WO1993006221A1 - Method for providing a deletion or inversion mutation in a plant genome; recombinant dna usable therefor; mutated plant - Google Patents

Abstract

A method for providing a deletion or inversion mutation in a plant genome by integrating into the plant genome rDNA which comprises a transposable element as well as, both in and outside the transposable element, a recombination sequence, effecting transposition of the transposable element including the recombination sequence present therein and effecting recombination between the recombination sequence which has been left behing and the recombination sequence which has jumped, resulting in a deletion or an inversion of the DNA located between the two recombination sequences, depending on the relative orientation of the recombination sequences involved. Any deletions can be isolated.

Description

Title: Method for providing a deletion or inversion mutation in a plant genome; recombinant DNA usable therefor; mutated plant

Field of the invention

The present invention relates to the field of genetic manipulation of plants and to that end makes use of a transposition system consisting of two elements, as well as a recombination system consisting of two elements, both active in the plant. Combining these two systems provides the possibility of obtaining deletion mutants or inversion mutants which cannot be obtained with either of the two systems alone. The present invention relates to a method for providing a deletion mutation or inversion mutation in a plant genome, wherein recombination in the plant genome is induced after transposition has taken place, so as to induce a deletion or inversion between the original and the new position of the transposon. The invention further relates to a method in which the DNA deleted by recombination is isolated.

Background of the invention Introduction

The induction of mutations and in particular deletions in the genome of an organism forms a very important tool in studying the molecular organization of the genome. Organisms with a mutant phenotype often form the basis for the characterization and isolation of a gene or a set of genes. In prokaryotes in particular, frequent use is made of the induction of deletion mutants for research into the molecular structure of the genome, as well as for the characterization and isolation of genes which are being researched.

In prokaryotes, the process of deletion induction is relatively simple because large numbers of specimens can be tested and the frequency at which homologous recombination occurs is relatively high. In eukaryotic cells, however, the frequency at which homologous recombination occurs is much lower and therefore it is less simple to induce deletion mutants in these cells at a high frequency. It is true it is possible to obtain mutants in prokaryotic and eukaryotic cells by chemical means, UV irradiaton, stress treatment, etc. These methods mainly yield point mutations and deletions/insertions of a few base pairs in the DNA of the treated cells. The mechanism by which these mutations are produced is often unclear and the location of the mutation produced in the genome cannot be traced, unless there is selection for a predetermined mutation.

By contrast, the location of a mutation can be determined when use is made of insertion mutagenesis. The point is that the mutated gene can then be isolated by making use of the known sequence of the mutagen used.

In prokaryotes, often use is made of transposons as an insertion mutagen. A transposon is a particular DNA fragment that is capable of changing its position in the genome of the host. This change in position can occur via a so-called conservative mechanism, whereby the gene excises from the original position and then reintegrates into the genome at a new location. In prokaryotes, however, there are also transposons known which transpose via a replicative method. In this case, a complete copy of the transposon is left behind at the original position, while a new copy of the transposon inserts at another location in the genome. The reintegration of a transposon in or near a particular gene can then lead to the generation of a mutation in that the expression or the regulation of the gene or of several genes is disturbed.

In eukaryotic cells, too, transposons are used to isolate genes by means of insertion mutagenesis, while in plant cells use is made inter alia of the transfer DNA (T-DNA) of • Agrobacterium tumefaciens as an insertion mutagen (Errampalli et al. 1991) . In principle, however, any DNA fragment capable of insertion into the genome of an organism can be used for this purpose.

In some cases, it is also possible in bacteria to induce deletions, in addition to insertion mutants, after transposition. This is the result of a replicative mechanism by which certain transposons transpose in bacteria. Then a copy of the transposon is left behind at the original site and homologous recombination can take place between the transposon on the old and new locations (Sherratt 1989) . In animal cells and plant cells, too, use is made of transposition to obtain insertion mutants. Here, however, it is not possible to induce deletions after transposition, because, on the one hand, transposition occurs in accordance with a different mechanism than replicative transposition and, accordingly, during normal transposition no copy of the transposon is left behind on the original location, and, on the other hand, the frequency of homologous recombination in animal cells and plant cells, compared with regard to bacteria, is so low that even if several copies of a transposon are present, deletion mutants can only be found under very stringent selection pressure. In addition to homologous recombination, there are a number of site-specific recombination systems known which induce recombination at high frequencies in the prokaryote (Abremski et al. 1983) and in yeast (Broach and Hicks 1980) . These systems are used for the induction of deletion and/or inversion mutants in the hosts in question. The use of a heterologous site-specific recombination system in the eukaryotic cell offers the unique possibility of obtaining recombination in these cells at a higher frequency, whilst the homologous recombination frequency remains low. This datum therefore makes it possible to induce specific deletions in the eukaryotic genome by means of transposition, as is described in detail herein below. This manner of inducing deletions or inversions in the eukaryotic genome provides the possibility of inducing specific mutations in the eukaryotic genome at a reasonable frequency and can therefore contribute quite considerably to the characterization and isolation of genes from the eukaryotic genome. Background Recombination

In order to be able to use recombination systems in plants for the isolation of mutants, it is first of all necessary to use a properly characterized system. So far, however, endogenous forms of homologous and site-specific recombination systems in plants have not been examined in detail. Further, the mechanism for the recombination events that occur in the plant is not known in detail. This explains why these endogenous recombination systems are not regulatable as yet and hence are not useful for the targeted and controllable induction of deletions in the plant genome. Further, the frequency at which recombination occurs in the plant is very low and hence, for that reason too, the endogenous recombination systems cannot be properly used, if at all, for the induction of deletions in the plant genome. In animal systems, a great deal of research has already been done towards optimization of recombination, although the frequencies are very low and a stringent selection forms an important part in these experiments (for an overview, see Bollag et al. 1989) . Still, recently many attempts have been made to make use of homologous recombination in plants. As yet, recombination in plants can be demonstrated only under stringent selection at a very low frequency (Offringa et al. 1990; Peterhans et al. 1990; Paszkowski et al. 1988; Baur et al. 1990; Putcha and Hohn 1991) . The experiments described so far have mainly focused on homologous recombination of extrachromosomal DNA with sequences in the genome, which results in an insertion of certain sequences into the genome. However, little research has been carried out on the formation of deletions or inversions in the genome.

Another possibility of obtaining recombination in plants is the introduction of a heterologous recombination system into the plant. This has as an advantage in that the newly introduced recombination system can be regulated, in contrast to endogenous recombination systems.

Recently, a number of site-specific recombination systems have been successfully introduced into eukaryotic cells . These relatively simple recombination systems appear to operate with very high efficiency in both animal and plant cells (Dale and Ow 1990; Sauer and Henderson 1990; O'Gorman et al. 1991; Maeser and Kahmann 1991; Onouchi et al. 1991) . An advantage of these site-specific recombination systems is that they are simple and have been examined in detail for the mechanism of recombination. A further advantage is that these recombination systems can be separated into two elements, viz. the recombination sequences and the proteins (recombinases) involved in the recombination process. This offers the unique possibility of first inserting the recombination sequences into the genome, whereafter later, at a desired time, the recombinase can be introduced, leading to the recombination between the recombination sequences present in the genome. However, a disadvantage of recombination systems such as these is that the recombination sequences must be introduced into the eukaryotic genome again and again. In the final analysis, this makes these recombination systems suitable only for the deletion or inversion of fragments of newly introduced DNA or for the site-specific introduction of DNA into the eukaryotic genome (Odell et al. 1990; Sauer and Henderson 1990; 0'Gorman et al. 1991; Dale and Ow 1991; Bayley et al. 1992; Russell et al. 1992) .

Introduction of a recombination system into eukaryotic cells will lead to the integration of DNA at fairly random positions in the genome, regardless of the transformation method used. When the recombination sequences integrate independently of each other at random positions in the genome, there is little chance that two recombination sequences will be located in one and the same chromosome, and therefore mainly interchromosomal recombination will be induced. Only when both recombination sequences are located relatively close to each other in one chromosome is it possible to obtain inversion and deletion mutants. It is conceivable, however, that a site-specific recombination system is used, for instance, for the deletion of particular DNA segments which are important for the transformation process but thereafter no longer fulfill any essential function for the transformed organism ( Dale and Ow 1991; Russell et al. 1992) . In that case, the recombination sequences can be introduced into the genome simultaneously on one piece of DNA. It is further conceivable that the use of an inversion or deletion system makes it possible to influence the regulation of gene expression of genes that are introduced into the eukaryotic genome (Golic and Lindquist 1989; O'Gorman et al. 1991; Maeser and Kah ann 1991; Onouchi et al. 1991; Bayley et al. 1992) .

Background transposition The present invention further makes use of transposition in such a manner that a large number of deletions can be created in the eukaryotic genome.

A great deal of research has been done into transposition in prokaryotes and eukaryotes. In particular with respect to prokaryotes, a great deal is known about the mechanism by which different transposable elements move within the genome. Both the process of conservative transposition and the process of the replicative transposition have been studied in detail (Sherratt 1989). In yeast and animal cells (Baltimore 1985), too, a large number of transposable elements are present. Many of these transposable elements originate from a retrovirus and these transpose via a conservative mechanism, although there are also indications of transposable elements which transpose via a mechanism related to the replicative mechanism (Craig 1-990) .

Research on transposition in plants has been done for many years now in Zefl mays and Antirrhinum roaj s (for an overview, see Fedoroff 1989) . From £. mays different transposable elements have been isolated, including Mul, Spm/En and Ac. From both Spm and Ac, non-autonomous elements have been isolated as well, viz. dSpm and Ds, respectively, while Mul seems to be a non-autonomous element itself. From &. aius a large number of elements have been isolated as well, including Taml and Tam3. In addition to the presently best- studied elements from Z.- mays and &. maήus. in a large number of plant varieties transposable elements have been described and isolated, including the tobacco transposable element Tnt-1 (Grandbastien et al. 1989) and the Petunia hybrida element dTphl (Gerats et al. 1990) . Introduction of transposable elements, such as Spm/dSpm, Ac/Ds, Tam3/dTam3, into heterologous hosts has revealed that these transposable elements can also be active as a two-element system in a new host (Haring et al. 1991) . The Ac/Ds system in particular is active upon introduction in a large number of plants, such as tobacco (Nicotiana tabacum. , tomato .Lvcooersicon esculent.rim. , Arabiriopsis thaliana. potato (Solanum tuberosum) , soy (Glvcine max.. Petunia hvbrida. carrot (Daucus C_flrPta) and rice (Orvza sativa) (Baker et al. 1986; Van Sluys et al. 1987; Knapp et al. 1988; Yoder et al. 1988; Haring et al. 1989; Houba-Herin et al. 1990; Jing-liu et al. 1991). In a number of these plants, including tobacco and tomato, it has been demonstrated that the Ac element can excise from the original site of integration in the genome and subsequently reintegrate at a new position in the plant genome. It has f rther been demonstrated that in these plants transactivation of the non- autonomous Ds element can occur if Ac or the gene for the Ac transposase is active in the same cell (Lassner et al. 1989; Rommens et al. 1991) . The property of a transposon to reintegrate at a new position in the plant genome makes transposable elements suitable for the isolation of plant genes (Hille et al. 1989) . As in prokaryotes, transposons such as Ac/Ds can be used in the plant for mutating (tagging) a particular gene. By the insertion of a transposon into a particular gene, a phenotype can arise, whereafter the transposon can be used as a tag in the isolation of this gene. This so-called transposon tagging strategy has been succesfully applied in the original hosts, such as . maius and £. mays, of transposable elements (Martin et al. 1985; Doring 1989) and is presently utilized in a number of laboratories for the isolation of plant genes from heterologous plant varieties whose gene product is not known (Haring et al. 1991) . As a result of the size of the plant genome, the frequency at which a specific gene is eliminated by a transposon will be low. Here, in fact, there is selection for an insertion of the transposon into a gene or the regulatory sequences of a gene (2-5 kbp) in a plant genome of 10⁵-10⁶ kbp. In order to raise the frequency at which a gene can be tagged, in different ways research is being done into the possibilities of optimizing transposon tagging. One possibility under consideration is for instance to uncouple the transposon and the transposase so as to enable regulation of excision and reintegration of the transposon. Uncoupling the transposon and the gene coding for the transposase, which is normally located in the element itself, means that these elements are introduced separately into the plant genome. For instance, the transposable element has become non-autonomous (Ds) through a deletion in the area of the transposase gene. Such a Ds element only needs the terminal repeats and parts of the subterminal sequences to be able to transpose efficiently, after transactivation by an introduced active transposase gene. The Ds element can now at the site of the deletion be equipped with random sequences without this adversely affecting the transposition process. This property of non- autonomous transposable elements makes it possible to equip these elements with sequences enabling the detection, selection (marker genes) and isolation (bacterial origin of replication [ori] and an antibiotic resistance) of these elements (Rommens et al. 1992b) . Uncoupling a transposon into two elements further makes it possible, for instance, to influence the expression of the transposase gene. This can be effected inter alia by the insertion of new regulator sequences around the coding sequence of the gene. It would for instance be possible to regulate the timing and frequency of transposition by using an inducible promoter (Rommens et al. 1992a; Scofield et al. 1992) .

Finally, it is known that transposons do not jump to entirely random positions in the genome. There seems to be a correlation between the distance of transposition and the frequency at which these events occur. Although hitherto very little research has been done into the integration pattern of transposons in plants, there nevertheless seems to be a preference for integration close to the original excision position (Dooner and Belachew 1989; Jones et al. 1990; Dooner et al. 1991; Osborne et al. 1991; Belzile and Yoder 1992) . This possible property of transposons such as Ac/Ds has as a consequence that it may be advantageous to start a tagging experiment from a position not far away from the locus of interest.

Although a transposition system in the plant can be used for the isolation of insertion mutants, this system cannot lead to an efficient isolation of deletion mutants. Small deletions or changes in the sequences located adjacent the transposon as a result of aberrant excision occur in a small percentage of the transposition events, but these events are not specific and therefore cannot be regulated (Dooner et al. " 1988) . Therefore, to enable induction of deletions into the plant genome, something will have to be added to the transposition system as such so as to initiate the generation of deletions after the transposition.

Summary of the invention

The invention provides a method for providing a deletion or inversion mutation in a plant genome, comprising integrating into the plant genome recombinant DNA which comprises a transposable element as well as, both in and outside the transposable element, a recombination sequence, effecting transposition of the transposable element including the recombination sequence present therein and effecting recombination between the recombination sequence which has been left behind and the recombination sequence which has jumped, resulting in a deletion or an inversion of the DNA located between the two recombination sequences, depending on the relative orientation of the recombination sequences involved.

The recombination sequences can each consist of a single recombination sequence or be linked in inverted repeat to a second specimen of the same recombination sequence. It is preferred that either the recombination sequence located in the transposable element or the recombination sequence located outside the transposable element, or both, are linked in inverted repeat to a second specimen of the recombination sequence. It is thereby ensured that a deletion can always be induced.

In the case where a chromosomal deletion occurs, the invention further provides a method for the purification of the deleted chromosomal DNA fragment. To that end, the chromosomal DNA is isolated from the parent plant from which the deletion mutant originates. Using the purified Cre protein a recombination reaction in vitro is performed on this DNA. The thus isolated circular DNA fragment is identical to the deleted DNA fragment in the deletion mutant and can subsequently be cloned using plasmid rescue (if a bacterial replication origin [ori] is present on the fragment removed by recombination) or using a second recombination reaction which introduces the DNA into a vector which contains the loxP sequence (e.g. cosmid, YAC, etc.).

According to the invention, the transposable element is preferably a non-autonomous transposable element which does contain the cis elements required for transposition (terminal and subterminal sequences) but does not contain the trans elements required for transposition (transposase genes) . Although it is also possible to use an autonomous transposable element which also contains the trans elements required for transposition, this leads to complications and is therefore not preferred.

The transposition of the non-autonomous transposable element with the recombination sequence present therein is preferably effected by introducing the trans elements required for transposition (transposase genes) into the plant. This can be done by means of a transient expression of transposase genes which have been introduced into the plant but have not been built into the genome, by retransformation or by crossing with a plant having the required transposase genes in its genome.

In a preferred embodiment, as non-autonomous transposable element the Ds element of Zea mays is used and as trans element for transposition the Ac transposase gene of Zea mays is used. The recombination between the recombination sequence which has been left behind and the recombination sequence which has jumped is preferably effected by introducing the trans elements required for recombination (recombination genes) into the plant. Here, too, it is possible to utilize transient expression, retransformation and introduction into the genome of the required recombination genes by crossing with a plant that contains these genes.

In a preferred embodiment, as recombination sequence the loxP sequence of bacteriophage PI is used and as trans element for recombination the Cre recombinase gene of bacteriophage PI is used. For the transformation of plants and integration into the genome, different techniques can be used, such as direct transfer and transformation using Agrobacterium tumefaciens .

It is preferred that the integration into the plant genome of the recombinant DNA which comprises a transposable element as well as, both in and outside the transposable element, a recombination sequence, is effected using an Agrobacterium tumefaciens strain which contains a T-DNA construct, which T- DNA construct comprises the left-hand and right-hand ends of the T-DNA required for transfer to plants, with an insertion of the recombinant DNA mentioned located therebetween.

As far as the components of the recombinant DNA are concerned, it is preferred that the transposable element incorporates a bacterial replication origin; a bacterial marker gene, for instance a chloramphenicol resistance gene; and/or a marker gene that is active in plants, such as the β-glucuronidase gene (GUS) or the herbicide resistance gene bar, provided with transcription promoter and transcription terminator sequences active in plants; and that the recombinant DNA contains a marker gene that is active in plants, such as the hygromycin resistance gene Hptll, provided with transcription promoter and transcription terminator sequences which are active in plants, the transposable element having been inserted between the promoter and the marker gene; contains a marker gene that is active in plants, such as the tms2 gene from the octopin TL-DNA, provided with transcription promoter and transcription terminator sequences that are active in plants, which enables selection of plants in which a deletion has taken place; or contains a marker gene that is active in plants, such as the spectinomycin resistance gene, which can function as positive deletion marker; and contains a marker gene that is active in plants, such as the kanamycin resistance gene Nptll, provided with transcription promoter and transcription terminator sequences which are active in plants, which enables selection of transformed plants.

The invention extends to recombinant DNA comprising a transposable element as well as, both in and outside the transposable element, a recombination sequence, which recombinant DNA can be used in the above-mentioned method, as well as to a plant which contains an insertion of this recombinant DNA or, through a genetic manipulation by means of the method described, has been provided with a deletion or inversion mutation in the genome. Detailed description of the invention

The invention relates to a method for the efficient induction of deletions and inversions in the plant genome. This method comprises introducing into the plant at least one non-autonomous transposable element equipped with a recombination site, simultaneously with a second recombination site which is located in the same piece of DNA. The method further comprises the introduction of the transposase gene into the same plant, whereafter transposition of the introduced non-autonomous transposable element can take place. The method further comprises the introduction of the recombinase gene into the same plant, whereafter recombination can take place between the recombination sequences present in the originally inserted DNA and the Ds element which has jumped, resulting in inversion/deletions of the intervening sequences.

The use of transposons in combination with a site- specific recombination system is unique and offers the possibility of using an efficient recombination system in the plant, with a view to obtaining a large number of independent deletion and inversion mutants. Heretofore, using either a transposition system or a recombination system in the plant, this was not possible because the frequency at which inversion or deletion mutants are generated with these systems is very low. By the combination of these two systems it is possible, by analogy with deletions induced in prokaryotes by transposition, to induce deletions in eukaryotes after transposition. The difference between this new system and the prokaryotic system is that in prokaryotes transposons such as Tn3 transpose via a replicative mechanism, with the result that, in addition to a newly integrated copy of the transposon, the original copy is still present in the genome as well. As a consequence, in these cases homologous recombination can take place between the two copies of the transposon (Sherratt 1989) . In eukaryotic cells, to date mainly transposable elements are known in which the transposition occurs according to a non-replicative mechanism, with the result that no transposon sequence is left behind in the original position ("empty donor site") . As a consequence, the use of these transposons does not enable the induction of homologous recombination after transposition and if a form of replicative transposition occurs nevertheless, the homologous recombination frequency in plants is too low to permit efficient recombination between the two transposon copies. However, when the transposon is now introduced into the plant genome, together with a recombination sequence, and the t'ransposible element itself is also equipped with a recombination sequence, after transposition one of the recombination sequences will reintegrate with the transposon at a new position in the genome, while the second recombination sequence is neatly left behind right beside the original position ("empty donor site") of the transposon which has jumped. When the recombination sequences are then located in the plant genome at a certain distance from each other, recombination can be induced between the original and the new position of the transposon by introducing into the cell the recombinase which acts on the relative recombination sequences. An advantage of this method is that the starting point of the thus obtained deletions/inversions in the plant genome is known, namely the recombination sequence in the DNA originally introduced into the plant. A further advantage is that the frequency of the site-specific recombination process induced by the recombinase is much higher than the freqency at which recombination occurs between two homologous sequences in the plant.

Thus, in view of the fact that a transposon is capable of transposing to a large number of independent sites in the plant genome, a large number of deletions and/or inversions can be obtained in this way, starting from one and the same original DNA insertion. This primary DNA insertion in the plant genome must consist of only two essential components. In the first place, this piece of DNA must contain a transposable element which is capable of excising and reintegrating at a new position in the plant genome. This transposable element, then, must contain one of the recombination sequences of a recombination system that is capable of inducing recombination in the plant genome. This sequence must be inserted into the element in such a manner that this element is still capable of transposition. Secondly, adjacent to this transposable element, a second recombination sequence must be located, which does not jump along with the transposable element during the transposition process but is left right beside the original position ("empty donor site") of the jumped element. If two-element systems are used, in addition to this primary DNA construct, the genes that are involved in transposition and recombination must also be introduced into the plant.

Depending on which system is used, this can mean that one or more genes involved in transposition must be introduced. For Ds transposition, the Ac transposase is sufficient for this purpose. It also depends on the selected recombination system how many genes involved in the recombination process must be introduced. For the Cre/loxP system of bacteriophage PI, the FLP recombination system of yeast and the Zygosaccharomvces recombination system, this concerns only one gene, viz., the Cre recombinase gene (Gre gene) , the FLP gene and the R gene, respectivel .

The introduced genes for transposition and recombination should in any case contain a promoter that is active in the intended host. A strong promoter is preferred so as to obtain a highest possible frequency of transposition and recombination. It is also possible to use regulated or regulatable promoters to obtain a particular expression pattern of these genes. In addition, the introduced genes should preferably contain a 3' flanking region having therein a polyA addition signal that is functional in the intended host.

Finally, it is known with regard to plant transposons that a large proportion of the transpositions occur across small distances in the same chromosome, while only a small percentage seem to transpose to another chromosome (Greenblatt 1984; Jones et al. 1990; Dooner et al. 1991; Osborne et al. 1992; Belzile and Yoder 1992) . This means that a series of deletions/inversions can readily be obtained in one chromosome, starting from the original position of the transposon in this chromosome.

Description of the figures The invention is further illustrated in the schematic drawings, in which

Fig. 1 schematically represents a part of a plant genome with an insertion of recombinant DNA according to the invention, comprising T-DNA having therein a recombination sequence Lox and a non-autonomous transposable element Ds having therein a second specimen of the recombination sequence Lox (top) ; and schematically represents the situation resulting from a transposition induced with Ac transposase (middle) ; and schematically represents situations resulting from a deletion induced with Cre recombinase (bottom) ;

Fig. 2 schematically represents a T-DNA construct which contains, between the left-hand and right-hand ends (LB and RB, respectively) of the T-DNA, an Ac transposase gene having a 3'-end of its own and the CaMV 35S promoter as well as the chloramphenicol resistance gene CAT (top) or the kanamycin resistance gene Nptll (bottom) , both provided with promoter and terminator sequences that are active in plants; Fig. 3 schematically represents a T-DNA construct which, between the left-hand and right-hand ends of the T-DNA, contains a Cre recombinase gene as well as the kanamycin resistance gene Nptll, both provided with promoter and terminator sequences which are active in plants; .

Pig. 4 schematically represents a DNA construct which, between the terminal and subterminal sequences of the non-autonomous transposable element Ds, contains: a double loxP sequence, a bacterial replication origin (ori) , a bacterial chloramphenicol resistance gene (Cm) as well as the β- glucuronidase gene GUS (top) or the Basta^R herbicide resistance gene bar (bottom) , both provided with promoter and terminator sequences that are active in plants; Fig. 5 represents a Ba HI fragment having therein the loxP sequence (top), a Hindlll fragment having therein a __ϊ_2t_I site and the loxP sequence (middle) , and a Hi&dlll fragment having therein two loxP sequences ordered in inverted repeat, separated by a NotI site (bottom) ; Fig. 6 schematically represents the part of the vector pMH2057 that contains the hygromycin resistance gene Hptll, provided with promoter and terminator sequences that are active in plants, and the tms2 gene from the octopin TL-DNA; Fig. 7 schematically represents a T-DNA construct that contains a loxP sequence and a kanamycin resistance gene Nptll adjacent the part of pMH2057 shown in Fig. 6, having therein an insertion - in the BamHI site located between the Hptll gene and the CaMV 35S promoter - of the DNA constructs shown in Fig. 4 with GUS gene (top) and bar gene (bottom), respectively;

Fig. 8 schematically represents three strategies for the implementation of the method according to the invention; Fig. 9 schematically represents a part of a plant genome carrying the traces of a method according to the invention by which a deletion has occurred of one of the two double loxP sequences and the DNA located between the non-staggered loxP site and the staggered loxP site; Fig. 10 schematically represents a strategy for the use of positive selectable deletion marker genes;

Fig. 11 schematically represents a strategy for the implementation of a purification of the deleted chromosomal

DNA; and Fig. 12 schematically shows the construct pMV933 and pMH2713 as well as data of PCR experiments.

Examples

The invention described hereinabove relates to the use of transposition and recombination and in particular the combination of these two systems in the plant. As an example serves the preferred, well studied transposition system from maize, consisting of two elements (Ac and Ds) , as well as a site-specific recombination system from bacteriophage PI, consisting of two elements (34bp loxP sequences and the Cre- protein), in tomato. Transposable elements

From different plants, both dicotyls and monocotyls, transposons have been isolated. A number of these transposable elements from Zea mays (maize) and Antirrhinum majus (snapdragon) have meanhwhile been tested in heterologous plants. The transposable element, Tam3, from &. majus can transpose in tobacco but is inactivated by methylation, while the transposable element En/Spm originating from maize transposes in both tobacco and potato at a relatively low frequency. With the Ac element and the non-autonomous Ds element originating from maize, transposition has been demonstrated in a large number of heterologous hosts, including Nicotiana tabacum. Lyco^persicon esc lent Tr.. _______________ carota. Solanum t__berpg m, Glycine max, Qrvza sativa and Arabidopsis thaliana (see Haring et al. 1991) .

The Ac/Ds transposition system has so far proved the most reliable in heterologous hosts and the system has been studied very well. Therefore it is preferred that Ac/Ds be used for obtaining transposition in the plant, although in principle any transposition element can be used for the realisation of the method described here.

Recombination systems

Recently various site-specific recombination systems, including the Cre/loxP system from bacteriophage PI, the FLP recombination system from yeast and the R recombination-system from Zygosaccharomyces, have been introduced succesfully into animal and/or plant cells (Odell et al. 1990; O'Gorman et al. 1991; Onouchi et al. 1991) . The Cre/loxP and the FLP recombination system have both been studied very well, both in the prokaryote Escherichia coli and in yeast as well as in vitro (Broach and Hicks 1980; Sternberg and Hamilton 1981;

Abremski et al. 1983) . The R recombination system originating from the yeast plasmid pRSl and isolated from Zγgosaccharomvces rouxii has been studied in less detail, but the recombination process is very simple for all systems mentioned inasmuch as it consists of only two components, the recombinase (Cre protein, FLP protein, or R protein) and the recombination sequences (34 bp loxP sequences or FRT sequences, or SRI recombination sequences of 58 bp at most) . Recombination between two recombination sequences occurs when the Cre protein, the FLP protein, or the R protein is present and, depending on the relative position of the recombination sequences, results in a deletion of the intervening sequence (recombination sequences in direct repeat) or in an inversion of the intervening sequence (recombination sequences in inverted repeat) .

The R site-specific recombination system works not only in yeast but also in plant cells (Onouchi et al. 1991) and the FLP site-specific recombination system also works in animal cells (O'Gorman et al. 1991), while the Cre/loxP recombination system functions not only in the prokaryote £.. coli and in vitro but also in yeast (Sauer 1987), animal cells (Sauer and Henderson 1989) and plant cells (Dale and Ow 1990; Odell et al. 1990) . Introduction of the loxP sequences and the gene that codes for the Cre recombinase was sufficient to demonstrate both inversion and deletion formation in tobacco cells (Dale and Ow 1990) . Also after introduction of the loxP recombination sequences into the genome of tobacco, recombination between the loxP sequences proved possible (Dale and Ow 1991; Bayley et al. 1992) . These first experiments show that this recombination system operates efficiently in the plant. It is therefore preferred that the Cre/loxP recombination system be used in the method described here. In principle, the FLP recombination system or other site-specific or homologous recombination systems, such as the recombination system of bacteriophage lambda, can be used for this purpose as well. These systems, however, have not been extensively tested in plant cells yet.

Hosts and intrcd-ic icn PNΛ

The choice of the host is strongly related to the choice of the transformation technique. The introduction of a deletion system as described here is interesting for all crops whose genomes are being studied and contain interesting genes which are eligible for isolation. In the area of application, this concerns ornamental and food crops in particular. Genes involved in the formation of the product of these crops, such as the flower, fruit, root, leaf, etc., are interesting genes to isolate. Further, the genes that play a role in the immune system of the plant are interesting genes that are eligible for isolation. It is therefore important that the system described here can be introduced into hosts such as ornamental and food crops. Also to be considered are hosts of non¬ commercial plant species such as wild varieties and ancestors of the present culture crops. In principle, it is possible to introduce the system described into any plant if a transformation method for the intended host exists. As examples of a host for the system described, use is made of tobacco .Nicotiana tab um) , tomato ( y P erSJCCn esculentum. and Arabidopsis thaliana.

The introduction of DNA into the plant genome can be realised in a number of manners. One possibility is the introduction of DNA directly into the plant cell, whereafter integration into the plant genome occurs in accordance with an unknown integration mechanism (Hain et al. 1985) . A second possibility is the introduction of foreign DNA into the plant cell using the basic bacterium Agrobacterium tumefaciens. With regard to this bacterium, it is known that a specific piece of DNA (T-DNA) is neatly injected and subsequently integrated into the plant genome (Melchers and Hooykaas 1987) . With respect to both transformation systems, it is known that the DNA integrates into the plant genome more or less at random. There does seem to be a slight preference for the integration of the T-DNA into DNA that is actively transcribed, although there are not yet sufficient data available for this .

Methods whereby DNA is introduced directly into the plant cell are limited for the time being for a large number of crops owing to the possibility of regeneration of the transformed plant tissue, while, on the other hand, it is not yet clear whether all plants, in particular monocotyls, can be transformed by Agrobacterium. However, there are examples known of the introduction of the T-DNA by A., tumefaciens in monocotyls (Hooykaas-Van Slogteren et al. 1984) .

The use of A., tumefaciens for the introduction of DNA into the plant genome is preferred to the use of direct DNA transfer because in this transformation method the integration of a specific piece of DNA occurs in a controlled manner, in contrast to the integration after direct DNA transfer.

When A. tumefaciens is incapable of transforming a particular plant, however, use can be made of other transformation techniques such as the direct DNA transfer. Direct introduction of DNA is realised inter alia by PEG/Ca transformation, electroporation, microinjection, laser techniques and via particle bombardment.

Induction of deletions/inversion.-, using Ac/Ds and Cre/loxP Both the transposition and the recombination systems can be introduced into tomato as two-element systems, namely the Ac/Ds transposition system and the Cre/loxP recombination system. By inserting the loxP sequences into, on the one hand, a Ds element and, on the other, the T-DNA with which this Ds element is introduced into the plant, these systems can be connected with each other. By transactivation of the Ds element (using "Ac transposase"), excision of this element from the T-DNA will occur, with subsequent reintegration at a position elsewhere in the plant genome. With the Ds element, the loxP sequence, present in Ds, will also jump away from the loxP sequence which is present in the T-DNA. After the loxP sequences have been removed from each other over different distances by independent transposition events, recombination on the loxP sequences can be induced by introduction of the Cre protein, resulting in deletions of different size starting from the T-DNA (see Fig. 1) . When inversions or deletions are formed in the plant genome, it can be studied whether this results in a mutant phenotype. The combination of the Cre/loxP system and Ac/Ds transposition in tomato therefore gives the possibility of inducing mutations (deletions/inversions) in the plant genome at increased frequency.

Description of the constructs

First of all, the recombination system and the transposon system are introduced into the plant. Using - tumefaciens. transgenic plants containing the "Ac transposase" gene, plants with the Cre recombinase gene and plants with the Ds element and the loxP sequences are made.

The Ac transposase is a gene originating from the Ac transposable element. It codes for the transposase, essential to the transposition process of Ac and Ds elements. Although this gene is expressed in monocotyls and dicotyls, the coding sequence for this protein (the transposase) can be regulated by different promoter (5*-end) and transcription terminator (3'-end) sequences. In this example, the choice opted for was to provide the gene with a strong constitutive plant promoter, namely the CaMV 35S promoter originating from the cauliflower mosaic virus genome (Odell et al. 1985) , while use is made of the transcription termination sequences of the transposase gene itself (see Fig. 2) . Particularly in certain hosts such as Arabidopsis thaliana. a strong promoter for the transposase gene is important to obtain transposition of the Ds element at a reasonable frequency. In hosts such as tobacco and tomato, however, it is sufficient to use the transposase gene provided with its natural promoter sequences.

Two different constructs with CaMV 35S transposase are available. The first CaMV 35S transposase construct was made by first cloning a Hindlll/Smal fragment coming from pBI121 (Jefferson et al. 1987), with the CaMV 35S promoter thereon, into the £. coli vector pUC19 (Yanisch-Perron et al. 1985) . In addition, in the S al en EcoRI sites a Nael/EcoRI fragment (ca. 3.8 kbp) from Ac was cloned having located thereon the entire encoding sequence of the transposase and the 3'-end with the polyA addition signals. The entire insertion was subsequently transferred into another £. coli vector, pSK- bluescript (Stratagene) as a Pstl/Clal fragment (pTT261) . From this vector the CaMV 35S transposase construct was transferred as a Sacl/Sall fragment into a binary vector with a chloramphenicol restistance gene, as described by Haring et al. (1991; see Fig. 2) . The second CaMV 35S transposase construct was made by replacing the BamHI/Xhol fragment in the binary construct pTT230 (Rommens et al. 1991) with the BamHI/XhoI fragment from the pTT261 construct described hereinabove (see Fig. 2) . The Cre gene originating from bacteriophage PI is provided with prokaryotic transcription regulation sequences, and therefore here, too, the 5' end of this gene was replaced with the CaMV 35S promoter sequences, while the 3 '-end of the nopalin synthase gene, with a polyA addition signal therein, was used as transcription terminator sequence for this construct (see Fig. 3) . The construct used is a derivative of the construct pED32 which is described in detail by Dale and Ow (1990) . This CaMV 35S-Cre construct was set as a Xhol/Hindlll fragment into the Sall/Hindlll sites of the binary vector Bin 19 (Jefferson et al. 1978, Figure 3) . For the purpose of the method described here, in principle use can be made of any regulatory sequence, resulting in the formation of active transposase or recombinase, but here a preference is expressed for the strong CaMV 35S promoter for the transposase and Cre gene so as to induce a high transposition and recombination frequency.

As Ds element, in this example use is made of an element consisting of the terminal inverted repeats and the subterminal sequences which are necessary for transposition. This Ds element is derived from the Ac element originating from the waxy-m7 allele of maize (Behrens et al . 1984) . It is possible to insert DNA between the sequences of the two Ds ends, which, during transposition subsequently jumps along with the transposable element to new locations in the genome. In this example, the Ds element is equipped not only with the sequences necessary for transposition but also with a detectable or selectable marker, a bacterial origin of replication (ori) and a synthetically prepared sequence consisting of the loxP sequence:

ATAACTTCGTATAATGTATGCTATACGAAGTTAT SEQ ID NO:l and the recognition sequence (GCGGCCGC) for the restriction enzyme NotI. Of these sequences only the loxP sequence is necessary for the functioning of the system described here. The other sequences which have been set in the Ds element here are used as aids during the analysis of the transgenic plants. The inserted replication origin (ori) sequence and the NotI restriction site are for instance used to simplify the isolation of the elements from the plant genome before or after transposition, while the ori sequence can also be an important aid during the isolation of deleted chromosomal DNA segments using recombination reactions. The insertion of a marker gene into the Ds elements makes it possible to test plants in a simple manner for the presence of the transposable element. The Ds element described here has been demonstrated to be capable of excising and reintegrating when it has been transformed to the plant genome (Rommens et al. 1991) . The starting material for constructing these Ds elements was £• coli vector pACYC184 (Chang and Cohen 1978) . The Sphl/Nrul fragment of pACYC184 was replaced with a Sphl/Nrul fragment having located thereon the terminal ends of the Ac element (586 bp 5' end and 448 bp 3'-end), separated by a Bglll site, as described in Haring et al. 1989. As a result, the thus obtained Ds element (pACYC-Ds) is already provided with a bacterial replication origin with an antibiotic resistance for chloramphenicol. Then the selected marker gene and the loxP sequences can be introduced into the vector part of this construct, whereby the inserted sequences likewise come to lie between the ends of the Ds element (see Figure 4) . In Figure 4 both possible orientations of the loxP fragment are schematically represented.

In this example, two different Ds marker genes are described; the detectable marker β-glucuronidase (GUS) and the selectable marker against the herbicide Basta^R, the bar gene. In this example both genes are regulated by the CaMV 35S promoter sequences and the GUS gene is provided with the nopalin synthase transcription terminator sequences, while the bar gene is provided with the transcription terminator sequences of transcript 7 of the octopin T-DNA (Figure 4) . The CaMV 35S GUS construct has been described by

Jefferson et al. (1978) and was inserted as a Hindlll/EcoRi fragment from pBI121 into the Hindlll and Xk&I sites of the pACYC-Ds construct. For this purpose, the Xbal and EcoRI sites were filled up using DNA polymerase. The CaMV 35S bar construct has been described by De Block et al. (1987) and was inserted as a iϋndlll/EcϋRI fragment from pGSFR280 into the Hindlll and Asel sites of the pACYC-Ds construct. The synthetic loxP/Notl sequences were subsequently inserted into the Hindlll site of these constructs, preferably with the NotI site adjacent the marker gene and the loxP sequence directly adjacent the end of the Ds element (see Figure 4) . The sequences of two different loxP/Notl Hindlll fragments are specified in Figure 5. In the case of the insertions with the double loxP sequences with the NotI site in between, the orientation of the fragment is of course not important.

In the construction of the Ds elements, elements with a single loxP sequence and with double loxP sequences were opted for, because it may be an advantage if a double loxP sequence is present in the element. In these double loxP sequences, two loxP sequences are located in inverted repeat relative to each other (Figure 5) . This has as an advantage that always one of these loxP sequences will be present in direct repeat relative to the loxP sequence which has been left in the T-DNA after transposition, independently of the orientation in which the Ds element has reintegrated into a new location in the genome. In theory, therefore, a deletion can always be induced between the loxP sequence in the T-DNA and the jumped Ds element.

However, between the loxP sequences which are present adjacent to each other in the Ds element, only inversion can occur, so that in principle the construct does not change after recombination between these two loxP sequences. In contrast to these constructs with double loxP sequences, with regard to Ds elements with a single loxP sequence, it depends on the^' orientation of reintegration whether a deletion or an inversion will occur between the loxP sequence in the newly integrated Ds element and the loxP sequence in the T-DNA.

The different above-described Ds elements are subsequently inserted between the promoter (CaMV 35S) and the encoding sequence of the resistance gene for hygromycin (Hptll) in pMH2057 (Figure 6) . ρMH2057 was obtained by insertion of the Ss ϊ CaMV 35S-HptII fragment from pTT218 as described by Haring et al. (1989) and the tms2 gene from the octopin TL-DNA (3490 bp Sphl/Xhol fragment) into the £. coli vector pUC19 (Yanisch-Perron et al. 1985, see Figure 6) . The promoter sequence for the Hptll gene again consists of sequences of the CaMV 35S promoter, while the gene contains the nopalin synthase 3'-end as transcription terminator. The insertion of the different Ds elements as a Bglll fragment into the BamHI site of the construct, between the promoter and the encoding sequence of a selectable marker, has as an advantage that hereby selection for excision of the Ds element from this construct can be effected. After excision of the Ds element from the T-DNA, the Hptll gene can be expressed and the cell has thus become hygromycin resistant . Insertion of the tms2 gene next to the Ds element provides the possibility of selecting for certain deletion events. The fact is the tms2 gene can be used as a negative selectable gene, which means that selection for the loss (by deletion) of this gene is possible. Although this is not necessary for the method described here, the presence of a negative selectable gene, such as the tms2 gene, or a positive selectable or detectable deletion marker, can substantially simplify the selection of plants in which deletions have occurred.

The different thus obtained constructs can now finally be transferred into a binary vector already having located therein a selectable marker and loxP sequence. The selectable marker, in this case the gene for kanamycin resistance (Nptll gene), is in this vector provided with the mannopin 5'- and 3'- regulatory sequences and is used for the selection of transgenic plants after transformation. The binary vector pCGN1548 used in this example has been described by McBride and Summerfelt (1990) . Into the B^mHI site of this vector, the synthetic BamHI fragment with the loxP sequence has been inserted (see Figure 5) . Adjacent thereto, the different Ds- containing constructs are inserted as a EBH.1 fragment. The constructs are then located within the "direct repeats" of the T-area, which is transferred to the plant cell by A. tumefaciens (see Figure 7) .

Using A. tumefaciens LBA4404 (Hoekema et al. 1983), the different T-DNA constructs as described above are transformed to - tabacum and £. esculentum via the "leaf disk" method (Fillatti et al. 1987) and to A- thaliana via the root transformation technique (Valvekens et al. 1988), in order to test the system in these different hosts. The primary transformants are examined for the number of T-DNA insertions (copy number) and also the location of the T-DNA insertion in the plant genome is determined in the case of transformation with the Ds/loxP construct. Full-grown plants in which the Ds/loxP element is present are now initially crossed with the "Ac transposase"-containing plants, to thereby induce transposition of the Ds element with one of the loxP sequences. The offspring of this crossing is examined by means of selection for hygromycin for the excision of the Ds element from the original position in the T-DNA and the reintegration of the element elsewhere in the genome. Then the thus obtained plants are crossed with the Cre gene- containing plants, in order to induce site-specific recombination between the loxP sequences in these plants . However, it is also possible to cross both genes simultaneously into the Ds/loxP plants, whereafter direct selection for deletion or inversion events can take place (see Figure 8) . In addition to introducing the transposase and recombination functions via crossings, it is also possible to introduce these functions into the Ds/loxP plants via retransformation.

Another way of inducing transposition and recombination in the Ds/loxP plant is to use the possibility of expressing the transposase and recombinase transiently in protoplasts of the Ds/loxP-containing plants. When this method is followed, it is not necessary that integration of the transposase and/or the recombinase gene occurs in the plant genome. Transient expression of the gene is sufficient to induce both transposition and recombination in the plant genome (see Figure 8) . The obtained deletion/inversion mutants (and the offspring of the following generation after self-pollination) can subsequently be analysed for the size of the deletion/inversion that has taken place and the occurrence of a phenotypical change, allowing subsequent characterization and optional isolation of the gene that is responsible for this mutation.

When after recombination between the loxP sequences of the above-described construct a deletion is created in the plant genome, a part of both the T-DNA and the jumped Ds element will be left behind in the genome. The deletion will lead to only one loxP sequence being left in the genome, thereby preventing the occurrence of Cre-induced recombination, while also only one end of the Ds element is left, so that transposition of this element can no longer occur either (see Figure 9) .

For the selection of deletion mutants in the plant, also a positive selectable marker can be used, as will be illustrated with reference to the construct shown in Figure 10. The underlying basis of the construct is that a promoter-less marker gene cannot be expressed until after the formation of a deletion, because only then a promoter for the gene is present. The system is comparable with the system that is used for the detection of transposition events using an excision marker which likewise cannot be expressed until the transposon between the promoter and the excision marker has disappeared through transposition. In Figure 10 both systems are coupled, with one and the same promoter being used for the expression of the excision marker (after transposition) and the deletion marker (after occurrence of a chromosomal deletion) . However, it is also possible to make constructs with two different promoters.

Tobacco plants which contain the Ds/loxP described are provided with the recombinase protein Cre by means of retransformation of these plants with an Agrobacterium tumefaciens strain which contains the CaMV35S-Cre gene described in the T-area. Using PCR techniques, it has been demonstrated that in the genome of these plants the expected deletions and inversions do indeed occur, which shows that the constructs made in the plant are actually functional. Figure 12 summarizes the results of the PCR experiment in the plant. It is clear small PCR products can only be formed after the occurrence of a deletion in pMV933 and pMH2713 with, respectively, the primers pl84 + M3 and C5 + M3. These experiments further show that the double loxP sequence is an efficient target site for recombination and that this leads to ^'deletions, while inversions in these plants cannot be observed. These results correspond with results obtained with these constructs in Escherichia coli and in vitro. In addition to the efficient operation of double loxP sequences in vitro and in the plant, these experiments further show that the recombination reaction in not hindered by the presence of the Ds-end between the recombination sequences. The method described here can for instance be used for the deletion of one or more plant genes. This may concern plant genes that are present in the plant genome or newly introduced genes. These thus obtained deletion mutants can be studied at molecular level, by the isolation of the flanking sequences of the T-DNA segment left behind after the recombination event. This method can further lead to the isolation of mutants in which chromosome segments have been deleted or inverted. In these mutants, the organization of a chromosome may be changed, with possible consequences for the gene regulation of one or more plant genes. Using this method, interchromosomal recombination can occur as well, with the result that the organization of the genome changes, which can lead to different phenotypes. In addition to the deletion of specific or random plant genes, inversion of a specific or random plant gene can be induced as well, with the result that the expression pattern of that gene is changed or even becomes regulatable.

Isolation and cloning of the deleted chromosomal DNA

As shown in Figure 11, using the same recombination reaction through which a chromosomal deletion is induced in the plant genome, it is possible to isolate and clone this chromosomal DNA. To that end, the DNA is isolated from the parent plant from which the deletion mutant has been obtained. This plant therefore contains the loxP T-DNA insertion at a certain place in the genome with the Ds/loxP element that jumped from it located at a different position in the same chromosome. Then the DNA segment that has disappeared in the deletion mutant is still located between the loxP sequences. On the DNA isolated from this parent plant, in vitro under the influence of the Cre protein a site-specific recombination reaction is induced, equal to the recombination reaction which in vivo led to the deletion mutant (see Figure 11) . The DNA deleted in the deletion mutant is then isolated as a circular DNA molecule from the chromosomal DNA of the plant. Depending on the size of the isolated DNA and the presence of a bacterial origin of replication (ori) . this DNA can be- transformed and cloned directly or after a second recombination reaction. Small deletions (to some tens of kb) that contain an ori can be transformed directly to Escherichia coli. whereafter cloning is a fac . Larger deletions or deletions that do not contain any functional bacterial ori can first be introduced via a second recombination reaction into a vector which is capable of replicating large DNA segments. LoxP-containing cosmid and YAC vectors qualify for this purpose, but in principle any vector can be equipped with a loxP sequence. Given as an example here is the YAC4 vector having introduced into the EcoRI site a synthetically made loxP sequence with EcoRI ends (Burke et al. 1987) . After the DNA has been shuttled in the above-described manner from the plant genome to a DNA vector, it becomes possible to multiply and preserve this DNA, so that it becomes accessible to techniques which are available in molecular biology. Thus a method is obtained for efficiently introducing deletions in the plant genome, with, coupled thereto, a method for obtaining the deleted DNA in a relatively simple manner for molecular analysis of the deletion mutants obtained.

References:

- Abremski, K., Hoess, R. and Sternberg, N. (1983) Studies on the properties of PI site-specific recombination: evidence for topologically unlinked products following recombination. Cell 32, 1301-1311.

- Baker, B., Schell, J., Lorz, H. and Fedoroff, N.V. (1986) Transposition of the maize controlling element "Activator" in tobacco. Proc. Natl. Acad. Sci. USA 83, 4844-4848.

- Baltimore, D. (1985) Retroviruses and retrotransposons: the role of reverse transcription in shaping the eukaryotic genome. Cell 40, 481-482

- Bayley, C.C., Morgan, M., Dale, E.C. and Ow, D.W. (1992) Exchange of gene activity in transgenic plants catalyzed by the Cre-lox site-specific recombination system. Plant Mol. Biol. 18, 353-361.

- Behrens, U., Federoff, N., Laird, A., Muller-Neumann, M., Starlinger, P. and Yoder, J. (1984) Cloning of Zea mays controlling element Ac from the wx-m7 allele. Mol. Gen. Genet. 194, 346-347 - Belzile, F. and Yoder, J.I. (1992) Pattern of somatic transposition in a high copy Ac tomato- line. The Plant Journal 2, 173-179.

- Bollag, R.J., Waldman, A.S. and Liskay, R.M. (1989) Homologous recombination in mammalian cells. Annu. Rev. Genet. 23, 199-225 - Broach, J.R. and Hicks, J.B. (1980) Replication and recombination functions associated with the yeast plasmid 2μ circle. Cell 21, 501-508.

- Burke, D.T., Carle, G.F. and Olson, M.V. (1987) Cloning of large segments of exogenous DNA into yeast by means of artificial chromosome vectors. Science 236, 806-812.

- Craig, N.L. (1990) P element transposition. Cell 62, 399- 402.

- Dale, E.C. and Ow, D.W. (1990) Intra- and intermolecular site-specific recombination in plant cells mediated by bacteriophage PI recombinase. Gene 91, 79-85.

- Dale, E.C. and Ow, D.W. (1991) Gene transfer with subsequent removal of the selection gene from the host genome. Proc. Natl. Acad. Sci. USA 88, 10558-10562. - De Block, M. , Botterman, J. , Vandewiele, M, Dockx, J., Thoen, C, Gossele, V., Rao Mowa, N., Thompson, C, Van Montagu, M. and Leemans, J. (1987) Engeneering herbicide resistance in plants by expression of a detoxif ing enzyme. EMBO J. 6, 2513-2518.

- Dooner, H.K., English, J.and Ralston, E.J. (1988) The frequency of transposition of the maize element Activator is not affected by an adjacent deletion. Mol. Gen. Genet. 211, 485-491. - Dooner, H.K. and Belachew, A. (1989) Transposition pattern of the maize element Ac from the bz-m.2 (Ac) allel. Genetics 122, 447-457. - Dooner, H.K., Keller, J., Harper, E. and Ralston, E. (1991) Variable patterns of transposition of the maize element activator in tobacco. The Plant Cell 3, 473-482.

- Doring, H.P. (1989) Tagging genes with maize transposable elements. An overview. Maydica 34, 73-88.

- Errampalli, D. Patton, D., Castle, L., Mickelson, L., Hansen, K., Schnall, J., Feldmann, K. and Meinke, D. (1991) Embryotic lethals and T-DNA mutagenesis in Arabidopsis. The Plant Cell 3, 149-157. - Fedoroff, N.V. (1989) Maize transposable elements, in: Mobile DNA (eds D.E. Berg and M.M. Howe) pp. 375-411. American Society for Microbiology.

- Fillatti, J.J., Kiser, J., Rose, R. and Comai, L. (1987) Efficient transfer of a glyphosate tolerance gene into tomato using a binary Agrobacterium tumefaciens vector. Bio/Technology 5, 726-730.

- Gerats, A.G.M., Huits, H., Vrijlandt, E., Marana, C, Souer and Beld, M. (1990) Molecular characterization of a nonautonomous transposable element (dTphl) of petunia. The Plant Cell 2, 1121-1128.

- Golic, K.G. and Lindquist, S. (1989) The FLP recombinase of yeast catalyzes site-specific recombination in the Drosophila genome. Cell 59, 499-509.

- Grandbastien, M.A., Spielmann, A. and Caboche, M. (1988) Tnt-1 a mobile retroviral like transposable element of tobacco isolated by plant cell genetics. Nature 337, 376-380. - Greenblatt, I. (1984) A chromosome replication pattern deduced from pericarp phenotypes resulting from movements of the transposable element Modulator in maize. Genetics 108, 471-485. - Hain, R., Stabel, P. Czernilofski, A. . Steinbiss, H.H., Herrera-Estrella, L. and Schell, J. (1985) Uptake, integration, expression and genetic transmission of a selectable chimeric gene in plant protoplasts. Mol. Gen. Genet. 199, 161-168. - Haring, M.A., Gao, J. , Volbeda, T., Rommens, C.M.T.,

Nijkamp, H.J.J. and Hille, J. (1989) A comparative study of Tam3 and Ac transposition in transgenic tobacco and petunia plants. Plant Mol. Biol. 13, 189-201.

- Haring, M.A., Rommens, C.M.T., Nijkamp, H.J.J. and Hille, J. (1991) The use of transgenic plants to understand transposition mechanisms and to develop transposon tagging strategies. Plant Mol. Biol. 16, 449-461.

- Hille, J., Koornneef, M., Ramanna, M.S. and Zabel, P. (1989) Tomato: a crop species amenable to improvement by cellular and molecular methods. Euphytica 42, 1-23.

- Hoekema A., Hirsch, P.R., Hooykaas, P.J.J. and Schilperoort, R.A. (1983) A binary vector strategy based on separation of vir and T-region of the Agrobacterium tumefaciens Ti plasmid. Nature 303, 179-181. - Hooykaas-van Slogteren, G.M.S., Hooykaas, P.J.J. and

Schilperoort, R.A. (1984) Expression of Ti plasmid genes in monocotyledonous plants infected with Agrobacterium tumefaciens. Nature 311, 763-764.

- Houba-Herin, N., Becker, D., Post, A., Larondelle, Y. and Starlinger, P. (1990) Excision of a DS-like maize transposable element (AcΔ) in a transient assay in Petunia is enhanced by a truncated coding region of the transposable element Ac. Mol. Gen. Genet. 224, 17-23.

- Jefferson, R.A., Kavanagh, T.A., Bevan, M.W. (1987) GUS fusions: β-glucoronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6, 3901-3907.

- Jing-liu, Z., Xiao-ming, L., Rui-zhu, C, Rui-xin, H. and Meng-min, H. (1991) Transposition of maize transposable element Activator in rice. Plant Science 73, 191-198.

- Jones, J.D.G., Carland, F., Lim, 'E., Ralston, E. and Dooner, H.K. (1990) Preferential transposition of the maize element

Activator to linked chromosomal locations in tobacco. The Plant Cell 2, 701-707.

- Knapp, S., Coupland, G., Uhrig, H., Starlinger, P. and Salamini, F. (1988) Transposition of the maize transposable element Ac in Solanum tuberosum. Mol. Gen. Genet. 213, 285- 290.

- Lassner, M.W., Palys, J.M. and Yoder, J.I. (1989) Genetic transactivation of Dissociation elements in transgenic tomato plants. Mol. Gen. Genet. 218, 25-32. - Maeser, S. and Kahmann, R. (1991) The Gin recombinase of phage Mu can catalyse site-specific recombination in plant protoplasts. Mol. Gen. Genet. 230, 170-176. - Martin, C, Carpenter, R, So mer, H., Seadler, H.and Coen, E.S. (1985) Molecular analysis of instability in flower pigmentation of Anthirrhinum majus, following isolation of the pallida locus by transposon tagging. EMBO J. 4, 1625-1630. - McBride, K.E. and Summerfelt, K.R. (1990) Improved binary vectors for Agrobacterium-mediated plant transformation. Plant Mol. Biol. 14, 269-276.

- Melchers, L.S. and Hooykaas, P.J.J. (1987) Virulence of Agrobacterium. in: Oxford Surveys of Plant Molecular and Cell Biology 4, 167-220

- Odell, J.T., Knowlton, S., Lin, W. and Mauvais, C.J. (1988) Properties of an isolated transcription stimulating sequence derived from the cauliflower mosaic virus 35S promoter. Plant Mol. Biol. 10, 263-272. - Odell, J., Caimi, P., Sauer, B. and Russell, S. (1990) Site- directed recombination in the genome of transgenic tobacco. Mol. Gen. Genet. 223, 369-378.

- Offringa, R., De Groot, M.J.A., Haagsman, H.J., Does, M.P., Van den Elzen, P.J.M. and Hooykaas, P.J.J. (1990) Extrachromosomal homologous recombination and gene targeting in plant cells after Agrobacterium mediated transformation. EMBO J. 9, 3077-3084.

- O'Gorman, S., Fox, D.T. and Wahl, G.M. (1991) Recombinase- mediated gene activation and site-specific integration in mammalian cells. Science 251, 1351-1355.

- Onouchi, H., Yokoi, K., Machida, C, Matsuzaki, H., Oshima, Y., Matsuoka, K., Nakamura, K. and Machida, Y. (1991) Operation of an efficient site-specific recombination system of Zygosaccharomyces rouxii in tobacco cells . Nucleic Acids Res. 19, 6373-6378.

- Osborne, B.I., Corr, C.A., Prince, J.P., Hehl, R., Tanksley, S.D., McCormick, S. and Bak r, B. (1991) Ac transposition from a T-DNA can generate linked and unlinked clusters of insertions in the tomato genome. Genetics 129, 833-844.

- Rommens, C.M.T., Kneppers, T.J.A., Haring, M.A., Nijkamp, H.J.J. and Hille, J. (1991) A transposon tagging strategy with Ac on plant cell level in heterologous plant species . Plant Science 74, 99-106.

- Rommens, C.M.T., van Haaren, M.J.J., Buchel, A.S., Mol, J.N.M., van Tunen, A.J., Nijkamp, H.J.J. and Hille, J. (1992a) Transactivation of Ds by Ac-transposase gene fusions in tobacco. Mol. Gen. Genet. 231, 433-441.

- Rommens, C.M.T., Rudenko, G.N., Dijkwel, P.P., van Haaren, M.J.J., Ouwerkerk, P.B.F., Blok, K.M., Nijkamp, H.J.J. and Hille, J. (1992b) Characterization of the Ac/Ds behaviour in transgenic plants using plasmid rescue. Plant Mol. Biol. 20, 61-70.

- Russell, S.H., Hoopes, J.L. and Odell, J.T. (1992) Directed excision of a transgene from the plant genome. Mol. Gen. Genet. 234, 49-59.

- Scofield, S.R., Harrison, K., Nurrish, S.J. and Jones, J.D.G. (1992) Promoter fusions to the activator transposase gene cause distinct patterns of dissociation excision in tobacco cotyledons. The Plant Cell 4, 573-582. - Sherratt, D. (1989) Tn3 and related transposable elements: site-specific recombination and transposition, in: Mobile DNA (eds D.E. Berg and M.M. Howe) pp. 163-184. American Society for Microbiology. - Paszkowski, J., Baur, M., Bogucki, A., Potrykus,. I. (1988) Gene targeting in plants. EMBO J. 7, 4021-4026.

- Peterhans, A., Schlupmann, H., Basse, C. and Paszkowski, J. (1990) Intrachromosomal recombination in plants. EMBO J. 9,

3437-3445. - Putcha, H. and Hohn, B. (1991) A transient assay in plant cells reveals a positive correlation between extrachromosomal recombination rates and length of homologous overlap. Nucleic Acids Res. 19, 2693-2700.

- Sauer, B. (1987) Functional expression of the cre-lox site- specific recombination system in the yeast Saccharomyces cerevisiae. Mol. Cel. Biol. 7, 2087-2096.

- Sauer, B. and Henderson, N. (1989) Cre-stimulated recombination at loxP-containing DNA sequences placed into the mammalian genome. Nucleic Acids Res. 17, 147-161. - Sauer, B. and Henderson, N. (1990) Targeted insertion of exogenous DNA into the eukaryotic genome by the Cre recombinase. The New Biologist 2, 441-449.

- Sternberg, N. and Hamilton, D. (1981) Bacteriophage PI site- specific recombination I. recombination between loxP sites. J. Mol. Biol. 150, 467-486.

- Valvekens, D., Van Montagu, M. and Van Lijsebettens, M. (1988) Agrabacterium tumefaciens-mediated transformation of Arabidopsis thaliana root explants by using kanamycin selection. Proc. Natl. Acad. Sci. USA 85, 5536-5540.

- Van Sluys, M.A., Tempe, J. and Federoff, N. (1987) Studies on the introduction and mobility of maize Activator element in Arabidopsis thaliana and Daucus carota. EMBO J. 6, 3881-3889.

- Yanisch-Perron, C, Vieira, J. and Messing, J. (1985) Improved M13 cloning vectors and host strains: nucleotide sequences of the M13mpl8 and pUC19 vectors. Gene 33, 103-119.

- Yoder, J.I., Palys, J., Alpert, K. and Lassner, M. (1988) Ac transposition in transgenic tomato plants. Mol. Gen. Genet

213, 291-296.

SEQUENCE LIST

SEQ ID NO:l SEQUENCE TYPE: nucleotide

SEQUENCE LENGTH: 34 nucleotides

ATAACTTCGT ATAATGTATG CTATACGAAG TTAT 34

Claims

1. A method for providing a deletion or inversion mutation in a plant genome, comprising integrating into the plant genome recombinant DNA which comprises a transposable element as well as, both in and outside the transposable element, a recombination sequence, effecting transposition of the transposable element including the recombination sequence present therein and effecting recombination between the recombination sequence which has been left behind and the recombination sequence which has jumped, resulting in a deletion or an inversion of the DNA located between the two recombination sequences, depending on the relative orientation of the recombination sequences involved.

2. A method according to claim 1, wherein either the recombination sequence located in the transposable element or the recombination sequence located outside the transposable element, or both, are linked in inverted repeat to a second specimen of the recombination sequence.

3. A method according to any one of claims 1-2, wherein the transposable element is a non-autonomous transposable element which does contain the cis elements required for transposition (terminal and subterminal sequences) but does not contain the trans elements required for transposition (transposase genes) .

4. A method according to claim 3, wherein the transposition of the non-autonomous transposable element with the recombination sequence present therein is effected by introducing the trans elements necessary for transposition (transposase genes) into the plant.

5. A method according to claim 4, wherein as non-autonomous transposable element the Ds element of Zea mays and as trans element for transposition the Ac transposase gene of i≥a mays are used.

6. A method according to any one of claims 1-5, wherein the recombination between the recombination sequence which has been left behind and the recombination sequence which has jumped is effected by introducing the trans elements required for recombination (recombination genes) into the plant.

7. A method according to claim 6, wherein as recombination sequence the loxP sequence of bacteriophage PI and as trans element for recombination the Cre recombinase gene of bacteriophage PI are used.

8. A method according to any one of claims 1-7, wherein the integration into the plant genome of the recombinant DNA which comprises a transposable element as well as, both in and outside the transposable element, a recombination sequence, is effected using an Agrobacterium tumefaciens strain which contains a T-DNA construct,, which T-DNA construct comprises the left-hand and right-hand ends of the T-DNA required for transfer to plants, with an insertion of the recombinant DNA mentioned located therebetween.

9. A method according to any one of claims 1-8, wherein a bacterial replication origin has been incorporated into the transposable element.

10. A method according to any one of claims 1-9, wherein a bacterial marker gene, for instance a chloramphenicol resistance gene, has been incorporated into the transposable element.

11. A method according to any one of claims 1-10, wherein a marker gene that is active in plants, such as a β-glucuronidase gene or the herbicide resistance gene bar, provided with transcription promoter and transcription terminator sequences active in plants, has been incorporated into the transposable element.

12. A method according to any one of claims 1-11, wherein the recombinant DNA contains a marker gene that is active in plants, such as the hygromycin resistance gene Hptll, provided with transcription promoter and transcription terminator sequences which are active in plants, with the transposable element having been inserted between the promoter and the marker gene.

13. A method according to any one of claims 1-12, wherein the recombinant DNA contains a marker gene that is active in plants, such as the tms2 gene from the octopin TL-DNA, provided with transcription promoter and transcription terminator sequences that are active in plants, which enables selection of plants in which a deletion has occurred.

14. A method according to any one of claims 1-13, wherein the recombinant DNA contains a marker gene that is active in plants, such as the spectinomycin resistance gene, which enables selection of plants in which a deletion has occurred.

15. A method according to any one of claims 1-14, wherein the recombinant DNA contains a marker gene that is active in plants, such as the kanamycin resistance gene Nptll, provided with transcription promoter and transcription terminator sequences which are active in plants, which enables selection of transformed plants.

16. A method according to any one of claims 1-15, wherein, in the case of a deletion obtained by recombination, the deleted DNA is isolated from a parent plant of the deletion mutant by subjecting the DNA of the parent plant to an in vitro recombination reaction.

17. Recombinant DNA comprising a transposable element as well as, both in and outside the transposable element, a recombination sequence.

18. Recombinant DNA according to claim 17, wherein either the recombination sequence located in the transposable element or the recombination sequence located outside the transposable element, or both, are linked in inverted repeat to a second specimen of the recombination sequence.

19. Recombinant DNA according to any one of claims 17-18, wherein the transposable element is a non-autonomous transposable element which does contain the cis elements required for transposition (terminal and subterminal sequences) but does not contain the trans elements required for transposition (transposase genes) .

20. Recombinant DNA according to claim 19, wherein the non- autonomous transposable element is the Ds element of Zea mays.

21. Recombinant DNA according to any one of claims 17-20, containing as a recombination sequence the loxP sequence of bacteriophage PI.

22. Recombinant DNA according to any one of claims 17-21, comprising the left-hand and right-hand ends of T-DNA required for transfer to plants, with an insertion therebetween comprising a transposable element as well as, both in and outside the transposable element, a recombination sequence.

23. Recombinant DNA according to any one of claims 17-22, wherein the transposable element contains a bacterial replication origin.

24. Recombinant DNA according to any one of claims 17-23, wherein the transposable element contains a bacterial marker gene, for instance a chloramphenicol resistance gene.

25. Recombinant DNA according to any one of claims 17-24, wherein the transposable element contains a marker gene that is active in plants, such as a β-glucuronidase gene or the herbicide resistance gene bar, provided with transcription promoter and transcription terminator sequences that are active in plants.

26. Recombinant DNA according to any one of claims 17-25, containing a marker gene that is active in plants, such as the hygromycin resistance gene Hptll, provided with transcription promoter and transcription terminator sequences which are active in plants, with the transposable element having been inserted between the promoter and the marker gene.

27. Recombinant DNA according to any one of claims 17-26, containing a marker gene that is active in plants, such as the tms2 gene from the octopin TL-DNA, provided with transcription promoter and transcription terminator sequences that are active in plants, which enables selection of plants in which a deletion has occurred.

28. Recombinant DNA according to any one of claims 17-27, containing a marker gene that is active in plants, such as the spectinomycin resistance gene, which can function as a positive deletion marker.

29. Recombinant DNA according to any one of claims 17-28, containing a marker gene that is active in plants, such as the kanamycin resistance gene Nptll, provided with transcription promoter and transcription terminator sequences which are active in plants, which enables selection of transformed plants.

30. A plant which has been provided with a deletion or inversion mutation in the genome as a result of a genetic manipulation by means of a method according to any one of claims 1-16.

31. A plant which has been provided with an insertion of recombinant DNA according to any one of claims 17-29 as a result of a genetic manipulation.