CN113528506B

CN113528506B - DNA inversion system and application thereof and target DNA inversion method

Info

Publication number: CN113528506B
Application number: CN202110779459.6A
Authority: CN
Inventors: 吴毅; 元英进; 韩佩言; 付宗恒; 马渊; 周晓
Original assignee: Tianjin University
Current assignee: Tianjin University
Priority date: 2021-07-09
Filing date: 2021-07-09
Publication date: 2022-12-20
Anticipated expiration: 2041-07-09
Also published as: CN113528506A

Abstract

The invention relates to the technical field of genetic engineering, and discloses application of a DNA inversion system and a target DNA inversion method. Under the action of the Rci enzyme with continuous directional mutation, the target DNA between two sfxa101 sites which are arranged in a reverse direction is mediated to only carry out reversal reaction, so that deletion reaction is avoided, and even if the same-direction sfxa101 sites exist, the generation efficiency of the deletion reaction is very low relative to the generation efficiency of the reversal reaction. The DNA inversion system and the inversion method of the invention can realize inversion of DNA fragments between sites without deletion, can avoid adverse effects caused by deletion, can further generate an inversion library, and realize changing the sequence and direction of a plurality of DNA elements, thereby ensuring that the length is unchanged.

Description

DNA inversion system and application thereof and target DNA inversion method

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a DNA inversion system, application thereof and a target DNA inversion method.

Background

DNA rearrangement mediated by site-specific recombination plays an important role in creating biodiversity. Such natural systems include: in developing lymphocytes, V (D) J recombination mediated by RAG recombinase produces distinct antigen receptors; in E.coli 15T-, the p15BMin system, mediated by Min convertase, leads to the selective expression of various tail fiber genes. Also, various artificial systems for DNA rearrangement have been developed, for example, synthetic chromosomal rearrangements and modifications can be made in the synthetic yeast genome (Sc2.0) by the LoxPsym-mediated evolution of the SCRAMBLE system; and Cre recombinase-mediated multiple loxp site barcode systems (Brainbow and Polylox systems), can randomly generate diversity of chromosomal structural variations, and generate a vast barcode library.

The DNA rearrangement system described above can be diversified by site-specific recombination-mediated deletions, inversions and other structural variations. However, deletions in DNA rearrangement systems may play a negative role. For example, the deletion of large chromosomal segments mediated by scrramble will often result in high lethality in cells in which scrramble occurs. For the Cre recombinase-mediated barcode approach, cre is inherently prone to deletion rather than inversion, resulting in reduced barcode diversity. The site-specific DNA inversion system mediates inversion reaction between only two sites arranged in reverse, while almost no deletion reaction occurs between two sites arranged in the same direction. The site-specific DNA inversion system can effectively solve adverse effects caused by deletion. To date, site-specific DNA inversion systems exist only in bacteria and bacteriophages. Therefore, there is a strong need to develop a similar site-specific DNA inversion system in eukaryotes.

Disclosure of Invention

In view of the above, the present invention provides a DNA inversion system, which belongs to the Rci enzyme/sfxa 101 site composition, and can be applied in mediating target DNA inversion, and can also realize changing the sequence and direction of multiple DNA elements, while ensuring the length is unchanged, to generate an inversion library;

it is another object of the present invention to provide a method for inverting a high ratio of a target DNA based on the Rci/sfxa101 system and a method for generating a DNA inversion library.

In order to achieve the above purpose, the invention provides the following technical scheme:

a DNA inversion system comprising a sfxa101 site sequence, and an Rci enzyme and/or its coding sequence; the sfxa101 site sequence is a double-stranded nucleotide sequence with one strand sequence shown as SEQ ID No.1, the Rci enzyme sequence is an amino acid sequence shown as SEQ ID No.2 or SEQ ID No.3, and the coding sequence of the Rci enzyme is a nucleotide sequence capable of coding the amino acid sequence shown as SEQ ID No.2 or SEQ ID No. 3.

The 31bp sequence of the sfxa101 site consists of a 7bp spacer sequence, a 12bp right arm sequence and a 12bp left arm sequence, the nucleotide sequence shown in SEQ ID NO.1 is one strand of the sfxa101 site, one strand of the sfxa101 site sequence in the opposite direction is shown in SEQ ID NO.5, and the sequences of the two sfxa101 sites in different directions are shown in the attached drawing 1. Meanwhile, the invention continuously and directionally evolves the Rci enzyme, under the action of the Rci8 enzyme of the amino acid sequence shown in SEQ ID NO.2, the ratio of the reversal efficiency and the deletion efficiency of the system is extremely high, and even if the deletion reaction hardly occurs between two sfxa101 site sequences arranged in the same direction, the purpose that the reversal ratio is obviously higher than the deletion ratio under the catalysis of the enzyme is realized, and in practical application, if only the sfxa101 site sequences in opposite directions are arranged, the reversal can be only mediated. Meanwhile, the ratio of the reverse efficiency to the deletion efficiency under catalysis of the Rci26 enzyme of the amino acid sequence shown in SEQ ID NO.3 is also high.

