out culture at 37 ℃ for 12-20h to obtain E.coli W3110M 2/pAm-sucA-metZ strain and E.coli W3110/37-metZ strain.
Shake flask fermentation and detection were performed on the production strains E.coli W3110M 2/pAm-sucA-metZ and E.coli W3110M 2thrB A1G/pAm-sucA-metZ constructed in steps 3-3, according to example 1, steps 1-7, with E.coli W3110M2/pAm as control group, and the results of the L-methionine content detection in the supernatants of the OD 600 and fermentation broth as shown in FIG. 4, wherein M2/pAm-metZ represents recombinant strain E.coli W3110M2/pAm-metZ, M2/pAm-metZ represents E.coli W3110M2/pAm-metZ, M2/pAm-sucA-metZ represents E.coli W3110M2/pAm-metZ, and M2/pAm-sucA-metZ represents E.coli W3110M 2/pAm-35.
FIG. 4 shows that overexpression of exogenous metZ on plasmid enhances the L-homoserine to homocysteine production pathway, and mutation of the amino acid sequence Q306A/A311G/R365A of the enzyme improves the catalytic performance of the enzyme, and enhancement of succinyl CoA production can obviously increase methionine yield to 2.85G/L. Thus, transformation of plasmid pAm-sucA-metZ, which overexpresses sucA and metZ, into threonine pathway-impairing strain M2thrB A1G, as shown in fig. 4M2thrBA G/pAm-sucA-metZ, was effective in reducing threonine accumulation and directing the metabolic flux of intracellular homoserine in the direction of L-methionine synthesis, well balancing the metabolic fluxes of the branched pathway and L-methionine synthesis pathway, and finally the L-methionine production reached 3G/L.
EXAMPLE 4 construction of recombinant E.coli strain E.coli W3110M 2/pAm-HS and shake flask fermentation this example was followed by construction of recombinant E.coli strain E.coli W3110M 2/pAm-HS and shake flask fermentation.
The specific operation is as follows:
4-1: construction of pAm-HS plasmid
Extracting plasmid pAm as a template, and linearizing the pAm plasmid by using a linearization primer PAM-1/PAM-2 shown in Table 2 to obtain a linearization fragment 1pAm; plasmid R1 was extracted as template and fragment 1HS was obtained for ligation with linearized pAm using primers HS-1/HS-2 of Table 2; the obtained linearization 1pAm and fragment 1HS are subjected to seamless cloning and are transformed into DH5 alpha competence, single colony is subjected to colony PCR verification and sequencing correctness by using the primers Pam-YZ-F and Pam-YZ-R in the table 2, and plasmids are extracted, namely plasmids with pAm plasmids inserted into a hok/sok system: pAm-HS plasmid.
4-2: Obtaining E.coli W3110M 2/pAm-HS Strain
3 Mu L of pAm-HS plasmid constructed in the step 4-1 is taken and placed into an ep tube containing 100 mu L M < 2 > competent cells obtained in the step 1-4, the ice bath is carried out for 30min, the temperature is 42 ℃ for 90s (rapid placement and timing), 700 mu LLB culture solution is added into an ultra-clean workbench after 2-3min, an incubator at 37 ℃ is 1-1.5h and centrifugation is carried out for 2-3min at 5000rpm, 200 mu L of supernatant is taken, the supernatant is coated on a plate containing 50mg/L kanamycin after resuspension, and E.coli W3110M 2/pAm-HS strain can be obtained after culturing for 12-20h at 37 ℃.
The production strain E.coli W3110M 2/pAm-HS constructed in step 4-2 was subjected to shake flask fermentation and yield detection for 20 batches of strain E.coli W3110M 2/pAm according to steps 1-7 of example 1; for M2/pAm-HS, the strain was subjected to 5 batches of shake flask fermentation without antibiotic addition and yield detection. The L-methionine content of the fermentation supernatant is shown in FIG. 5, and FIG. 5A represents the L-methionine production of the starting strain, M2/pAm, in 20 kanamycin-resistant shake flask fermentations, abbreviated as M2; FIG. 5B represents the L-methionine production after 5 antibiotic-free shake flask fermentations with strain E.coli W3110M 2/pAm-HS, which is abbreviated as HS.
