CN113528506B - DNA inversion system and application thereof and target DNA inversion method - Google Patents

Abstract

The invention relates to the technical field of genetic engineering, and discloses an application of a DNA reversal system and a target DNA reversal method. The present invention provides a DNA inversion system based on the Rci enzyme/sfxa101 site. Under the action of the Rci enzyme that continuously mutates, the target DNA between two reversely arranged sfxa101 sites is mediated Inversion reaction occurs and deletion reaction is avoided. Even if there is a sfxa101 site in the same direction, the occurrence efficiency of this deletion reaction is negligible compared with that of inversion reaction. The DNA inversion system and inversion method of the present invention can realize the inversion of DNA fragments between sites without almost deletion, can avoid adverse effects caused by deletion, and can further generate an inversion library to realize the change of multiple DNA elements order and direction, while keeping the length constant.

Description

A kind of DNA reversal system and its application and a kind of target DNA reversal method

technical field

The invention relates to the technical field of genetic engineering, in particular to a DNA reversal system and its application and a target DNA reversal method.

Background technique

DNA rearrangements mediated by site-specific recombination play an important role in creating biological diversity. Such natural systems include: in developing lymphocytes, V(D)J recombination mediated by RAG recombinase to generate different antigen receptors; in E. coli 15T-, p15BMin mediated by Min convertase system, resulting in the selective expression of multiple pigtail genes. At the same time, a variety of artificial systems for DNA rearrangement have also been developed. For example, the SCRaMbLE system evolved through LoxPsym-mediated evolution in the synthetic yeast genome (Sc2.0) can perform synthetic chromosome rearrangement and modification; and Cre recombinase-mediated multiple A loxp locus barcode system (Brainbow system and Polylox system) can randomly generate the diversity of chromosome structure variation and generate a huge barcode library.

The aforementioned DNA rearrangement systems can generate diversity through site-specific recombination-mediated deletions, inversions, and other structural variations. However, deletions in DNA rearrangement systems can play a negative role. For example, deletion of large chromosomal segments mediated by SCRaMbLE often results in high lethality of cells undergoing SCRaMbLE. For the Cre recombinase-mediated barcoding approach, Cre inherently favors deletion rather than inversion, resulting in reduced barcode diversity. The site-specific DNA inversion system only mediates the inversion reaction between two sites aligned in the opposite direction, and almost no deletion reaction occurs between the two sites aligned in the same direction. A site-specific DNA inversion system can effectively address adverse effects caused by deletions. So far, site-specific DNA inversion systems exist only in bacteria and phages. Therefore, there is an urgent need to develop a similar site-specific DNA inversion system in eukaryotes.

Contents of the invention

In view of this, the object of the present invention is to provide a DNA reversal system, which belongs to the Rci enzyme/sfxa101 site composition, which can be used to mediate target DNA reversal, and can also change the sequence and Direction, while keeping the length unchanged, generate a reverse library;

Another object of the present invention is to provide a method for inverting target DNA at a high rate based on the Rci/sfxa101 system and a method for generating a DNA inversion library.

In order to achieve the above object, the present invention provides the following technical solutions:

A DNA inversion system comprising sfxa101 site sequence, and Rci enzyme and/or its coding sequence; said sfxa101 site sequence is a double-stranded nucleotide sequence whose sequence of one chain is shown in SEQ ID NO.1 , the Rci enzyme sequence is the amino acid sequence shown in SEQ ID NO.2 or SEQ ID NO.3, the coding sequence of the Rci enzyme is capable of encoding the amino acid sequence shown in SEQ ID NO.2 or SEQ ID NO.3 Nucleotide sequence.

The 31bp sequence at the sfxa101 site consists of a 7bp spacer sequence, a 12bp right arm sequence, and a 12bp left arm sequence. The nucleotide sequence shown in SEQ ID NO.1 is one of the strands, and the opposite direction A chain sequence of the sfxa101 site sequence is shown in SEQ ID NO.5, and the sfxa101 site sequence in two different directions is shown in Figure 1. At the same time, the present invention continuously evolves the Rci enzyme. Under the action of the Rci8 enzyme with the amino acid sequence shown in SEQ ID NO. There is almost no deletion reaction between the sfxa101 site sequences arranged in the opposite direction, and the inversion ratio under the catalysis of this enzyme is significantly higher than the deletion ratio. In practical applications, if only the sfxa101 site sequence in the opposite direction is set only mediates inversion. At the same time, the ratio of inversion efficiency to deletion efficiency under the Rci26 enzyme catalysis of the amino acid sequence shown in SEQ ID NO.3 is also high.

In a specific embodiment of the present invention, the nucleotide sequence capable of encoding the amino acid sequence shown in SEQ ID NO.2 is shown in SEQ ID NO.4.

Preferably, the coding sequence of the sfxa101 site sequence and the Rci enzyme can also exist in the form of an expression vector, for example, the target DNA, the sfxa101 site sequence and the coding sequence of the Rci enzyme are inserted into the vector plasmid, and then transformed into the recipient cell (yeast cells, HEK-293T cells and other eukaryotic cells).

In order to verify the effect of the DNA inversion system of the present invention, the present invention verified the target DNA inversion in eukaryotic cells on the plasmid vector and the chromosome respectively by means of the screening label and the indication of fluorescent protein. The Rci8 enzyme/Rci26 enzyme was expressed in the cells, and the ratios of target DNA inversion efficiency and deletion efficiency were about 4320 and 1195, respectively, reflecting good inversion specificity, proving that site-specific DNA inversion was successfully constructed on yeast plasmids system;

The results of target DNA inversion directly on the yeast chromosome showed that the ratio of inversion efficiency to deletion efficiency was about 960 under the catalysis of Rci8 enzyme, which also reflected good inversion specificity, proving that the site was successfully constructed on the yeast chromosome. Point-specific DNA inversion system;

In order to prove that other eukaryotic cells can also use the inversion system, the present invention introduces the plasmid vector into the animal cell HEK-293T, and uses fluorescent protein as an indicator. The results show that the transfected cells of many experimental groups turn green (indicating the occurrence Inversion), while almost no green cells were observed in the control group, proving that an inversion reaction occurred in the cells. Quantitative analysis by flow cytometry showed that about 21.8% of the 293T cells turned green, while about 0.24% of the cells turned red (indicating deletion), which was verified by PCR and Sanger sequencing. These results demonstrate that the Rci/sfxa101 system can mediate DNA recombination with a strong directional bias, resulting in the dominance of inversion between inverted sfxa101 sites in mammalian cells, successfully constructing site specificity in animal cells DNA inversion system.

Based on the above technical effects, the present invention proposes the application of the DNA inversion system in mediating the inversion of target DNA, and the application in constructing a DNA inversion library.

According to the application, the present invention also provides a target DNA reversal method, comprising:

Step 1. Insert two sfxa101 site sequences in opposite directions into both ends of the target DNA;

Step 2, transfer the vector capable of expressing the Rci enzyme into the recipient cell where the target DNA is located, and the expressed Rci enzyme acts on the target DNA between the two sfxa101 sites in opposite directions to invert.

At the same time, the present invention also provides a method for constructing a DNA reversal library, comprising:

Step 1. Insert two sfxa101 site sequences in opposite directions at both ends of multiple target DNAs to be reversed;

Step 2, transfer the vector capable of expressing Rci enzyme into the recipient cell where the target DNA is located, and the expressed Rci8 enzyme acts on the target DNA between the two sfxa101 sites in opposite directions to invert.

In order to only mediate DNA inversion and avoid deletion, the sequences of two adjacent sfxa101 sites are in the opposite direction.

Among them, in the above two methods, the target DNA can be on the chromosome of the recipient cell, or it can be introduced into the recipient cell in the form of an insertion vector. The latter method is usually to carry out fragment on-targeting of the constructed multifunctional fragment. Inversion of DNA.

It can be seen from the above technical scheme that the present invention provides a DNA inversion system based on the Rci enzyme/sfxa101 site, under the action of the continuously directed mutation Rci enzyme provided by the present invention, mediates two reversely arranged sfxa101 sites The target DNA in between only undergoes an inversion reaction, avoiding a deletion reaction. Even if there is a sfxa101 site in the same direction, the efficiency of this deletion reaction is negligible compared to the inversion reaction. The DNA inversion system and inversion method of the present invention can realize the inversion of DNA fragments between sites without almost deletion, can avoid adverse effects caused by deletion, and can further generate an inversion library to realize the change of multiple DNA elements order and direction, while keeping the length constant.

Description of drawings

Figure 1 shows a schematic diagram of two sfxa101 site sequences in opposite directions;

Figure 2 shows the schematic map of the plasmid pHPY004 and the verification unit on the plasmid; the right-angled arrow indicates the promoter, the triangle indicates the sfxa101 site sequence and its directionality, the T-shaped symbol indicates the terminator, and URA3ΔATG indicates the reverse knockout start codon The URA3 tag sequence of the sub-ATG, HIS3ΔATG represents the HIS3 tag sequence of knocking out the start codon ATG;

Figure 3 is a schematic diagram of the inversion and deletion of the verification unit on the plasmid pHPY004;

Figure 4 shows a schematic diagram of using the Rci8/sfxa101 system to reverse the target DNA (ie, reverse URA3) on the chromosome of Saccharomyces cerevisiae; the right-angled arrow indicates the promoter, the triangle indicates the sfxa101 site sequence and its directionality, and the T-shaped symbol indicates the termination Clover indicates the green fluorescent protein coding sequence, Clover+ indicates that the cell is green and reversed; miRFP670 indicates the red fluorescent protein coding sequence, miRFP670+ indicates that the cell is red and has been deleted;

Figure 5 is a schematic diagram of using fluorescent protein to verify DNA inversion on the Pcep4 plasmid of HEK-293T cells;

Figure 6 is a schematic diagram of the map of plasmid pHPY007, which belongs to the expression vector for expressing Rci8 enzyme;

Figure 7 is a schematic diagram of the number of colonies on different types of medium after the plasmid pHPY004 is introduced into Saccharomyces cerevisiae for reversal/deletion;

Figure 8 shows the PCR results of 24 randomly selected reversed Saccharomyces cerevisiae strains;

Figure 9 is a schematic diagram of the number of colonies on different types of media after the reversal/deletion of the verification unit cloned from pHPY004 on the chromosome of Saccharomyces cerevisiae;

Figure 10 shows the PCR results of 12 randomly selected reversed Saccharomyces cerevisiae strains;

Figure 11 shows the microscopic image of the color change of HEK-293T cells after inversion/deletion;

Figure 12 shows the flow cytometry analysis of the color change of HEK-293T cells; green (lower right quadrant) indicates inversion; orange (upper right quadrant) indicates that cells are overturned to express green fluorescent protein CLOVER, and then deleted miRFP670, the CLOVER protein exists in the cell at this time, the red and green are superimposed into orange, because it is to evaluate the deletion ratio, only look at the single channel miRFP+, and it is calculated as deletion; red (upper left quadrant) indicates deletion occurs; gray (lower left quadrant) ) indicates that inversion and deletion did not occur, and 78% of the cells did not invert and delete due to the expression time of Rci enzyme.

detailed description

The embodiment of the present invention discloses a DNA inversion system and its application as well as a target DNA inversion method. Those skilled in the art can learn from the content of this article and appropriately improve the process parameters to realize it. In particular, it should be pointed out that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The DNA reversal system and its application and the target DNA reversal method described in the present invention have been described through preferred embodiments, and the relevant personnel can obviously reverse the DNA described herein without departing from the content, spirit and scope of the present invention The system and its application as well as the target DNA inversion method are modified or appropriately modified and combined to realize and apply the technology of the present invention.

Two Rci enzymes are provided in the present invention, that is, the Rci8 enzyme with the amino acid sequence shown in SEQ ID NO.2 and the Rci26 enzyme with the amino acid sequence shown in SEQ ID NO.3; compared with the Rci26 enzyme, the Rci8 enzyme has been optimized for directed mutation, Under its catalysis, the ratio of target DNA inversion efficiency and deletion efficiency has been greatly improved; in the specific embodiments of the present invention, the optimal Rci8 enzyme is basically used for related verification.

In the specific embodiment of the present invention, the present invention uses URA3 and HIS3 screening tags (knocking out the ATG start codon) to construct a plasmid vector for verifying the reverse DNA effect, and introduce it into yeast cells for verification. The schematic diagram is shown in Figure 2; On the vector, URA3 is inserted in reverse and the sfxa101 site sequence in the opposite direction is inserted at both ends, and the promoter Pcyc1 and ATG start codons are set before the sfxa101 site sequence upstream of the reverse URA3 tag; only in the HIS3 screening tag A sfxa101 site sequence is set up upstream, and its direction is the same as the sfxa101 site sequence upstream of the reverse URA3 tag, and a terminator is set between the sfxa101 site sequence and the sfxa101 site sequence downstream of the reverse URA3 tag;

The construction method of the above-mentioned plasmid vector can directly reflect the inversion efficiency and deletion efficiency of the URA3 tag as the target DNA with the help of SC-URA and SC-HIS medium. When the DNA inversion occurs between the two reverse sfxa101 site sequences, The URA3 tag can be expressed normally, but the HIS3 tag cannot be expressed, and colonies can grow on the SC-URA medium; and when the DNA deletion occurs between the two sfxa101 site sequences in the same direction, the reverse URA3 tag is deleted, and the HIS3 tag can be normal expression, colonies can be grown on SC-HIS medium, as shown in Figure 3 for a schematic diagram.

In the same way, the above verification unit is inserted into the yeast chromosome, and the same inversion efficiency verification can also be performed, as shown in Figure 4 for a schematic diagram.

In addition, the present invention also uses fluorescent protein to construct a plasmid vector to verify the effect of reverse DNA, and introduces it into animal cell HEK-293T for verification; similar to the aforementioned verification unit in yeast cells, the reverse URA3 is replaced by the reverse green fluorescent protein sequence Tag, replace the HIS3 tag with the red fluorescent protein sequence, and keep the others the same. At the same time, for simplicity, the expression system of the Rci8 enzyme is also inserted into the plasmid vector, while in the previous yeast cell verification, a single expression of the Rci8 enzyme was transformed. Vector plasmid; when the DNA inversion occurs between the two reverse sfxa101 site sequences, the green fluorescent protein can be expressed normally, but the red fluorescent protein cannot be expressed, and the transfected cells can be imaged by fluorescence microscopy and detected by flow cytometry; When the DNA deletion occurs between the two sfxa101 site sequences in the same direction, the reverse green fluorescent protein sequence is deleted, and the red fluorescent protein can be expressed normally. The transfected cells can be imaged by a fluorescence microscope and detected by flow cytometry. The schematic diagram is shown in Figure 5.

Plasmids pHPY004 and pHPY007 involved in the present invention were obtained by transformation on commercially available plasmids pRS416 and pRS415; for example, pHPY004 was introduced into the verification unit in Figure 3 based on the pRS416 plasmid with the URA3 tag knocked out, and the screening tag can be selected according to the actual situation Replace, add or retain the original screening tag of the pRS416 plasmid. See Figure 2 for a schematic diagram of the plasmid map; pHPY007 uses the pRS415 plasmid as the base plasmid to introduce the expression system of the Rci8 enzyme. The use of a Gal-inducible promoter can facilitate the control of the expression of the Rci8 enzyme. The screening tag can be Choose to replace, add or retain the original screening tag of the pRS415 plasmid according to the actual situation. The schematic diagram of the plasmid map is shown in Figure 6.

The application of a DNA reversal system provided by the present invention and a target DNA reversal method will be further described below.

Example 1: Construction of a eukaryotic site-specific DNA inversion system on a Saccharomyces cerevisiae plasmid using the Rci8/sfxa101 system

1. Introduce the pHPY004 plasmid and the pHPY007 plasmid into the BY4741 starting strain by yeast transformation. The steps are as follows:

a) Pick a single colony of Saccharomyces cerevisiae BY4741 in 5mLYPD liquid medium, and cultivate overnight at 30°C;

b) Measure the OD600 of the overnight cultured Saccharomyces cerevisiae culture solution, inoculate the overnight culture solution into 5mL LYPD ( _0.125OD600 /ml), and cultivate at 30°C and 220rpm until the OD600 reaches 0.5 (about 3.5-4.5hrs);

c) Pipette 1mL of Saccharomyces cerevisiae culture solution into a 1.5mL EP tube, centrifuge at 4000rpm for 2min, and collect the cells; resuspend the cells in 1mL of sterile water, centrifuge as above, and collect the cells; resuspend the cells in 1mL 0.1M LiOAc, centrifuge as above, and collect the cells ; Remove 900 μL supernatant with a pipette, resuspend the cells in the remaining 100 μL LiOAc, and place them on ice to obtain competent cells.

d) Prepare the transformation system:

The system was thoroughly mixed and ready for use.

e) Add 2 μL of pHPY004 plasmid and 2 μL of pHPY007 plasmid to 100 μL of yeast competent cells, blow and pipette evenly, add to the transformation system, and mix evenly by turning up and down; incubate in a 30°C incubator for 30 minutes; Stimulate for 15min; centrifuge at 3600rpm for 30s, collect cells; aspirate the mixture, add 400μL of 5mMCaCl ₂ , resuspend the cells, and let stand for 5min; centrifuge at 3600rpm for 30s, aspirate, resuspend in sterile water and apply SC+HYG (hygromycin) Screening Media Screening.

After the yeast grew on the screening medium for 2 days, a single colony was inoculated in SC-Leu+HYG liquid medium, and cultured at 30°C, 220rpm until saturated.

2. Take 1 mL of yeast, wash the cells twice with ddH ₂ O to remove glucose, and then transfer to galactose medium for induction and culture for 12 hours. Spread the induced yeast cells on SC-URA and SC-HIS medium at an appropriate dilution factor, and culture them in a 30°C incubator for 3 days; the results are shown in Figure 7, and the results in Figure 7 are shown in SC-URA medium A large number of colonies grew on the SC-HIS medium, but basically no colonies grew on the SC-HIS medium, indicating that the inversion system of the present invention realizes the inversion of DNA fragments between sites without almost deleting.

3. Rci8/sfxa101 system expression, randomly select 24 colonies on SC-URA medium, test the generation of new junctions by PCR, and analyze the new junctions generated after inversion by Sanger sequencing, the results are shown in Figure 8; the inversion region Sanger sequencing results are as follows:

CATTAGGACCTTTGCAGCATAAATTACTATACTTCTATAGACACACAAACACAAATACACACACTAAATTAATAATGAAGGCAATACTTTCGTGCCAATCCGGTACGTGGTCGAAAGCTACATATAAGGAACGTGCTGCTACTCATCCTAGTCCTGTTGCTGCCAAGCTATTTAATATCATGCACGAAAAGCAAACAAACTTGTGTGC

The results showed that the ratio of inversion efficiency to deletion efficiency was about 4320, reflecting good inversion specificity, and proved that a site-specific DNA inversion system was successfully constructed on the Saccharomyces cerevisiae plasmid.

In addition, in this example, the Rci26 enzyme (before directional optimization) was selected to replace the Rci8 enzyme for the same experiment, and the results showed that the ratio of inversion efficiency to deletion efficiency was about 1195.

Example 2: Using the Rci8/sfxa101 system to construct a eukaryotic site-specific DNA inversion system on the chromosome of Saccharomyces cerevisiae.

1. Insert the fragment of the system cloned from pHPY004 (that is, the verification unit shown in Figure 3, with a length of 4202bp) into the X chromosome (position 639678bp) in Saccharomyces cerevisiae by yeast homologous recombination, and simultaneously introduce the pHPY007 plasmid.

2. Take 1 mL of yeast, wash the cells twice with ddH ₂ O to remove glucose, and then transfer to galactose medium for induction and culture for 12 hours. Spread the induced yeast cells on SC-URA and SC-HIS medium at an appropriate dilution factor, and culture them in a 30°C incubator for 3 days; the results are shown in Figure 9, and the results in Figure 9 are shown in SC-URA medium A large number of colonies grew on the SC-HIS medium, but basically no colonies grew on the SC-HIS medium, indicating that the inversion system of the present invention realizes the inversion of DNA fragments between sites without almost deleting.

3. Rci8/sfxa101 system expression, randomly select 12 colonies on SC-URA medium, test the generation of new junctions by PCR, and analyze the new junctions generated after inversion by Sanger sequencing. The results are shown in Figure 10; the Sanger sequencing results of the inverted region are as follows:

TTGCAGCATAAATTACTATACTTCTATAGACACACAAACACAAATACACACACTAAATTAATAATGAAGGCAATACTTTCGTGCCAATCCGGTACGTGGTCGAAAGCTACATATAAGGAACGTGCTGCTACTCATCCTAGTCCTGTTGCTGCCAAGCTATTTAATATCATGCACGAAAAGCAAACAAACTTGTGTGCTTCATTGGATGTTCGTACCACCAAGGAATTACTGGAGTTAGTTGAAG(注：与实施例1中测序结果部分不同是由于所用引物不同，中间序列是相同的)

The results showed that the ratio of inversion efficiency to deletion efficiency was about 960, which reflected good inversion specificity, and proved that a site-specific DNA inversion system was successfully constructed on Saccharomyces cerevisiae chromosome.

Example 3: Construction of a eukaryotic site-specific DNA inversion system in animal cell HEK-293T using the Rci8/sfxa101 system

1. Design and construct a characterization system on the Pcep4 plasmid of HEK-293T cells. The inversion of the DNA fragment between the two reversely arranged sfxa101 sites makes the expression of green fluorescent protein and the cells turn green; two aligned in the same direction The deletion of the DNA fragment between the sfxa101 sites makes the red fluorescent protein expressed and the cells turn red.

2. The characterization system plasmid and the Rci8 plasmid (pHPY007) were transfected into HEK-293T cells, and the cells containing only the characterization system plasmid were used as controls. After culturing for 72 hours, the transfected cells were imaged by a fluorescence microscope. The results in Figure 11 showed that many transfected cells in the experimental group turned green, while almost no green cells were observed in the control group, proving that a reverse reaction occurred in the cells.

Quantitative analysis by flow cytometry, the results in Figure 12 show that about 21.8% of 293T cells turned green, and about 0.24% of cells turned red, and verified by PCR and Sanger sequencing. These results demonstrate that Rci8/sfxa101 can mediate DNA recombination with a strong directional bias, resulting in the dominance of inversion between inverted sfxa101 sites in mammalian cells, successfully constructing site-specific DNA in animal cells Invert the system.

The Sanger sequencing results of the inverted region are as follows:

GGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATAATAAGCAGAGCTGGCAATACTTTCGTGCCAATCCGGTACGTGGACCCAAGGGCGAGGAGCTGTTCACCGGGGCGGTGCCCAGTCAGGTGGTCGAGCTGGAACGCG

The above description is only used to understand the method and core idea of the present invention. It should be pointed out that for those of ordinary skill in the art, some improvements and modifications can be made to the present invention without departing from the principles of the present invention. Improvements and modifications also fall within the protection scope of the rights of the present invention.

sequence listing

<110> Tianjin University

<120> A DNA inversion system and its application and a target DNA inversion method

<130> MP21009216

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ggcaatactt tcgtgccaat ccggtacgtg g 31

<210> 2

<211> 384

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Pro Ser Pro Arg Ile Arg Lys Met Ser Leu Ser Arg Ala Leu Asp

1 5 10 15

Lys Tyr Leu Lys Thr Val Ser Val His Lys Lys Gly His Gln Gln Glu

20 25 30

Phe Tyr Arg Ser Asn Val Ile Lys Arg Tyr Pro Ile Ala Leu Arg Asn

35 40 45

Met Asp Val Ile Thr Thr Val Asp Ile Ala Thr Tyr Arg Asp Val Arg

50 55 60

Leu Ala Glu Ile Asn Pro Arg Thr Gly Lys Pro Ile Thr Gly Asn Thr

65 70 75 80

Val Arg Leu Glu Leu Ala Leu Leu Ser Ser Leu Phe Asn Ile Ala Arg

85 90 95

Val Glu Trp Gly Thr Cys Arg Thr Asn Pro Val Glu Leu Val Arg Lys

100 105 110

Pro Lys Val Ser Ser Gly Arg Asp Arg Arg Leu Thr Ser Ser Glu Glu

115 120 125

Arg Arg Leu Ser Arg Tyr Phe Arg Glu Lys Asn Leu Met Leu Tyr Val

130 135 140

Ile Phe His Leu Ala Leu Glu Thr Ala Met Arg Gln Gly Glu Ile Leu

145 150 155 160

Ala Leu Arg Trp Glu His Ile Asp Leu Arg His Gly Val Ala His Leu

165 170 175

Pro Glu Thr Lys Asn Gly His Ser Arg Asp Val Pro Leu Ser Arg Arg

180 185 190

Ala Arg Asn Phe Leu Gln Met Met Pro Val Asn Leu His Gly Asn Val

195 200 205

Phe Asp Tyr Thr Ala Ser Gly Phe Lys Asn Ala Trp Arg Ile Ala Thr

210 215 220

Gln Arg Leu Arg Ile Glu Asp Leu His Phe His Asp Leu Arg His Glu

225 230 235 240

Ala Ile Ser Arg Phe Phe Glu Leu Gly Ser Leu Asn Val Met Glu Ile

245 250 255

Ala Ala Ile Ser Gly His Arg Ser Met Asn Met Leu Lys Arg Tyr Thr

260 265 270

His Leu Arg Ala Trp Gln Leu Val Ser Lys Leu Asp Ala Arg Arg Arg

275 280 285

Gln Thr Gln Lys Val Ala Ala Trp Phe Ile Pro Tyr Pro Ala His Ile

290 295 300

Thr Thr Ile Asp Glu Glu Asn Gly Gln Lys Ala His Arg Ile Glu Ile

305 310 315 320

Gly Asp Phe Asp Asn Leu His Val Thr Ala Thr Thr Lys Glu Glu Ala

325 330 335

Val His Arg Ala Ser Glu Val Leu Leu Arg Thr Leu Ala Ile Ala Ala

340 345 350

Gln Lys Gly Glu Arg Val Pro Ser Pro Gly Ala Leu Pro Val Asn Asp

355 360 365

Pro Asp Tyr Ile Met Ile Cys Pro Leu Asn Pro Gly Ser Thr Pro Leu

370 375 380

<210> 3

<211> 384

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Pro Ser Pro Arg Ile Arg Lys Met Ser Leu Ser Arg Ala Leu Asp

1 5 10 15

Lys Tyr Leu Lys Thr Val Ser Val His Lys Lys Gly His Gln Gln Glu

20 25 30

Phe Tyr Arg Ser Asn Val Ile Lys Arg Tyr Pro Ile Ala Leu Arg Asn

35 40 45

Met Asp Glu Ile Thr Thr Val Asp Ile Ala Thr Tyr Arg Asp Val Arg

50 55 60

Leu Ala Glu Ile Asn Pro Arg Thr Gly Lys Pro Ile Thr Gly Asn Thr

65 70 75 80

Val Gly Leu Glu Leu Ala Leu Leu Ser Ser Leu Phe Asn Ile Ala Arg

85 90 95

Val Glu Trp Gly Thr Cys Arg Thr Asn Pro Val Glu Leu Val Arg Lys

100 105 110

Pro Lys Val Ser Ser Gly Arg Asp Arg Arg Leu Thr Ser Ser Glu Glu

115 120 125

Arg Arg Leu Ser Arg Tyr Phe Arg Glu Lys Asn Leu Met Leu Tyr Val

130 135 140

Ile Phe His Leu Ala Leu Glu Thr Ala Met Arg Gln Gly Glu Ile Leu

145 150 155 160

Ala Leu Arg Trp Glu His Ile Asp Leu Arg His Gly Val Ala His Leu

165 170 175

Pro Glu Thr Lys Asn Gly His Ser Arg Asp Val Pro Leu Ser Arg Arg

180 185 190

Ala Arg Asn Phe Leu Gln Met Met Pro Val Asn Leu His Gly Asn Val

195 200 205

Phe Asp Tyr Thr Ala Ser Gly Phe Lys Asn Ala Trp Arg Ile Ala Thr

210 215 220

Gln Arg Leu Arg Ile Glu Asp Leu His Phe His Asp Leu Arg His Glu

225 230 235 240

Ala Ile Ser Arg Phe Phe Glu Leu Gly Ser Leu Asn Val Met Glu Ile

245 250 255

Ala Ala Ile Ser Gly His Arg Ser Met Asn Met Leu Lys Arg Tyr Thr

260 265 270

His Leu Arg Ala Trp Gln Leu Val Ser Lys Leu Asp Ala Arg Arg Arg

275 280 285

Gln Thr Gln Lys Val Ala Ala Trp Phe Val Pro Tyr Pro Ala His Ile

290 295 300

Thr Thr Ile Asp Glu Glu Asn Gly Gln Lys Ala His Arg Ile Glu Ile

305 310 315 320

Gly Asp Phe Asp Asn Leu His Val Thr Ala Thr Thr Lys Glu Glu Ala

325 330 335

Val His Arg Ala Ser Glu Val Leu Leu Arg Thr Leu Ala Ile Ala Ala

340 345 350

Gln Lys Gly Glu Arg Val Pro Ser Pro Gly Ala Leu Pro Val Asn Asp

355 360 365

Pro Asp Tyr Ile Met Ile Cys Pro Leu Asn Pro Gly Ser Thr Pro Leu

370 375 380

<210> 4

<211> 1155

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgccttcac ctaggattcg taaaatgtcc ctgtcaaggg cgctagataa atatcttaaa 60

actgtgagtg tccataaaaa ggggcaccaa caagaattct atcgttcaaa tgtcatcaaa 120

aggtatccta ttgctttaag aaacatggac gtgataacca cggtcgacat agccacatac 180

cgtgatgtta gattggccga aatcaaccca agaacaggaa aacctattac tggaaacact 240

gtcagattgg agctggccct gctttcatcc ttgttcaata ttgcaagagt cgaatggggt 300

acgtgcagga ctaaccctgt tgaactagtt cgtaaaccaa aagtgtctag tggtagggat 360

agaaggttaa catccagtga agaaagaaga ctgtcaagat attttagaga aaagaactta 420

atgttatatg ttattttcca tttggcctta gaaacagcaa tgagacaagg tgaaatatta 480

gctttgcgtt gggaacatat agattacgt cacggtgtag cccattacc tgaaaccaaa 540

aatggtcaca gcagagatgt tccacttagt agaagagctc gtaatttctt gcagatgatg 600

ccagtcaatt tgcacggtaa cgtatttgac tacaccgctt ccggttttaa aaacgcatgg 660

agaattgcca ctcaaagact tagaatagaa gacctgcact tccatgactt aagacacgag 720

gccatatcaa gattttttga attgggtagc ttgaacgtga tggaaatagc tgcgattagt 780

gggcacagat ctatgaatat gttaaagcgt tacactcacc ttagagcgtg gcagttagtg 840

agcaagttag acgcaagaag aaggcaaact cagaaggtcg cagcttggtt tataccttat 900

ccggcacata ttactactat cgatgaagag aatggtcaaa aagcccatag aatagagata 960

ggtgattttg ataatttgca tgtaactgcg accactaaag aggaagctgt acatagagca 1020

tccgaggttc tattgagaac cctagcgatc gctgcacaga agggtgaaag agttccttca 1080

ccaggagctt tgccggttaa cgacccggat tatattatga tctgtccctt gaaccctggt 1140

tctacacctt tataa 1155

<210> 5

<211> 31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccacgtaccg gattggcacg aaagtattgc c 31

Claims (8)

1. The composition of Rci enzyme and sfxa101 site, is characterized in that, comprises sfxa101 site, and Rci enzyme and/or its coding nucleic acid; Described sfxa101 site is wherein the sequence of a chain is as shown in SEQ ID NO.1 The double-stranded nucleotide of the Rci enzyme, the amino acid sequence of the Rci enzyme is the amino acid sequence shown in SEQ ID NO.2 or SEQ ID NO.3, and the encoding nucleic acid of the Rci enzyme is the encoding of SEQ ID NO.2 or SEQ ID NO .3 A nucleic acid having the amino acid sequence shown. 2. The composition according to claim 1, characterized in that, the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.2 is shown in SEQ ID NO.4. 3. The composition according to claim 1, wherein the sfxa101 site sequence and the coding sequence of the Rci enzyme exist in the form of an expression vector. 4. Use of the composition according to any one of claims 1-3 in mediating target DNA inversion. 5. The application of the composition described in any one of claims 1-3 in the construction of a DNA reversal library. 6. A target DNA reversal method, characterized in that, comprising: Step 1. Insert two sfxa101 sites in opposite directions into both ends of the target DNA; Step 2, transfer the vector expressing the Rci enzyme into the recipient cell where the target DNA is located, and the expressed Rci enzyme acts on the target DNA between the two sfxa101 sites in opposite directions to invert; The sfxa101 site is a double-stranded nucleotide whose sequence of one chain is shown in SEQ ID NO.1, and the amino acid sequence of the Rci enzyme is the amino acid sequence shown in SEQ ID NO.2 or SEQ ID NO.3 , the encoding nucleic acid of the Rci enzyme is the nucleic acid encoding the amino acid sequence shown in SEQ ID NO.2 or SEQ ID NO.3. 7. A method for constructing a DNA reversal library, comprising: Step 1. Insert two sfxa101 sites in opposite directions at both ends of multiple target DNAs that need to be reversed; Step 2, transfer the vector expressing Rci enzyme into the recipient cell where the target DNA is located, and the expressed Rci8 enzyme acts on the target DNA between the two sfxa101 sites in opposite directions to invert; The sfxa101 site is a double-stranded nucleotide whose sequence of one chain is shown in SEQ ID NO.1, and the amino acid sequence of the Rci enzyme is the amino acid sequence shown in SEQ ID NO.2 or SEQ ID NO.3 , the encoding nucleic acid of the Rci enzyme is the nucleic acid encoding the amino acid sequence shown in SEQ ID NO.2 or SEQ ID NO.3. 8. The method according to claim 7, wherein the directions of the sequences of two adjacent sfxa101 sites are opposite.

Images