In a specific embodiment of the invention, the nucleotide sequence capable of encoding the amino acid sequence shown in SEQ ID NO.2 is shown in SEQ ID NO. 4.

Preferably, the sfxa101 site sequence and the coding sequence of the Rci enzyme can also exist in the form of expression vectors, for example, the target DNA, the sfxa101 site sequence and the coding sequence of the Rci enzyme are inserted into a vector plasmid, and then transformed into recipient cells (yeast cells, eukaryotic cells such as HEK-293T cells).

In order to verify the effect of the DNA inversion system, the invention verifies the target DNA inversion in eukaryotic cells on a plasmid vector and a chromosome respectively by virtue of the indication effects of a screening label and fluorescent protein, and the result shows that the Rci8 enzyme/Rci 26 enzyme is expressed in yeast cells in a plasmid vector mode, the ratio of the target DNA inversion efficiency to the deletion efficiency is respectively about 4320 and 1195, good inversion specificity is embodied, and the site-specific DNA inversion system is successfully constructed on yeast plasmids;

the target DNA inversion result directly on the yeast chromosome shows that the ratio of the inversion efficiency to the deletion efficiency under the catalysis of Rci8 enzyme is about 960, and good inversion specificity is also embodied, thus proving that a site-specific DNA inversion system is successfully constructed on the yeast chromosome;

in order to prove that other eukaryotic cells can also use the inversion system, the plasmid vector is introduced into the animal cell HEK-293T, fluorescent protein is taken as an indicator, and the result shows that transfected cells of a plurality of experimental groups turn green (indicating inversion), while green cells are hardly observed in a control group, and the inversion reaction is proved to occur in the cells. Quantitative analysis by flow cytometry showed that about 21.8% of the 293T cells turned green and about 0.24% of the cells turned red (indicating deletion) and verified by PCR and Sanger sequencing. These results indicate that the Rci/sfxa101 system can mediate DNA recombination with strong directional bias, leading to predominant inversion between reverse sfxa101 sites in mammalian cells, and successfully construct a site-specific DNA inversion system in animal cells.

Based on the technical effects, the invention provides the application of the DNA inversion system in mediating target DNA inversion and the application in constructing a DNA inversion library.

According to the application, the invention also provides a target DNA inversion method, which comprises the following steps:

step 1, inserting two sfxa101 site sequences in opposite directions into two ends of a target DNA respectively;

and 2, transferring a vector capable of expressing the Rci enzyme into a receptor cell where the target DNA is located, wherein the expressed Rci enzyme acts on the target DNA between two sfxa101 sites in opposite directions to generate inversion.

Meanwhile, the invention also provides a method for constructing the DNA inversion library, which comprises the following steps:

step 1, inserting two sfxa101 site sequences in opposite directions into two ends of a plurality of target DNAs to be inverted;

and 2, transferring a vector capable of expressing the Rci enzyme into a receptor cell where the target DNA is located, wherein the expressed Rci8 enzyme acts on the target DNA between two sfxa101 sites in opposite directions to generate inversion.

In order to mediate only the inversion of DNA retrogradation and avoid deletion, the sequences of the adjacent sfxa101 sites were in opposite directions.

In both methods, the target DNA may be on the chromosome of the recipient cell or may be introduced into the recipient cell in the form of an insertion vector, and the latter method is usually a method of inverting the target DNA in the fragment of the constructed multifunctional fragment.

According to the technical scheme, the invention provides the Rci enzyme/sfxa 101 site-based DNA inversion system, under the action of the Rci enzyme with continuous directional mutation, the target DNA between two oppositely arranged sfxa101 sites is mediated to only undergo inversion reaction, deletion reaction is avoided, and even if the equidirectional sfxa101 sites exist, the generation efficiency of the deletion reaction is very low relative to that of the inversion reaction. The DNA inversion system and the inversion method of the invention can realize inversion of DNA fragments between sites without deletion, can avoid adverse effects caused by deletion, can further generate an inversion library, and realize change of the sequence and direction of a plurality of DNA elements, thereby ensuring that the length is not changed.

Drawings

FIG. 1 shows a schematic diagram of sequences of two sfxa101 sites in opposite directions;

FIG. 2 shows a map schematic of plasmid pHPY004 and validation units on the plasmid; the right-angled arrow indicates a promoter, the triangle indicates an sfxa101 site sequence and the directionality thereof, the T-shaped symbol indicates a terminator, URA3 delta ATG indicates a URA3 tag sequence of a reverse start codon ATG knockout, and HIS3 delta ATG indicates an HIS3 tag sequence of the start codon ATG knockout;

FIG. 3 is a schematic representation of the inversion and deletion of the verification unit on plasmid pHPY 004;

FIG. 4 is a schematic diagram showing the inversion of a target DNA (i.e., reverse URA 3) on the Saccharomyces cerevisiae chromosome using the Rci8/sfxa101 system; the right-angled arrow indicates the promoter, the triangle indicates the sfxa101 site sequence and the orientation thereof, the T-shaped symbol indicates the terminator, clover indicates the green fluorescent protein coding sequence, and Clover + indicates that the cells are inverted in green; miRFP670 indicates the red fluorescent protein coding sequence, miRFP670+ indicates that the cell is red, and deletion occurs;

FIG. 5 is a schematic representation showing the verification of DNA inversion using fluorescent protein on the Pcep4 plasmid of HEK-293T cells;

FIG. 6 shows a map of plasmid pHPY007, which is an expression vector for expressing Rci8 enzyme;

FIG. 7 is a schematic representation of the number of colonies on different types of medium after inversion/deletion of plasmid pHPY004 into s.cerevisiae;

FIG. 8 is a graph showing PCR results for randomly selected 24 inverted s.cerevisiae strains;

FIG. 9 is a schematic representation of the number of colonies on different types of medium after inversion/deletion of the validation unit from the clone pHPY004 on the Saccharomyces cerevisiae chromosome;

FIG. 10 is a graph showing PCR results for randomly selected 12 inverted s.cerevisiae strains;

FIG. 11 is a micrograph showing the color change of HEK-293T cells after inversion/deletion;

FIG. 12 is a graph showing flow cytometry analysis of color changes in HEK-293T cells; green (lower right quadrant) indicates that inversion occurred; orange (upper right quadrant) indicates that the cells turn over to express green fluorescent protein CLOVER, and then delete to express mirFP670, at this time, CLOVER protein exists in the cells, and red and green are overlapped to orange, so that deletion is calculated as deletion occurring only by seeing a single channel mirFP + because of evaluating deletion ratio; red (upper left quadrant) indicates that deletion occurred; grey (lower left quadrant) indicates no inversion and deletion, and 78% of cells did not invert and delete due to the time problem for Rci enzyme expression.

Detailed Description

The embodiment of the invention discloses a DNA inversion system, application thereof and a target DNA inversion method, and a person skilled in the art can appropriately improve process parameters for realization by taking the contents into consideration. It is expressly intended that all such similar substitutes and modifications which would be obvious to those skilled in the art are deemed to be included within the invention. While the DNA inversion system and its application and target DNA inversion method of the present invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the art that the techniques of the present invention may be implemented and applied by modifying or appropriately changing or combining the DNA inversion system and its application and target DNA inversion method described herein without departing from the spirit, scope and spirit of the invention.

In the invention, two kinds of Rci enzymes are provided, namely Rci8 enzyme with an amino acid sequence shown in SEQ ID NO.2 and Rci26 enzyme with an amino acid sequence shown in SEQ ID NO. 3; compared with the Rci26 enzyme, the Rci8 enzyme is subjected to directional mutation optimization, and the ratio of the target DNA inversion efficiency to the deletion efficiency under the catalysis of the Rci8 enzyme is greatly improved; in the specific embodiment of the invention, the optimal Rci8 enzyme is basically adopted for relevant verification.

In the specific embodiment of the invention, URA3 and HIS3 screening labels (ATG initiation codon is knocked out) are used for constructing a plasmid vector for verifying the effect of reversal DNA, and the plasmid vector is introduced into yeast cells for verification, and a schematic diagram is shown in figure 2; on the plasmid vector, URA3 is inserted reversely, sfxa101 site sequences in opposite directions are inserted at two ends of the URA3, and a promoter Pyc 1 and an ATG initiation codon are arranged in front of the sfxa101 site sequence at the upstream of a reverse URA3 label; only setting a sfxa101 site sequence at the upstream of the HIS3 screening label, wherein the direction of the sfxa101 site sequence is the same as that of the sfxa101 site sequence at the upstream of the reverse URA3 label, and setting a terminator between the sfxa101 site sequence and the sfxa101 site sequence at the downstream of the reverse URA3 label;

the construction mode of the plasmid vector can intuitively reflect the reversal efficiency and deletion efficiency of the URA3 label as target DNA by means of SC-URA and SC-HIS culture media, when DNA reversal occurs between two reverse sfxa101 site sequences, the URA3 label can be normally expressed, but the HIS3 label cannot be expressed, and a colony can grow on the SC-URA culture media; when the DNA deletion occurs between the two homologous sfxa101 site sequences, the reverse URA3 tag is deleted, the HIS3 tag is normally expressed, and colonies can grow on the SC-HIS medium, and the schematic diagram is shown in FIG. 3.

In the same manner, the same inversion efficiency verification can also be performed by inserting the above-described verification unit into the yeast chromosome, as schematically shown in FIG. 4.

In addition, the invention also constructs a plasmid vector for verifying the effect of the reverse DNA through the fluorescent protein, and introduces the plasmid vector into animal cells HEK-293T for verification; similar to the previous validation unit in yeast cells, the reverse URA3 tag was replaced by the reverse green fluorescent protein sequence, the HIS3 tag was replaced by the red fluorescent protein sequence, the others remained the same, and for simplicity, the expression system for Rci8 enzyme was also inserted into the plasmid vector, whereas in the previous validation of yeast cells, a vector plasmid expressing Rci8 enzyme was transformed separately; when DNA inversion occurs between the two reverse sfxa101 site sequences, the green fluorescent protein can be normally expressed, and the red fluorescent protein can not be expressed, so that transfected cells can be imaged by a fluorescence microscope and detected by a flow cytometer; when DNA deletion occurs between the two sfxa101 site sequences in the same direction, the reverse green fluorescent protein sequence is deleted, the red fluorescent protein is normally expressed, and the transfected cells can be imaged by a fluorescence microscope and detected by a flow cytometer, and the schematic diagram is shown in fig. 5.

The plasmids pHPY004 and pHPY007 related by the invention are obtained by modifying the plasmids pRS416 and pRS415 sold in the market; for example, pHPY004 introduces pRS416 plasmid with the URA3 label knocked off as a basic plasmid into the verification unit in FIG. 3, the screening label can be selected to replace, increase or retain the original screening label of pRS416 plasmid according to actual situations, and the schematic diagram of the plasmid map is shown in FIG. 2; pHPY007 introduces an expression system of Rci8 enzyme by taking pRS415 plasmid as basic plasmid, uses Gal inducible promoter to conveniently control the expression of the Rci8 enzyme, a screening label can selectively replace, increase or retain the original screening label of the pRS415 plasmid according to actual situations, and a plasmid map schematic diagram is shown in figure 6.

The application of the DNA inversion system and a target DNA inversion method provided by the present invention are further described below.

Example 1: construction of eukaryotic site-specific DNA (deoxyribonucleic acid) inversion system on saccharomyces cerevisiae plasmid by using Rci8/sfxa101 system

1. pHPY004 plasmid and pHPY007 plasmid were introduced into BY4741 starting strain BY yeast transformation. The method comprises the following steps:

a) Selecting a BY4741 Saccharomyces cerevisiae single colony in a 5mLYPD liquid culture medium, and culturing overnight at 30 ℃;

b) OD600 of the culture solution of the overnight-cultured Saccharomyces cerevisiae was measured,inoculating overnight culture into 5mLYPD (0.125 OD) ₆₀₀ Ml), culturing at 30 deg.C and 220rpm until OD600 reaches 0.5 (about 3.5-4.5 hrs);

c) Sucking 1mL of saccharomyces cerevisiae culture solution into a 1.5mL of EP tube, centrifuging for 2min at 4000rpm, and collecting cells; resuspending the cells in 1mL of sterile water, centrifuging as above, and collecting the cells; resuspending the cells with 1mL of 0.1M LiOAc, centrifuging as above, and collecting the cells; remove 900. Mu.L of the supernatant by pipette, resuspend the cells with the remaining 100. Mu.L of LiOAc, and place on ice to obtain competent cells.

d) Preparing a transformation system:

the system is fully and uniformly mixed for standby.

e) Adding pHPY004 plasmid and pHPY007 plasmid into 100 μ L of yeast competent cells, respectively, blowing and sucking 2 μ L of the cells uniformly, adding the cells into a transformation system, and turning and mixing the cells uniformly up and down; incubating in an incubator at 30 ℃ for 30min; adding 90 mu LDMSO, turning over and mixing evenly; heat shock at 42 deg.C for 15min; centrifuging at 3600rpm for 30s, and collecting cells; the mixture was aspirated, and 400. Mu.L of 5mM CaCl was added ₂ Resuspending the cells, and standing for 5min; centrifuging at 3600rpm for 30s, sucking the supernatant, resuspending in sterile water, and screening with SC + HYG (hygromycin) screening medium.

After the yeast grows for 2 days on the screening culture medium, a single colony is inoculated in an SC-Leu + HYG liquid culture medium and cultured to be saturated at 30 ℃ and 220 rpm.

2. Taking 1mL of yeast, using ddH for thalli ₂ O-wash twice to wash out glucose, and then transfer to galactose medium for induction culture for 12 hours. Spreading the induced yeast cells on SC-URA and SC-HIS culture medium at appropriate dilution ratio, and culturing in 30 deg.C incubator for 3 days; the results are shown in FIG. 7, and the results in FIG. 7 show that a large number of colonies grew on SC-URA medium, while substantially no colonies grew on SC-HIS medium, indicating that the inversion system of the present invention achieved inversion of DNA fragments between sites with almost no deletion.

3. The Rci8/sfxa101 system was expressed, 24 colonies on SC-URA medium were randomly selected, the generation of new junctions was tested by PCR, the new junctions generated after inversion were analyzed by Sanger sequencing, and the results are shown in fig. 8; the reverse region Sanger sequencing results were as follows:

CATTAGGACCTTTGCAGCATAAATTACTATACTTCTATAGACACACAAACACAAATACACACACTAAATTAATAATGAAGGCAATACTTTCGTGCCAATCCGGTACGTGGTCGAAAGCTACATATAAGGAACGTGCTGCTACTCATCCTAGTCCTGTTGCTGCCAAGCTATTTAATATCATGCACGAAAAGCAAACAAACTTGTGTGC

the result shows that the ratio of the reversal efficiency to the deletion efficiency is about 4320, the good reversal specificity is embodied, and the site-specific DNA reversal system is successfully constructed on the saccharomyces cerevisiae plasmid.

In addition, the same experiment was carried out with the choice of the Rci26 enzyme (before targeted optimization) instead of the Rci8 enzyme, and the results showed that the ratio of inversion efficiency to deletion efficiency was approximately 1195.

Example 2: a eukaryotic site-specific DNA inversion system is constructed on a saccharomyces cerevisiae chromosome by utilizing an Rci8/sfxa101 system.

1. The fragment of the system cloned from pHPY004 (i.e.the validation unit shown in FIG. 3, length 4202 bp) was inserted by yeast homologous recombination into the X chromosome (position 639678 bp) in Saccharomyces cerevisiae, and the pHPY007 plasmid was simultaneously introduced.

2. Taking 1mL of yeast, using ddH for thalli ₂ O-wash twice to wash out glucose, and then transfer to galactose medium for induction culture for 12 hours. Spreading the induced yeast cells on SC-URA and SC-HIS culture medium at appropriate dilution ratio, and culturing in 30 deg.C incubator for 3 days; the results are shown in FIG. 9, and the results in FIG. 9 show that a large number of colonies grew on SC-URA medium, while substantially no colonies grew on SC-HIS medium, indicating that the inversion system of the present invention achieved inversion of DNA fragments between sites with almost no deletion.

3. The Rci8/sfxa101 system was expressed, 12 colonies on SC-URA medium were randomly selected, the generation of new ligations was tested by PCR, and the new ligations generated after inversion were analyzed by Sanger sequencing. The results are shown in FIG. 10; the reverse region Sanger sequencing results were as follows:

<xnotran> TTGCAGCATAAATTACTATACTTCTATAGACACACAAACACAAATACACACACTAAATTAATAATGAAGGCAATACTTTCGTGCCAATCCGGTACGTGGTCGAAAGCTACATATAAGGAACGTGCTGCTACTCATCCTAGTCCTGTTGCTGCCAAGCTATTTAATATCATGCACGAAAAGCAAACAAACTTGTGTGCTTCATTGGATGTTCGTACCACCAAGGAATTACTGGAGTTAGTTGAAG (: 1 , ) </xnotran>

The result shows that the ratio of the inversion efficiency to the deletion efficiency is about 960, good inversion specificity is reflected, and the successful construction of a site-specific DNA inversion system on a saccharomyces cerevisiae chromosome is proved.

Example 3: construction of eukaryotic site-specific DNA (deoxyribonucleic acid) inversion system in animal cell HEK-293T by using Rci8/sfxa101 system

1. Designing and constructing a characterization system on a Pcep4 plasmid of an HEK-293T cell, and inverting a DNA fragment between two sfxa101 sites which are reversely arranged so as to express green fluorescent protein and change the cell into green; deletion of the DNA fragment between the two homeotropically aligned sfxa101 sites resulted in the expression of red fluorescent protein and the cells turned red.

2. The characterized system plasmid and the Rci8 plasmid (pHPY 007) were transfected into HEK-293T cells, and cells containing only the characterized system plasmid served as controls. After 72 hours of culture, the transfected cells were imaged by a fluorescence microscope, and the results of FIG. 11 show that many of the experimental groups of transfected cells turned green, while almost no green cells were observed in the control group, demonstrating that an inverse reaction occurred in the cells.

Quantitative analysis by flow cytometry, the results of fig. 12 show that about 21.8% of 293T cells turned green and about 0.24% of cells turned red, and verified by PCR and Sanger sequencing. These results indicate that Rci8/sfxa101 can mediate DNA recombination with strong directional bias, leading to predominant inversion between inverted sfxa101 sites in mammalian cells, and successfully constructing a site-specific DNA inversion system in animal cells.

The reverse region Sanger sequencing results were as follows:

GGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGCAATACTTTCGTGCCAATCCGGTACGTGGACCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTCCGCGGCGAG

the foregoing is only for the purpose of understanding the method of the present invention and the core concept thereof, and it will be understood by those skilled in the art that various changes and modifications may be made without departing from the principle of the invention, and the invention also falls within the scope of the appended claims.

Sequence listing

<110> Tianjin university

<120> DNA inversion system, use thereof and target DNA inversion method

<130> MP21009216

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ggcaatactt tcgtgccaat ccggtacgtg g 31

<210> 2

<211> 384

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Pro Ser Pro Arg Ile Arg Lys Met Ser Leu Ser Arg Ala Leu Asp

1 5 10 15

Lys Tyr Leu Lys Thr Val Ser Val His Lys Lys Gly His Gln Gln Glu

20 25 30

Phe Tyr Arg Ser Asn Val Ile Lys Arg Tyr Pro Ile Ala Leu Arg Asn

35 40 45

Met Asp Val Ile Thr Thr Val Asp Ile Ala Thr Tyr Arg Asp Val Arg

50 55 60

Leu Ala Glu Ile Asn Pro Arg Thr Gly Lys Pro Ile Thr Gly Asn Thr

65 70 75 80

Val Arg Leu Glu Leu Ala Leu Leu Ser Ser Leu Phe Asn Ile Ala Arg

85 90 95

Val Glu Trp Gly Thr Cys Arg Thr Asn Pro Val Glu Leu Val Arg Lys

100 105 110

Pro Lys Val Ser Ser Gly Arg Asp Arg Arg Leu Thr Ser Ser Glu Glu

115 120 125

Arg Arg Leu Ser Arg Tyr Phe Arg Glu Lys Asn Leu Met Leu Tyr Val

130 135 140

Ile Phe His Leu Ala Leu Glu Thr Ala Met Arg Gln Gly Glu Ile Leu

145 150 155 160

Ala Leu Arg Trp Glu His Ile Asp Leu Arg His Gly Val Ala His Leu

165 170 175

Pro Glu Thr Lys Asn Gly His Ser Arg Asp Val Pro Leu Ser Arg Arg

180 185 190

Ala Arg Asn Phe Leu Gln Met Met Pro Val Asn Leu His Gly Asn Val

195 200 205

Phe Asp Tyr Thr Ala Ser Gly Phe Lys Asn Ala Trp Arg Ile Ala Thr

210 215 220

Gln Arg Leu Arg Ile Glu Asp Leu His Phe His Asp Leu Arg His Glu

225 230 235 240

Ala Ile Ser Arg Phe Phe Glu Leu Gly Ser Leu Asn Val Met Glu Ile

245 250 255

Ala Ala Ile Ser Gly His Arg Ser Met Asn Met Leu Lys Arg Tyr Thr

260 265 270

His Leu Arg Ala Trp Gln Leu Val Ser Lys Leu Asp Ala Arg Arg Arg

275 280 285

Gln Thr Gln Lys Val Ala Ala Trp Phe Ile Pro Tyr Pro Ala His Ile

290 295 300

Thr Thr Ile Asp Glu Glu Asn Gly Gln Lys Ala His Arg Ile Glu Ile

305 310 315 320

Gly Asp Phe Asp Asn Leu His Val Thr Ala Thr Thr Lys Glu Glu Ala

325 330 335

Val His Arg Ala Ser Glu Val Leu Leu Arg Thr Leu Ala Ile Ala Ala

340 345 350

Gln Lys Gly Glu Arg Val Pro Ser Pro Gly Ala Leu Pro Val Asn Asp

355 360 365

Pro Asp Tyr Ile Met Ile Cys Pro Leu Asn Pro Gly Ser Thr Pro Leu

370 375 380

<210> 3

<211> 384

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Pro Ser Pro Arg Ile Arg Lys Met Ser Leu Ser Arg Ala Leu Asp

1 5 10 15

Lys Tyr Leu Lys Thr Val Ser Val His Lys Lys Gly His Gln Gln Glu

20 25 30

Phe Tyr Arg Ser Asn Val Ile Lys Arg Tyr Pro Ile Ala Leu Arg Asn

35 40 45

Met Asp Glu Ile Thr Thr Val Asp Ile Ala Thr Tyr Arg Asp Val Arg

50 55 60

Leu Ala Glu Ile Asn Pro Arg Thr Gly Lys Pro Ile Thr Gly Asn Thr

65 70 75 80

Val Gly Leu Glu Leu Ala Leu Leu Ser Ser Leu Phe Asn Ile Ala Arg

85 90 95

Val Glu Trp Gly Thr Cys Arg Thr Asn Pro Val Glu Leu Val Arg Lys

100 105 110

Pro Lys Val Ser Ser Gly Arg Asp Arg Arg Leu Thr Ser Ser Glu Glu

115 120 125

Arg Arg Leu Ser Arg Tyr Phe Arg Glu Lys Asn Leu Met Leu Tyr Val

130 135 140

Ile Phe His Leu Ala Leu Glu Thr Ala Met Arg Gln Gly Glu Ile Leu

145 150 155 160

Ala Leu Arg Trp Glu His Ile Asp Leu Arg His Gly Val Ala His Leu

165 170 175

Pro Glu Thr Lys Asn Gly His Ser Arg Asp Val Pro Leu Ser Arg Arg

180 185 190

Ala Arg Asn Phe Leu Gln Met Met Pro Val Asn Leu His Gly Asn Val

195 200 205

Phe Asp Tyr Thr Ala Ser Gly Phe Lys Asn Ala Trp Arg Ile Ala Thr

210 215 220

Gln Arg Leu Arg Ile Glu Asp Leu His Phe His Asp Leu Arg His Glu

225 230 235 240

Ala Ile Ser Arg Phe Phe Glu Leu Gly Ser Leu Asn Val Met Glu Ile

245 250 255

Ala Ala Ile Ser Gly His Arg Ser Met Asn Met Leu Lys Arg Tyr Thr

260 265 270

His Leu Arg Ala Trp Gln Leu Val Ser Lys Leu Asp Ala Arg Arg Arg

275 280 285

Gln Thr Gln Lys Val Ala Ala Trp Phe Val Pro Tyr Pro Ala His Ile

290 295 300

Thr Thr Ile Asp Glu Glu Asn Gly Gln Lys Ala His Arg Ile Glu Ile

305 310 315 320

Gly Asp Phe Asp Asn Leu His Val Thr Ala Thr Thr Lys Glu Glu Ala

325 330 335

Val His Arg Ala Ser Glu Val Leu Leu Arg Thr Leu Ala Ile Ala Ala

340 345 350

Gln Lys Gly Glu Arg Val Pro Ser Pro Gly Ala Leu Pro Val Asn Asp

355 360 365

Pro Asp Tyr Ile Met Ile Cys Pro Leu Asn Pro Gly Ser Thr Pro Leu

370 375 380

<210> 4

<211> 1155

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgccttcac ctaggattcg taaaatgtcc ctgtcaaggg cgctagataa atatcttaaa 60

actgtgagtg tccataaaaa ggggcaccaa caagaattct atcgttcaaa tgtcatcaaa 120

aggtatccta ttgctttaag aaacatggac gtgataacca cggtcgacat agccacatac 180

cgtgatgtta gattggccga aatcaaccca agaacaggaa aacctattac tggaaacact 240

gtcagattgg agctggccct gctttcatcc ttgttcaata ttgcaagagt cgaatggggt 300

acgtgcagga ctaaccctgt tgaactagtt cgtaaaccaa aagtgtctag tggtagggat 360

agaaggttaa catccagtga agaaagaaga ctgtcaagat attttagaga aaagaactta 420

atgttatatg ttattttcca tttggcctta gaaacagcaa tgagacaagg tgaaatatta 480

gctttgcgtt gggaacatat agatttacgt cacggtgtag cccatttacc tgaaaccaaa 540

aatggtcaca gcagagatgt tccacttagt agaagagctc gtaatttctt gcagatgatg 600

ccagtcaatt tgcacggtaa cgtatttgac tacaccgctt ccggttttaa aaacgcatgg 660

agaattgcca ctcaaagact tagaatagaa gacctgcact tccatgactt aagacacgag 720

gccatatcaa gattttttga attgggtagc ttgaacgtga tggaaatagc tgcgattagt 780

gggcacagat ctatgaatat gttaaagcgt tacactcacc ttagagcgtg gcagttagtg 840

agcaagttag acgcaagaag aaggcaaact cagaaggtcg cagcttggtt tataccttat 900

ccggcacata ttactactat cgatgaagag aatggtcaaa aagcccatag aatagagata 960

ggtgattttg ataatttgca tgtaactgcg accactaaag aggaagctgt acatagagca 1020

tccgaggttc tattgagaac cctagcgatc gctgcacaga agggtgaaag agttccttca 1080

ccaggagctt tgccggttaa cgacccggat tatattatga tctgtccctt gaaccctggt 1140

tctacacctt tataa 1155

<210> 5

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccacgtaccg gattggcacg aaagtattgc c 31

Claims

A composition of an Rci enzyme and an sfxa101 site, comprisingsfxa101A site, and an Rci enzyme and/or a nucleic acid encoding the same; the above-mentionedsfxa101The locus is a double-stranded nucleotide with one strand of which the sequence is shown as SEQ ID NO.1, the amino acid sequence of the Rci enzyme is shown as SEQ ID NO.2 or SEQ ID NO.3, and the encoding nucleic acid of the Rci enzyme is the nucleic acid encoding the amino acid sequence shown as SEQ ID NO.2 or SEQ ID NO. 3.
2. The composition of claim 1, wherein the nucleotide sequence encoding the amino acid sequence shown in SEQ ID No.2 is shown in SEQ ID No. 4.
3. The composition of claim 1, wherein the composition is a mixture of two or more of the foregoingsfxa101The site sequence and the coding sequence of the Rci enzyme are present in the form of an expression vector.
4. Use of a composition according to any one of claims 1 to 3 for mediating a DNA inversion of interest.
5. Use of the composition of any one of claims 1 to 3 for constructing a DNA inversion library.
6. A target DNA inversion method, comprising:

step 1, two in opposite directionssfxa101The sites are respectively inserted into the two ends of the target DNA;

step 2, transferring a vector for expressing the Rci enzyme into a receptor cell in which the target DNA is positioned, wherein the expressed Rci enzyme acts on two opposite directionssfxa101The target DNA between the sites is inverted;

the above-mentionedsfxa101The locus is a double-stranded nucleotide with one strand of which the sequence is shown as SEQ ID NO.1, the amino acid sequence of the Rci enzyme is shown as SEQ ID NO.2 or SEQ ID NO.3, and the encoding nucleic acid of the Rci enzyme is the nucleic acid encoding the amino acid sequence shown as SEQ ID NO.2 or SEQ ID NO. 3.
7. A method of constructing a DNA inversion library comprising:

step 1, inserting two target DNAs with opposite directions into two ends of a plurality of target DNAs to be invertedsfxa101A locus;

step 2, transferring a vector for expressing Rci enzyme into a receptor cell in which the target DNA is positioned, wherein the expressed Rci8 enzyme acts on two opposite directionssfxa101Target DNA between sites is inverted;

the above-mentionedsfxa101The locus is a double-stranded nucleotide with one strand of which the sequence is shown as SEQ ID NO.1, the amino acid sequence of the Rci enzyme is shown as SEQ ID NO.2 or SEQ ID NO.3, and the encoding nucleic acid of the Rci enzyme is the nucleic acid encoding the amino acid sequence shown as SEQ ID NO.2 or SEQ ID NO. 3.
8. The method of claim 7, wherein two adjacent ones of the plurality of electrodes are adjacent to each othersfxa101The orientation of the site sequence is reversed.