As can be seen from FIG. 5A, the initial strain had a methionine production of up to 2.8g/L and a minimum of 1.6g/L in 20 antibiotic-added shake flask fermentations, and the fermentation performance was seen to be unstable for the different batches. FIG. 5B shows that after shake flask fermentation without antibiotic addition, the stability of the pAm-HS plasmid is better and stable production of L-methionine at the shake flask level can be achieved without antibiotic addition, demonstrating that insertion of the toxin-antitoxin system into pAm is more beneficial for plasmid stability and stable production of L-methionine.
EXAMPLE 5 construction of recombinant E.coli Strain E.coli W3110M 2 thrB A1G/pAm-sucA-metZ-HS construction of recombinant E.coli strain E.coli W3110M 2 thrB A1G/pAm-sucA-metZ-HS and shake flask fermentation were performed.
The specific operation is as follows:
5-1: construction of pAm-sucA-metZ-HS plasmid
Extracting plasmid pAm-sucA-metZ obtained in step 3-2 of example 3 as a template, linearizing pAm-sucA-metZ plasmid using linearization primer pAm-1/pAm-2 of table 2 to obtain linearized fragment pAm-sucA-metZ; plasmid R1 was extracted as template, and fragment 1HS was obtained for ligation with linearized pAm-sucA-metZ using primers HS-1/HS-2 of Table 2; the obtained linearized pAm-sucA-metZ fragments and fragment 1HS were subjected to seamless cloning and transformed into DH 5a competence, and after colony PCR verification and sequencing were correct by single colony using primers pAm-YZ-F and pAm-YZ-R of table 2, plasmids were extracted, namely plasmid pAm-sucA-metZ-HS plasmids inserted into the hok/sok system.
5-2: Obtaining E.coli W3110M 2 thrB A1G/pAm-sucA-metZ-HS Strain
And 3 mu L of pAm-sucA-metZ-HS plasmid constructed in the step 5-1 is transformed into M2 thrB A1G competent cells obtained in the step 1-7, and cultured for 12-20h at 37 ℃ to obtain E.coli W3110M 2 thrB A1G/pAm-sucA-metZ-HS strain.
The M2/pAm, E.coli W3110M 2thrB A1G/pAm-sucA-metZ obtained in step 3-3 and E.coli W3110M 2thrB A1G/pAm-sucA-metZ-HS strains obtained in step 5-2 were subjected to shake flask fermentation with/without antibiotic addition, respectively, and the content of L-methionine in the supernatant was examined. The OD 600 and the L-methionine content of the supernatant of the fermentation broth are shown in FIG. 6, wherein B/AZK and B/AZW in FIG. 6 represent recombinant E.coli W3110M 2thrB A1G/pAm-sucA-metZ strain fermented with and without kanamycin addition, and B/AZHSK and B/AZHSW represent E.coli W3110M 2thrB A1G/pAm-sucA-metZ strain fermented with/without kanamycin addition, respectively.
As can be seen from FIG. 6, the recombinant plasmid contained in the optimal recombinant strain can still realize stable production of L-methionine without adding antibiotics after introducing a toxin-antitoxin system hok/sok, and is stable at 3.00+/-0.02 g/L, which further shows that the introduction of the hok/sok system on the plasmid is favorable for the stable production of L-methionine by recombinant escherichia coli.
The raw materials and equipment used in the invention are common raw materials and equipment in the field unless specified otherwise; the methods used in the present invention are conventional in the art unless otherwise specified.
The foregoing description is only a preferred embodiment of the present invention, and is not intended to limit the present invention, and any simple modification, variation and equivalent transformation of the above embodiment according to the technical substance of the present invention still fall within the scope of the technical solution of the present invention.

Claims (10)

1. A genetically engineered bacterium for stably producing L-methionine is characterized in that: the genetically engineered bacterium is obtained by knocking down thrB genes on chassis bacterium genome, overexpressing sucA genes and metZ genes, and introducing a toxin-antitoxin system hok/sok.
2. The genetically engineered bacterium for stably producing L-methionine according to claim 1, wherein: the Chassis bacteria is E.coli W3110 ΔmetJ ΔmetI ΔlysA Trc-metH Trc-metF Trc-cysE Trc-serB Trc-serC/pA.
3. The genetically engineered bacterium for stably producing L-methionine according to claim 1, wherein: the thrB gene nucleotide sequence of the chassis fungus genome after knocking down is shown as SEQ ID No.1, the sucA gene nucleotide sequence is shown as SEQ ID No.2, and the nucleotide sequence of the toxin-antitoxin system hok/sok is shown as SEQ ID No. 4.
4. The genetically engineered bacterium for stably producing L-methionine according to claim 1, wherein: the metZ gene encodes an amino acid sequence obtained by mutating the amino acid sequence encoded by the metZ gene derived from Chromobacterium violaceum:
(a) Glutamine at position 306 is mutated to alanine;
(b) Alanine at position 311 is mutated to glycine;
(c) Arginine at position 365 is mutated to alanine.
5. The genetically engineered bacterium for stably producing L-methionine according to claim 4, wherein: the metZ gene nucleotide sequence is shown in SEQ ID No. 3.
6. The method for constructing a genetically engineered bacterium according to any one of claims 1 to 5, wherein: the method comprises the following steps:
(1) Knocking down thrB gene on chassis fungus genome;
(2) Overexpressing the sucA gene from E.coli W3110 on the plasmid and transforming into Chaetomium;
(3) The metZ gene from Chromobacterium violaceum was overexpressed on the plasmid and mutated and then transformed into Chaetomium;
(4) Introducing a toxin-antitoxin system hok/sok on the plasmid, and then converting the bacterial strain into chassis bacteria to obtain the genetically engineered bacteria.
7. The method of construction of claim 6, wherein: the thrB gene knocking-down method comprises the following steps: the initiation codon ATG of thrB gene was mutated to GTG.
8. The method of construction of claim 6, wherein: after metZ gene mutation, the encoded amino acid sequence was mutated at the following positions relative to the amino acid sequence encoded by metZ gene:
(a) Glutamine at position 306 is mutated to alanine;
(b) Alanine at position 311 is mutated to glycine;
(c) Arginine at position 365 is mutated to alanine.
9. The method of construction of claim 6, wherein: the chassis bacteria is E.coli W3110 DeltametJ DeltaMetI DeltalysA Trc-metH Trc-metF Trc-cysE Trc-serB Trc-serC/pA Ham; the plasmid is pAm.
10. The use of the genetically engineered bacterium according to any one of claims 1 to 5 or the genetically engineered bacterium constructed by the construction method according to any one of claims 6 to 9 in the production of L-methionine.
CN202410095126.5A 2024-01-23 2024-01-23 Genetically engineered bacterium for stably producing L-methionine and construction method and application thereof Pending CN118048285A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202410095126.5A CN118048285A (en) 2024-01-23 2024-01-23 Genetically engineered bacterium for stably producing L-methionine and construction method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202410095126.5A CN118048285A (en) 2024-01-23 2024-01-23 Genetically engineered bacterium for stably producing L-methionine and construction method and application thereof

Publications (1)

Publication Number Publication Date
CN118048285A true CN118048285A (en) 2024-05-17

Family

ID=91051259

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202410095126.5A Pending CN118048285A (en) 2024-01-23 2024-01-23 Genetically engineered bacterium for stably producing L-methionine and construction method and application thereof

Country Status (1)

Country Link
CN (1) CN118048285A (en)

Similar Documents

Publication Publication Date Title
US20200347419A1 (en) Recombinant bacterium capable of producing l-lysine, construction method thereof and production method of l-lysine
JP2021500914A5 (en)
CN109055289B (en) Recombinant escherichia coli for high yield of L-methionine and application thereof
CN114874964B (en) Construction method and application of recombinant escherichia coli for high yield of 2&#39; -fucosyllactose
EP2824186A1 (en) L-lysine generation method by fermenting bacteria having modified aconitase gene and/or regulatory element
CN113736719B (en) Corynebacterium glutamicum genetic engineering bacteria and application thereof in spermidine production
CN112126615B (en) Butyric acid producing bacillus subtilis and construction method and application thereof
CN106635945B (en) Recombinant strain, preparation method thereof and method for producing L-threonine
CN114854659B (en) Ergothioneine production process and application thereof
CN104845995A (en) Method for dynamic regulation and control of threonine efflux transport protein gene expression for production of L-threonine
CN118048285A (en) Genetically engineered bacterium for stably producing L-methionine and construction method and application thereof
CN112779200B (en) Genetically engineered bacterium for high yield of L-methionine and construction and application thereof
CN113564093B (en) Escherichia coli and application thereof in high-yield preparation of D-proline
CN113583930B (en) Construction of corynebacterium glutamicum which is independent of antibiotics and can efficiently produce gamma-aminobutyric acid
CN116064345A (en) Non-antibiotic genetic engineering bacteria for efficiently producing fucosyllactose and application thereof
CN114317582A (en) Method for improving stability of arginine producing capacity of strain
CN114606253B (en) Recombinant escherichia coli capable of high yield of L-methionine under action of no exogenous amino acid and application thereof
CN117844728B (en) L-valine production strain and construction method and application thereof
CN116042682B (en) Engineering bacterium for producing 2&#39; -fucosyllactose, construction method and application thereof
US20240018557A1 (en) Recombinant nucleic acid of escherichia coli, recombinant escherichia coli and culturing method thereof, and method for biosynthesizing l-threonine thereby
CN114107159B (en) High-yield beta-alanine producing strain, construction method and application
CN116836904A (en) Genetically engineered bacterium for high-yield of L-cysteine, construction method and application
CN117327636A (en) Genetically engineered bacterium for producing O-succinyl-L-homoserine, construction method and application
CN118126922A (en) L-threonine production strain, construction method and application thereof
CN118147034A (en) Genetically engineered bacterium for high-yield of L-cysteine, construction method and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination