CN111088278B - Retrotransposon Ra-RARE-1 with autonomous transposition activity and application thereof - Google Patents

Abstract

The invention discloses a retrotransposon Ra-RARE-1 with autonomous transposition activity and application thereof. The invention provides a retrotransposon Ra-RARE-1 with autonomous transposition activity, which is derived from a mangrove genome and has a sequence length of 6998bp for the first time. The retrotransposon has autonomous transcription and transposition capabilities, can perform autonomous proliferation, has lower activity, and is transgenic into other eukaryotic genomes, so that the harmful influence on the genome caused by mass proliferation of the conventional retrotransposon is greatly reduced, and meanwhile, due to a special transposition mechanism of the retrotransposon, newly generated copies can stably exist at insertion sites of the genome, so that specific characters generated in the gene function analysis and molecular breeding processes are stably maintained; therefore, the retrotransposon has wide application prospect in gene function analysis or molecular breeding.

Description

Retrotransposon Ra-RARE-1 with autonomous transposition activity and application thereof

Technical Field

The invention belongs to the field of biotechnology. More particularly, it relates to a retrotransposon Ra-RARE-1 having autonomous transposition activity and uses thereof.

Background

Transposons (transperson) are a DNA sequence which is capable of moving in the genome and which has been found to be widely present in the genome of animals and plants. Transposons are mostly found because their insertion into or near genes results in altered gene expression and thus a certain phenotypic difference; for example, the earliest Ac/Ds transposons were found to have three phenotypes, purple, yellow and purple spots, in the maize grain due to disruption of the insertion of the pigmentation gene; in addition, there are P element transposons in Drosophila, and mPing transposons in rice, etc., which are found only after the phenotype has been generated due to their insertional mutation. The transposition of the LTR retrotransposon is carried out by reverse transcription of RNA as a medium into DNA under the action of reverse transcriptase, and finally the DNA is inserted into the target site of the genome. This "copy-stick" transposition mechanism allows it to produce highly heterogeneous and huge numbers of copies of the transposon during vertical and horizontal inheritance; meanwhile, LTR retrotransposon transposition can cause stable mutation in or near genes, and the characteristic can be applied to research of gene functions and research of molecular breeding work.

At present, transposons which can be used as mutagenesis work are very rare, but the application of the transposons is very wide; for example, the Sleeping Beauty transposon and the PiggyBac transposon are widely used in vertebrate cells such as cultured cells of humans and germ line cells of mice, and are used as genetic engineering tools in the fields of gene transfer, gene function research, gene therapy, and the like; ac/Ds transposons and P element transposons have been developed at present as conventional tool transposons for insect and plant transgenic technologies, respectively.

However, with the increasing demand of diversification of gene editing technology, the sequence specificity of the transposon currently existing cannot fully meet the demands of scientific research and specific applications. Thus, there is a need to develop transposons with different transposable activities for generating an inducible, large number of stable types of genetic variation. In addition, transposon transposition, while generating a large amount of genetic diversity, acts as an endogenous mutagenizing factor, and the resulting effect is in many cases still detrimental to the host itself, and most transposons in the genome do not possess transposable activity; this is not only due to the loss of its own transposable capacity by mutation of the sequence of the transposon itself, but also because the transposon is generally regulated by epigenetic events from the host genome, such as DNA methylation, histone modification, small RNA-mediated pre-and post-transcriptional regulation, and the like. These regulatory mechanisms are not constant, and when responding to different internal and external environmental conditions, such as various stress conditions of pathogen invasion, high temperature, high salt, cold, etc., the control degree of the organism on transposons is generally reduced, and part of transposons escape from the inhibition of the host, thus regaining the capability of amplification and transposition; in this process, the series of genetic diversity resulting from transposon transposition in turn may give the species advantage in the evolution process. Therefore, the collision and cooperation of transposons with the host genome is a dynamic evolution process, and has been an important topic of population genetics. Exogenous transposons are developed by utilizing genomics means and transferred into a new genome (active genome), and the research of the conflict between the transposons and a host genome and the interaction modes of the transposons and the host genome is of great significance in elucidating the evolution mechanism of maintaining the genome stability of organisms and revealing the general rule of genome evolution.

Disclosure of Invention

The invention aims to overcome the defects and the shortcomings of the existing transposons and provide a retrotransposon Ra-RARE-1 with autonomous transposition activity and application thereof.

The object of the present invention is to provide a retrotransposon Ra-RARE-1 having autonomous transposition activity.

It is another object of the present invention to provide an expression cassette.

It is a further object of the present invention to provide a recombinant expression vector.

It is a further object of the present invention to provide the use of the retrotransposon Ra-RARE-1 in gene function analysis or molecular breeding.

The above object of the present invention is achieved by the following technical scheme:

the invention provides a retrotransposon Ra-RARE-1 with autonomous transposition activity for the first time, and the full-length sequence of the retrotransposon Ra-RARE-1 is shown as SEQ ID NO:1, the sequence length is 6998bp, the retrotransposon Ra-RARE-1 is derived from mangrove plants growing in the tropical subtropical coast intertidal zone, and the genome of the positive mangrove (Rhizophora apiculata).

The invention transforms Saccharomyces cerevisiae by using a recombinant expression vector containing the retrotransposon copy and the HIS3 gene, verifies that the retrotransposon has autonomous transcription and transposition capabilities and can perform autonomous proliferation.

The invention also provides an expression cassette comprising the retrotransposon Ra-RARE-1.

Preferably, the expression cassette further comprises a gene sequence for resistance screening and an artificially synthesized intron sequence.

Preferably, the artificially synthesized intron sequence is an AI sequence, and the sequence of the AI sequence is shown as SEQ ID NO: 4.

Preferably, the gene sequence for resistance screening is a HIS3 gene sequence, and the sequence of the gene sequence is shown in SEQ ID NO: shown at 5.

The invention also provides a recombinant expression vector comprising the retrotransposon Ra-RARE-1.

The invention verifies that the retrotransposon has transposition activity by monitoring the transposition proliferation event of the retrotransposon Ra-RARE-1 through the activity of the resistance screening gene; the activity of the retrotransposon is low, the retrotransposon is transferred to other eukaryotic (such as arabidopsis thaliana) genomes, the influence on host genes after transposition is helpful for researching gene functions, and beneficial characters generated by the influence on the host genes are capable of providing technical support for molecular breeding work.

Therefore, the application of the retrotransposon Ra-RARE-1 in gene function analysis or molecular breeding is also within the protection scope of the invention.

Preferably, the use is of the retrotransposon Ra-RARE-1 in the production of mutants or as a transgene vector.

The invention has the following beneficial effects:

the invention provides a retrotransposon Ra-RARE-1 with autonomous transposition activity, which is derived from a mangrove genome and has the sequence length of 6998bp for the first time; the invention transforms Saccharomyces cerevisiae by using a recombinant expression vector containing the retrotransposon copy and the HIS3 gene, and verifies that the retrotransposon has the characteristics of autonomous transcription and transposition; the activity of the resistance screening gene is used for monitoring the transposition proliferation event of the retrotransposon, so that the retrotransposon has transposition activity;

in addition, the invention discovers that the activity of the retrotransposon is lower, and the retrotransposon is transferred to other eukaryotic (such as arabidopsis thaliana) genomes, so that the harmful effect on the genomes caused by massive proliferation of conventional retrotransposons is greatly reduced, and meanwhile, the newly amplified copy of the retrotransposon can stably exist at the insertion site of the genomes due to the special transposition mechanism of the retrotransposon, so that the specific characters generated in the gene function analysis and molecular breeding processes are stably maintained; therefore, the retrotransposon has wide application prospect in gene function analysis or molecular breeding.

Drawings

FIG. 1 is a diagram of the structure and mechanism of action of recombinant expression vector pYES2-RARE-1-mHIS3 AI; wherein, (A) is a pYES2 plasmid map; (B) The diagram is a schematic diagram of the experiment of the transposition of the retrotransposon Ra-RARE-1.

FIG. 2 is a graph showing the results of analysis of transposition activity of retrotransposon Ra-RARE-1 in yeast; wherein, (A) is a graph of the growth condition results of three Saccharomyces cerevisiae transferred into different vectors (pYES 2-RARE-1-mHIS3, pYES2-RARE-1-HIS3mAI and pYES2-RARE-1-mHIS3 AI) on an SC-His plate; (B) FIG. S shows transfer of single colonies of yeast transferred into pYES2-RARE-1-mHIS3AI on SC-His plates to SC-His+FOA ^r Results of growth of the plates.

FIG. 3 is a graph of the validation results of SSAP experimental transposition events; wherein, the lane 1 is Marker, and the lanes 2-10 are different yeast monoclonals on SC-His board containing 5-FOA.

FIG. 4 is a result of verifying the amplification activity of Ra-RARE-1 in Arabidopsis genome by high throughput sequencing; wherein, (A) is a graph of the result of high throughput genomic resequencing of Ra-RARE-1 transgenic Arabidopsis; panel (B) is a graph of the result of fluorescent quantitative PCR verification of transposition activity.

Detailed Description

The present invention is further illustrated below with reference to specific examples, which are not intended to limit the invention in any way. Unless specifically stated otherwise, the reagents, methods and apparatus employed in the present invention are those conventional in the art.

Reagents and materials used in the following examples are commercially available unless otherwise specified.

EXAMPLE 1 extraction of N-mangrove DNA and acquisition of the full-Length sequence of retrotransposon Ra-RARE-1

1. Experimental method

Total DNA from leaves of N-mangrove was extracted by modified CTAB method (Doyle and Doyle, 1990) using TaKaRa kit

HS DNAPolymerase, according to its instruction of the reaction system amplification Ra-RARE-1 full length sequence, amplification primer pair Ra-full-F/Ra-full-R (sequence as shown in SEQ ID NO: 2-3);

primer Ra-full-F (SEQ ID NO: 2): 5'-ATAGGTACCTCAATTACCCCTTAAC ATGGTAGTCAGG-3';

primer Ra-full-R (SEQ ID NO: 3): 5'-CATGAGCTCACTTGTTGCCACATAGT TCCTTCTTTTG-3';

a recognition sequence of restriction enzyme KpnI (5 ' -GGTACC-3 ') or SacI (5 ' -GAGCTC-3 ') is added to the 5' -end of the primer Ra-full-F/Ra-full-R.

The amplification procedure was: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30sec, renaturation at 60℃for 30sec, extension at 72℃for 6min,35 cycles; finally, the extension is carried out for 10min at 72 ℃.

The amplified product was recovered (StarPrep Gel Extraction Kit), A tail (DNAA-Tailing Kit) was added, and ligated to EZ-T ^TM On the carrier, E.coli DH5 alpha competent cells are transformed, and EZ-T containing cells are selected ^TM Positive clones of RARE-1 plasmid were sequenced.

2. Experimental results

The full-length sequence of the retrotransposon Ra-RARE-1 is shown in SEQ ID NO: 1.

EXAMPLE 2 construction of recombinant expression vector pYES2-RARE-1-mHIS3AI containing expression cassette of selection marker Gene HIS3AI

1) Acquisition of pMD19T-AI plasmid containing AI sequence

The intron (AI) sequence was synthesized by Life Technologies company to obtain pMD19T-AI plasmid containing AI sequence; AI sequence is shown in SEQ ID NO:4 is shown in the figure;

AI sequence (SEQ ID NO: 4): 5'-AAGCTTACGTATGTTATATGGACTA AAGGAGGCTTTTCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTTTTACTAACAAATGGTATTATTTATAACAGCTGAATTC-3'.

(2) Containing EZ-T ^TM Acquisition of positive clones of the HIS3 plasmid

The HIS3 gene was derived from the yeast (Saccharomyces cerevisiae) genome, and after Yeast Genomic DNA Kit was used to extract yeast genomic DNA, the primer pair HIS-F/HIS-R (sequence shown in SEQ ID NO: 6-7) was amplified, and then recovered, ligated, transformed and sequenced in the same manner as in example 1 to obtain a DNA fragment containing EZ-T ^TM Positive cloning of HIS3 plasmid; the sequence of the HIS3 gene is shown in SEQ ID NO: shown at 5.

Primer HIS-F (SEQ ID NO: 6): 5'-AGCTTGTCTGTAAGCGGATG-3';

primer HIS-R (SEQ ID NO: 7): 5'-TTTCCTGATGCGGTATTTTCT-3'.

(3) EZ-T containing reverse AI ^TM Acquisition of positive clones of the HIS3mAI plasmid

Reversely inserting an AI sequence into an MscI site of the HIS3 gene, and culturing the pMD19T-AI plasmid containing the AI sequence obtained in the step (1) and the EZ-T plasmid containing the AI sequence obtained in the step (2) in an expanding manner ^TM Positive cloning of HIS3 plasmid using plasmid extraction kit (AXYGEN AXYPRep ^TM Plasmid Minprep Kit) plasmid extraction, cleavage and recovery (StarPrep Gel Extraction Kit) of AI from pMD19T-AI plasmid using the restriction enzymes SnaBI (NEB) and PvuII-HF (NEB), ligation to EZ-T after restriction enzyme Msci (NEB) cleavage and rSAP (NEB) dephosphorylation using T4DNA ligase (NEB) ^TM -on HIS3 plasmid; after transformation and sequencing, EZ-T containing reverse AI in HIS3 gene is obtained ^TM Positive cloning of the HIS3mAI plasmid.

(4) Acquisition of positive clones of pYES2-RARE-1 plasmid containing RARE-1 sequence

EZ-T-containing cells obtained in example 1 of the expansion culture ^TM Positive cloning of the RARE-1 plasmid was performed using the plasmid extraction kit (AXYGEN AXYPRep ^TM Plasmid Minprep Kit) plasmid extraction of RARE-1 from EZ-T using restriction enzymes KpnI (NEB) and SacI (NEB) ^TM After excision and recovery (StarPrep Gel Extraction Kit) of the RARE-1 plasmid, it was ligated to the same restriction endonuclease treated pYES2 plasmid (the EcoRI site of which had been disrupted by the point mutation technique) using T4DNA ligase (NEB), the pYES2 plasmid map being shown in FIG. 1 (A); after transformation and sequencing, positive clones of pYES2-RARE-1 plasmid containing the RARE-1 sequence were obtained.

(5) Acquisition of pYES2-RARE-1-mHIS3AI plasmid

The EZ-T containing the reverse AI obtained in the step (3) of the expansion culture ^TM Positive cloning of the HIS3mAI plasmid and positive cloning of the pYES2-RARE-1 plasmid containing the RARE-1 sequence obtained in step (4) were performed using a plasmid extraction kit (AXYGEN AXYPRep ^TM Plasmid Minprep Kit) plasmid extraction from plasmid EZ-T using restriction enzyme EcoRI (NEB) HIS3mAI sequence ^TM After excision and recovery (StarPrep Gel Extraction Kit) from HIS3mAI, it was ligated to the pYES2-RARE-1 plasmid after the same restriction endonuclease treatment and dephosphorylation of rSAP (NEB) using T4DNA ligase (NEB); after transformation and sequencing, the reverse-ligated plasmid was named: pYES2-RARE-1-mHIS3AI plasmid (experimental group), the forward-ligated plasmid was named: pYES2-RARE-1-HIS3mAI plasmid (negative control); then, the reverse HIS3 gene sequence without AI was ligated into EcoRI site of pYES2-RARE-1 plasmid by the same method as above, and after transformation and sequencing, pYES2-RARE-1-mHIS3 plasmid was obtained (positive control); the plasmids obtained above were each maintained with 25% glycerol.

EXAMPLE 3 analysis of the transposable Activity of the retrotransposon Ra-RARE-1 in Yeast

1. Experimental method

The HIS3 gene in yeast is involved in the biosynthesis process of histidine, and a forward intron AI is put in the reverse HIS3 gene, so that the AI and the HIS3 gene are transcribed in opposite directions; therefore, AI cannot be properly sheared, and thus HIS protein cannot be expressed.

The principle of the retrotransposon Ra-RARE-1 transposition experiment is shown in FIG. 1 (B), and we put the above-mentioned reverse HIS3 gene containing the forward intron AI in the forward retrotransposon Ra-RARE-1, after the retrotransposon ORF and before the 3' LTR; if the retrotransposon has transposable activity, since AI is identical to the transcription direction of the retrotransposon, AI is correctly sheared, and when the modified transcript is reversely transcribed into DNA and integrated into genome, HIS3 gene can be normally expressed, therefore, the yeast strain with the event can be screened out on the medium with histidine (His) deletion; in addition, the sheared transcripts are reversely transcribed into DNA to enter a genome, so that the DNA can be integrated on a yeast chromosome, homologous recombination can be carried out with a retrotransposon sequence containing an intron on a plasmid through a homologous recombination mechanism, and the yeast can normally grow on a His defect culture medium due to the occurrence of the two events;

therefore, we subsequently transferred colonies grown on His-deficient medium to His-deficient medium containing 5-FOA, which turned 5-FOA into toxic substances due to expression of URA3 gene on plasmid, resulting in death of yeast. Therefore, the interference generated by homologous recombination of yeast can be eliminated by the method, and yeast colonies with truly occurring transposition events can be screened out; the specific experimental method comprises the following steps:

(1) Transforming (lithium acetate transformation) the pYES2-RARE-1-mHIS3AI plasmid obtained in step (5) of example 2 and the positive control pYES2-RARE-1-mHIS3 plasmid and the negative control pYES2-RARE-1-HIS3mAI plasmid into a yeast strain to obtain a yeast strain containing the corresponding plasmids; the method specifically comprises the following steps:

1) A small amount of URA3, HIS3 double deficient yeast strain BY4741 (MATA HIS 3. DELTA.1 leu2DELTA.0met15. DELTA.0 URA 3. DELTA.0) was inoculated in 5mL of YPD medium and shaken at 30℃overnight at 200 rpm; 200 mu L of bacterial liquid is added into 50mL of YPD, and shake culture is carried out at 30 ℃ and 200rpm for 5h;

2) Centrifuging at 3000rpm for 3min at room temperature, removing culture medium, adding 250 μl of 0.1M LiAc, gently shaking to suspend cells, and standing at room temperature for 10min;

3) Beating the tube wall 3 times to suspend the cells and obtain yeast competent cells;

4) The following system is prepared: yeast competent cells 50. Mu.L, plasmid to be transformed 1. Mu.g, PLI 300. Mu.L, ssDNA 5. Mu.L; lightly blowing the system with a p1000 gun, and then carrying out heat shock at 42 ℃ for 25min;

5) Centrifuging at 3000rpm for 3min at room temperature, collecting cells, and sterilizing with ddH ₂ O is washed once, cells are plated on SC (SC-Ura) culture medium plates lacking uracil (Ura), and cultured overnight at 30 ℃;

6) Picking single colony of yeast with toothpick, suspending cells in 10 μl wall breaking enzyme (250U/mL); the method sequentially comprises the following temperature treatments: 37 ℃ for 30min;99 ℃ for 10min; -80 ℃,10min;99 ℃ for 10min; -80 ℃,10min; mixing after melting at room temperature, taking 1 mu L as a template of colony PCR, and identifying whether the Yeast strain contains correct plasmids or not by using a primer pair Yeast-F/Yeast-R (the sequences are shown as SEQ ID NOs: 8-9);

primer Yeast-F (SEQ ID NO: 8): 5'-AAAACATTCACTGGACATGTTGAT-3';

primer Yeast-R (SEQ ID NO: 9): 5'-AATTCAGAATAACCTTACTGAGAAA CA-3'.

(2) Through a resistance screening mechanism, whether the retrotransposon Ra-RARE-1 has transposable activity in yeast is verified, and the specific experimental method is as follows:

1) Selecting a single colony of yeast verified by colony PCR, inoculating the single colony of yeast into an SC-Ura culture solution taking galactose (Gal) as a sugar source, and culturing the single colony of yeast in a shaking table at 200rpm at 23 ℃ for 72 hours;

2) After low temperature induction, 3mL and 0.1mL are respectively taken and transferred into pYES2-RARE-1-mHIS3, pYES2-RARE-1-HIS3mAI and pYES2-RARE-1-mHIS3AI yeast liquid, and the yeast cells are precipitated by centrifugation at 3000rpm for 5min at room temperature;

3) Adding 1mL of sterilized water for resuspension, washing the precipitate, and centrifuging at 3000rpm for 5min;

4) Repeating step 3);

5) Adding 50-100 mu L of sterilized water to re-suspend and deposit, coating all the plates on a SC (SC-His) plate with histidine (His) deletion, and culturing at 30 ℃ for 3 days;

6) A small amount of single colony of the yeast transferred into pYES2-RARE-1-mHIS3AI grown on the SC-His plate is picked by a sterilized toothpick, and is respectively copied and transferred onto the SC-His plate containing 5-FOA, and is cultured for 3 days at 30 ℃.

2. Experimental results

The results of the transposition activity analysis of retrotransposon Ra-RARE-1 in yeast are shown in FIG. 2, wherein three types of yeasts transformed into different vectors (pYES 2-RARE-1-mHIS3, pYES2-RARE-1-HIS3mAI, pYES2-RARE-1-mHIS3 AI) grow on SC-His plates as shown in FIG. 2 (A), and it can be seen that after the SC-His plates are coated by galactose low temperature induction, a positive control (pYES 2-RARE-1-mHIS3 plasmid) grows over the whole plates, and a negative control (pYES 2-RARE-1-mHIS 3mAI plasmid) cannot grow on His-deleted plates, whereas the experimental group (pYES 2-RARE-1-mHIS3AI plasmid) shows a small number of single colonies;

single colony of yeast transferred into pYES2-RARE-1-mHIS3AI on SC-His plate transferred into SC-His+FOA ^r As shown in FIG. 2 (B), the growth of the plate was confirmed, and it was found that the transposition event occurred in the retrotransposon Ra-RARE-1 transferred in the single colony of pYES2-RARE-1-mHIS3AI yeast.

Example 4SSAP experiments verify transposition events

1. Experimental method

(1) Yeast DNA extraction

1) Selecting a monoclonal from an SC-His plate containing 5-FOA, placing the monoclonal in 4mL of SC-His culture solution containing 5-FOA, and placing the culture solution in a shaking table at 30 ℃ and 200rpm for 2 days;

2) The yeast cells were pelleted by centrifugation and 1mL ddH was used ₂ O washing and precipitating once;

3) 200. Mu.L of yeast cell lysate (0.2M lithium acetate, 0.5M NaCl,10mM EDTA (pH 8.0), 100mM Tris-HCl (pH 8.0)) was added, and the cells were resuspended by vortexing;

4) 200mg of glass beads (0.4 to 0.6 mm) were added, and 200. Mu.L of phenol was added: chloroform: isoamyl alcohol (25:24:1), and vigorously vortex for 3-5 min;

5) 200 mu L of TE buffer is added, and the mixture is gently inverted and uniformly mixed for 6 to 10 times;

6) Centrifuge at 13,000rpm for 10min, carefully transfer the upper aqueous phase to a new 1.5mL centrifuge tube;

7) 1 mu L of RnaseA (10 mg/mL) is added and put into a water bath kettle at 37 ℃ for warm bath for 1h;

8) Chloroform-isoamyl alcohol (24: 1) Mixing until the tube is full, and centrifuging at 10000rpm for 10min;

9) Carefully transfer the upper aqueous phase to a fresh 1.5mL EP tube, add 60% by volume isopropanol, after about 7min at-80℃centrifuge at 12000rpm for 10min;

10 Removing supernatant, washing the DNA twice with 500. Mu.L of 75% ethanol, washing the DNA once with 500. Mu.L of absolute ethanol, and centrifuging at 12000rpm for 5min after each washing;

11 Air-drying the DNA until it is semitransparent, adding 25. Mu.L of sterilized double distilled water to dissolve the DNA, taking 1. Mu.L of the DNA, performing agarose electrophoresis, and preserving the rest at-20 ℃.

(2) Double enzyme cutting

Double enzyme digestion system: 800ng DNA+0.5. Mu.L HinP1I (NEB) +0.25. Mu.L EcoRI-HF (NEB) +3. Mu.L

Buffer+ddH ₂ The total volume of O is 30uL, and the enzyme digestion is carried out for 5 hours at 37 ℃; and then agarose gel electrophoresis is carried out to detect whether the DNA is completely digested, and the DNA is placed in a water bath kettle at 65 ℃ after the complete digestion to inactivate enzymes, thus obtaining a double digestion product.

(3) Connection

The connection system is as follows: 25. Mu.L of the double cleavage product obtained in step (2) +1mu. L T4DNA library+ 500ng HinP1I adaptor+250ng EcoRI adaptor+4uL T4DNABuffer+ddH ₂ O, total volume 40uL; and (3) placing the connection system in a water bath kettle at the temperature of 16 ℃ for overnight connection, and placing the connection system in the water bath kettle at the temperature of 65 ℃ for 10min to inactivate enzymes, so as to obtain a connection product.

(4) Pre-amplification

Taking the connection product obtained in the step (3), taking a primer pair E0/H0 as a pre-amplification primer (the sequence is shown as SEQ ID NO: 10-11), and pre-amplifying according to the following pre-amplification system and reaction program to obtain a pre-amplification product;

1) The pre-amplification system is as follows:

2) The pre-amplification reaction procedure was: 95℃for 1min, (94℃for 1min,60℃for 1min,72℃for 1 min) for 30cycles,72℃for 7min.

(5) Selective amplification

Taking the pre-amplification product obtained in the step (4), taking a primer R1 and a primer H1 as primers for selective amplification (the sequences are shown as SEQ ID NO: 12-13), and carrying out selective amplification according to the following selective amplification system and reaction program to obtain a selective amplification product;

1) The selective amplification system is as follows:

2) The selective amplification reaction procedure was: 94℃for 5min, [94℃for 1min,65℃for 1min (-0.7 ℃/cycle), 72℃for 1min]for 13cycles, (94℃for 1min,56℃for 1min,72℃for 1 min) for 22cycles,72℃for 7min;

3) 3. Mu.L of the selective amplification product was subjected to 2% agarose gel electrophoresis to verify the transposition event of the SSAP experiment.

The primer used in the pre-amplification system is corresponding to the primer of the adapter without adding selective bases, the retrotransposon primer used in the selective amplification system is positioned in the LTR region of RA-RARE-1, and the selective primer is the primer corresponding to the adapter plus three selective bases; primer sequences of primer pair E0/H0, primer R1 and primer H1, and primer of the adapter are as follows:

2. experimental results

As shown in FIG. 3, it can be seen that a plurality of bands appear in lanes 2 to 10 after agarose gel electrophoresis, and the sizes of partial bands are obviously different from each other, further indicating that the retrotransposon Ra-RARE-1 successfully transposes in yeasts, different yeast colonies have different transposition insertion sites, and the number of transposition occurs more than once in a single yeast.

EXAMPLE 5 application of retrotransposon Ra-RARE-1 in molecular breeding

1. Experimental method

The full length sequence of the retrotransposon Ra-RARE-1 obtained in example 1 was cloned between the Kpn I and Sca I sites of the plant transgenic vector pCAMBIA1381z, the obtained transgenic plasmid was transfected into Arabidopsis thaliana by Agrobacterium, and the amplification activity of Ra-RARE-1 in Arabidopsis thaliana was judged by comparing the ratio of the full length sequence of the retrotransposon Ra-RARE-1 to the abundance of the transgenic background sequence (T-border) by high-throughput re-sequencing of the genomes of different F1 generations of Arabidopsis thaliana. After the retrotransposon Ra-RARE-1 transgene enters an Arabidopsis genome, if the retrotransposon Ra-RARE-1 transgene loses transposition activity, the sequencing abundance of the full-length sequence of the retrotransposon Ra-RARE-1 is consistent with the sequencing abundance of the T-border; if the retrotransposon Ra-RARE-1 maintains its transposition activity, it is amplified by replication in the Arabidopsis genome, the copy number is increased, and the abundance of the sequence obtained by high throughput sequencing is greater than that of the T-border sequence (because the T-border sequence cannot be amplified autonomously). The specific experimental method is as follows:

(1) Construction of Arabidopsis transgenic vector

The full length sequence of Ra-RARE-1 was double digested with KpnI and SacI, and EZ-T was obtained from example 1 ^TM The RARE-1 plasmid is digested and ligated into pCAMBIA1381z between KpnI and SacI sites using long fragment ligation; obtaining pCAMBIA1381z transgenic plasmid containing Ra-RARE-1 full-length sequence after transformation, clone sequencing and plasmid extraction;

wherein, two enzyme cutting systems: 2 μg DNA (EZ-T) ^TM RARE-1 plasmid or pCAMBIA1381z plasmid) +1. Mu.L KpnI (NEB) +1. Mu.L SacI (NEB) +3. Mu.L

Buffer+ddH ₂ The total volume of O is 30uL, and the enzyme digestion is carried out for 5 hours at 37 ℃; and then agarose gel electrophoresis is carried out to detect whether the DNA is completely digested, and the DNA is placed in a water bath kettle at 65 ℃ for 20min after the digestion is complete so as to inactivate the enzyme.

The connection system is as follows: agarose gel electrophoresis (0.8% agarose) is carried out on the enzyme digestion products, target strips are cut and subjected to glue recovery, and the Ra-RARE-1 full-length sequence after enzyme digestion and pCAMBIA1381z transgenic plasmid after enzyme digestion are obtained; 1 μg of Ra-RARE-1 DNA+0.5 μg of linearized pCAMBIA1381z plasmid+1 μ L T4DNA library+ 4uL T4DNA Buffer+ddH was taken ₂ The total volume of O was 40uL; after the connection system is placed in a water bath kettle at 16 ℃ for overnight connection, the connection system is placed in the water bath kettle at 65 ℃ for 10min to inactivate enzymes.

Plasmid extraction: the ligation product (10. Mu.L) was added to 100. Mu.L competent cells, vortexed for 1s at stage 3, and left in ice for 30min; placing in ice for 5min after heat shock at 42 ℃ for 60 s; adding 890 mu L of liquid LB culture medium, and shake culturing at 37 ℃ for 60min at 180 r/min; centrifuging at 3400rpm for 4min, collecting cells, uniformly smearing on LB agarose plate with Amp, X-Gal and IPTG, and culturing at 37deg.C overnight; picking single colony from LB agarose plate with toothpick, shake culturing overnight at 37deg.C and 180r/min in LB liquid medium containing 5 mL; by using

Spin Miniprep Kit plasmid extraction was performed according to instructions to obtain transgenic plasmids.

(2) Arabidopsis transgenes

Transforming the transgenic plasmid obtained in the step (1) into agrobacterium by adopting an agrobacterium-mediated method, and placing the agrobacterium-mediated method in 150mL LB culture medium containing antibiotics for shake culture at 28 ℃ for 24 hours; centrifuging the bacterial liquid for 20min with 4000g, and removing the supernatant; the bacterial solution is resuspended in 120mL of permeate (10% sucrose+400. Mu.l/L Silwet-77); selecting healthy arabidopsis plants cultured in a long-day environment, cutting off all fruit pods and fully open flowers on indexes, immersing overground parts of the plants in agrobacterium liquid for 1min, keeping the humidity of the plants by using a preservative film after light shaking, and performing dark culture for 24h and then performing normal culture; removing the preservative film after 3 days, and watering after 1 week of conversion; culturing until the plant matures, and screening to obtain the transformant.

(3) Transgenic Arabidopsis high throughput genome resequencing

Extracting the genome DNA of the transformant obtained in the step (2), and sending the genome DNA to a Huada gene for high-throughput resequencing; after quality control filtering low quality data from reads obtained by sequencing, the data were aligned to plasmids used for transgenes using bwa (Version: 0.7.12-r 1039), and the resulting sam files were converted to bam format files by samtools (Version: 1.6) and visualized using IGV (Version: 2.3.75) software.

(4) Fluorescent quantitative PCR for verifying transposition activity

Using SYBR GREEN master mix, 1. Mu.L of the diluted transgenic Arabidopsis DNA, 1. Mu.M each of forward and reverse primers (primer Hyg-F/R or primer LTR-F/R or primer ORF-F/R, sequences shown as SEQ ID NOS: 16-17, 18-19 or 20-21), 0.2. Mu.L of Rox, and sterilized ddH were added according to instructions ₂ O to 10. Mu.L system, quantitative PCR was performed;

the quantitative PCR reaction procedure was: 95℃for 5s, (95℃for 5s;55℃for 10s;72℃for 15 s) 40 cycles, and detection of fluorescent signals at 72℃for three technical replicates per sample;

use 2- ^△△CT The abundance of Hyg (hygromycin resistance gene on plasmid, quantitative primer is Hyg-F/R, the sequence is shown as SEQ ID NO: 16-17) is normalized to 1, and the abundance of LTR segment (quantitative primer is LTR-F/R, the sequence is shown as SEQ ID NO: 18-19) and ORF segment (quantitative primer is ORF-F/R, the sequence is shown as SEQ ID NO: 20-21) on Ra-RARE-1 sequence is relatively quantified.

Primer Hyg-F (SEQ ID NO: 16): 5'-TTGGGAATCCCCGAACATCG-3';

primer Hyg-R (SEQ ID NO: 17): 5'-CCCCATGTGTATCACTGGCA-3';

primer LTR-F (SEQ ID NO: 18): 5'-AGTGGCCCTTGTTTAACGTATG-3';

primer LTR-R (SEQ ID NO: 19): 5'-ATCCATTTTCCAGCAGCCGT-3';

primer ORF-F (SEQ ID NO: 20): 5'-CAAGGTGGTATCCCCACACC-3';

primer ORF-R (SEQ ID NO: 21): 5'-AGCTGGCCTTTTCTGTCTCG-3'.

2. Experimental results

The results of the amplification activity of Ra-RARE-1 in Arabidopsis genome by high throughput sequencing are shown in FIG. 4; the result of the high-throughput genome re-sequencing of the Ra-RARE-1 transgenic Arabidopsis thaliana is shown in a (A) diagram in FIG. 4, and it can be seen that in 5F 1 Arabidopsis thaliana transgenic lines (No. 8 to No. 12) randomly selected by us, the abundance of the sequence of the Ra-RARE-1 is obviously higher than that of the T-border sequence, and the transposable activity of the Ra-RARE-1 in the Arabidopsis thaliana genome is proved; in addition, the frequency of amplification of a single generation of Ra-RARE-1 is estimated to be 1 to 5 copies, and therefore, the genetic mutation generated by a single generation is not excessive, and Ra-RARE-1 is very suitable as a tool transposon for molecular breeding.

As shown in the (B) diagram of FIG. 4, the fluorescence quantitative PCR verifies the transposition activity, and can be seen that the abundance of the Ra-RARE-1 sequence is significantly higher than that of a plasmid sequence (hygromycin resistance gene) which cannot be amplified (two-charged t test, all P < 0.01) and is 2 to 5 times that of the hygromycin resistance gene, which is consistent with the results detected by using high-throughput genome re-sequencing; the retrotransposon Ra-RARE-1, which is the transgene into the Arabidopsis genome, was demonstrated to be amplified.

The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

Sequence listing

<110> university of Zhongshan

<120> a retrotransposon Ra-RARE-1 having autonomous transposition activity and use thereof

<160> 21

<170> SIPOSequenceListing 1.0

<210> 1

<211> 6998

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

tgttgagtta atcgacataa agtggccctt gtttaacgta tgacccaaat aatggatggc 60

ttaacgtgat ggtctgttaa gcaaaacggt ggttttgggt taatgggttt gaaatccctc 120

cgctctccct tctgacagat agccgttaca gatagggaga atctccctat cttcagggca 180

acggctgctg gaaaatggat gaatatatat atattcatta tggacatttt ctgggctctc 240

tcaaccatca gagaaaagcg taaagaacag aaagggaaga gtaggagaaa aggtaagaag 300

agaaaaggta ggaggagaga agataggaga aacagaaagg aaagcgtaca gggcaggaaa 360

gagaagtttt ctcatctcta ctaccggata tcagaataat ggagaacggt atgttgttct 420

gatttcctat tccttttggt tttgttacag ttatattgct agtattcgta tcaagataac 480

gatcctgcat gatagagata agaaaagtct aacagttttg gtatcagagc caggttaacg 540

aatactgcaa tttattttga ttttagttat ttgcgccgaa ttattttgtt ttgttttctg 600

gcaaacggaa aagcgtatgt tcaatgtatt ttctatatat tattgtttgc tgtacttaac 660

ggccggcgtt gaaaggggaa acgtcggcca tgtaaattta cactgctgaa accgctggtg 720

tcaaaacaaa aaaaaaaaaa ggagccgacc acgagaactg tacaccgccg gaacccgaac 780

ggttctgggt atggcggatc ggctccgatg aaggctgtgt ctccgttgtc agtgggagac 840

ccgaatcggt ccggtctggt gggcatgacg gaacagtctc cctgtgaggc tgatgctctg 900

ggtcgggcgt gggtctggtg gatggctgcc gtcggagatc cgacccgaac aggttggttc 960

acccacgttc gcctggtcag aggcgacgtc cgggaagagc cgacgcaccg gggttggctg 1020

ctgacggcga ctccctcaaa tgaaagccgc tggacgtcgt cgggaagagt cgacggcgat 1080

ggcagaatgg ggccagcacg cgggccgtgc gtggtctctg gtcagacgca gcctgcggta 1140

ggtggtgttg ccaccgtcgg ctccgatcgg aggcaacacg caggcggcgc ctgcagcagg 1200

tggtgttgcc accgtcggtc tccggtcgga ggcagcacgc gggccgtgcg aggtctctgg 1260

tcagaggcag cctgcggtag gtggtgttgc caccgtcggc tccgatcgga ggcaacacgc 1320

aggcagcgcc tgcagcaggt ggtgttgcca ccgtcggctc cgatcggagg caacacgcag 1380

gcagcgcctg cagcaggtgg tgttgccacc gtcggtctcc ggtcggaggc agcacgcggg 1440

ccgtgcgtgg tctctggtcg gaggcagcct gcagtacggt ggtgttgcca ccgtcggttt 1500

ctggtcggag gcaacacgcg ggctgtgccg gcagaaaaaa aaaaaaaaaa gtttattaaa 1560

gtcacgtcaa cgtgaatcaa atattgaaag cctattggtc accaaagtga cctggcctga 1620

aggaatttga attgttgatc gtgaattttc aattgttcat tttttatgct aatattatat 1680

aaatatatga acaattgtgg ttattaatta tacggctagg agatcatcca aagatggatc 1740

attgcctata attaatgaca ctgaaagggg attgattgat gtactgagca aacatgattg 1800

catatccaaa gataacattc atgttaactc tagtattatt gattaaccta ttaaagcata 1860

tttaaattag cattattatt gattgcagct atgtgtttga ggatcaccca aaggtgaact 1920

taaatatata gtcaaagttt ataatgcatg tgtctgaatc cattagagtt tactcaaagc 1980

attaacatgt aaatttggat tatgtttgca gcttctaata acgttttcgc cttgggcaat 2040

gcaatgatca aattcaatgg gctgaactat gcagaatggt ctgagcatat tcagtttcat 2100

ttaggtgttt tgggcttgga cttagcagtc atttcggaag aaaagcctgc agccattact 2160

gggaccagta cagaatctga taagtctttt catgaggctt gggtacggtc caataggctg 2220

agtttgaatt tgatgcgaat gacgatggct gaaaatgtca agccctcaat gcccaagacg 2280

gaaaatgcaa gggaatttct gatgagaatc aaggaatact ctcaatcaga catagctgat 2340

aaatccattg taggaaccct gatgagtgag ctgacgacca agaaatttga ttggtcacgg 2400

cctattcatg atcatgtgac tagcatggct aatctagcag caaagttgag aacgatgggt 2460

atggatgtga gtgaatcctt tttggttcaa ttcatcatca actcactacc tcctgaattt 2520

ggccagttcc aagtgaacta taacactatt aaagagaaat ggaactttca ggaaattaag 2580

gccatgttag ttcaggagga agggagatta aagaagatga aggatcactc cattcatctc 2640

actgttcgta atgatgctag tggtagcaag tctaaaccac atcacaaaaa taagaagaag 2700

gacaaagcct ccataaaagt ctctggaggt cagatccaaa aggatcagaa gtgcttcttc 2760

tgcaaaagga tgggtcactt caagaaggat tgcccaaaaa gaaaggcttg gttcgaaaag 2820

aaaggtatgt actgtatatc agtatgtttt gaatcaaata taattgaagt gcccaataat 2880

acttggtggt tagactctgg agctactatt catgtgtcac atattatgca gggattcctt 2940

tcaatccagc ccataacagg aactgagaag ttcctttata tgggaaacag aatgaaggca 3000

cgaatagaag gaattgggac gtacagattg atcttggaca ccaagtgtca tctggatcta 3060

gaaaagtgtc tctatgttcc tgaatgtgct agaaatttgg tttctgttgc aaagttggat 3120

gaagtgggat ttaatcttaa gattggaaat ggtgcatttt cattgtatag acattcgtac 3180

tattatggat ctggtacttt gattgatgat ttgtaccgct ttaatcttga cgctatgtat 3240

gctgattctc tatttcttgt tgagcatggt attggtaaca aacgtaatgt gcatgatgat 3300

tgttctgctt tcttatggca tcaaagattg ggtcatatat ccaaagaaag gatattgagg 3360

ttggtgaaaa gtgacatcct gcctcaattg gattttactg attgggatgt gtgtgttgat 3420

tgtataaaag ggaaacaaac aagacacaca tcgaagtacc cagccatgag aagtaatgcg 3480

cctttagaat tgatacacac tgatatttgt ggcccctttg acattcctac atggggtggt 3540

gaaaaatatt tcatcacatt catagatgac tactcacggt attgttactt atatctactg 3600

catgaaaagt cctggtcagt aaataccctg gaggtgttta ttgatgaagt ggaaaggcag 3660

ttagatagaa aagtaaaagt gattaagtca gacaggggtg gtgaatatta tggaaaattc 3720

aatgaaagtg gacaatgtcc tggtccattt gcaaaatttc ttgaaagtcg aggcatatgt 3780

gcacagtaca caatgcctgg tacaccacaa caaaatggtg tagcggaaag gcggaatcgc 3840

acacttatgg atatggttag gagcatgttg agtaacagta ctgtaccttt atccttgtgg 3900

atgcatgcat taagaactgc agcatatctg ctgaacaggg ttcccagtaa ggctgtccct 3960

aaaactcctt acgagttatg gacaggcagg aaacccagtt tgagacacct ccatgtttgg 4020

ggttgttcag cagaagtaag gatatataat ccacatgaag gaaagcttga tgcaaggacc 4080

attagtggtc acttcattgg ctatcctgaa aagtctaaag gatataggtt ctattgccct 4140

aaccatagca caagaatagt tgagtctggt aatgctcgat tcattgaaaa tggccggttc 4200

agtgggagtg gggagtcacg aaaggtggat attagagaat tacataatga aaaattcaca 4260

gtgagtactc ctactcaagg tggtatcccc acacccagtg tttctactca aattgttgtt 4320

ccttttgttg catcacagtc acgtgacatg caagggcaac aaattgatac tcgaaacacg 4380

caaagtgaac gcataagaga tgaaccaagt gacaatgtgc aatgtacaaa tgaacaagtg 4440

ataccacaag aaatggcatt acggaggtct acgagacaga aaaggccagc tgtatctaat 4500

gattatgtgg tttactcact tgagcatgag tcggaattga gcattgataa agatccagtc 4560

tcatttcaac aagccatgga atgtaatgat tctgaaaagt ggctcaatgc catgaaggaa 4620

gagatgaaat cgatggatgt aaaccaagtc tgggaactag tagagttacc taaaggatca 4680

aaacgagttg gctgtaagtg ggtcttcaag accaagcgaa actcgaaagg taatatcgaa 4740

aggtataaag ccagactggt tgccaaaggt ttcactcaaa gggatggtat tgactataag 4800

gagactttct ctccagtctc taagaaagac tccttgagaa ttattatggc tttggtggct 4860

cataatgatc tagagcttca ccaaatggat gtaaagaccg cctttttgaa tggtgactta 4920

gaagaggaag tatgtatgga ccaacctgaa ggtttcacca ccaccgggca ggaaaatttg 4980

gtgtgtaaat taaagaaatc gatatacgga ctgaaacagg cttcccgaca atggtatctt 5040

aagttcaatg ataccattac gtcatacggc tttgtagaga acaccgttga tcggtgtatc 5100

tatatgaaga ttagtgggag caagttcatt atattagtcc tatatgttga tgacattctt 5160

ttggccgcta atgacatggg tttgttacat gatgttaaga aatttctctc tgaaactttt 5220

gaaatgaaag atatgaatga ggcatcttat gtgattggaa tagagatatt ccgtgataga 5280

tcacaaggat tgttgggatt gtctcagaaa gggtatatca ataaagtatt agagagattt 5340

agaatggaaa attgctctac aggaatagtt ccaattcaga aaggggacaa gttcagtgaa 5400

ctgcaatgtc caaagaatga tttggaacgg aaagcaatgg aatcaattcc ctatgcctca 5460

ctggttggaa gcctgatgta tgcgcaaaca tgcactcggc cagacattag tttcgctgtt 5520

ggaatgttag gccgatatca aagcaatcct ggaatagatc attggaaagc cggaaagaaa 5580

gtccttaggt acttgcaagg caccaaagat tatatgctta cttataaaag atcaagtcat 5640

cttgaaatag taggctactc ggattcagat tatgctggat gtgtagactc gaggaaatct 5700

acatttggtt acttgttcct cctagctgga ggagcagttt cctggaaaag tgggaagcag 5760

tctgtcattg ctacttccac tatggaggct gaatttatag catgctttga ggctactatt 5820

catgcattat ggttgcggaa ttttatctca aggctcagtt tggtcgacag tatagaaaag 5880

ccgttgagaa tttactgtga taattccgca gcagttttct tctctaagaa tgataggtat 5940

tctaaaggtg cgaaacatat ggatttgaaa tacctatctg ttaaagaaga agtgcaaaat 6000

cacagagtgt ctattgagca cattggcact gagttgatga tagcggaccc gttaactaaa 6060

ggtttgccac cgaaaacatt cactggacat gttgatcgga tgggcatatt ggacaggtcc 6120

tcattctctt gaaagtcaat attttgtact gctcatatca ttgagacact cttgaattca 6180

attaaggtcg tggttttgct tgtgctttgt tgtctctatt tagttgtata cagttatagt 6240

ttgtgagata actaatggca tatatggaca tgacaattta aaactttaat gtttctcagt 6300

aaggttattc tgaattatca tgattatgtg atacatggaa ggaatcatgt cactgagaga 6360

tatgtgaccg ccatgatcca atcgttttaa ttcaatcaag tattgtgatt tgataatctt 6420

taaggattgt gcacacttat ttgttgttga ttcatcaaat cattacaagg gccaagtggg 6480

agattgttga gttaatcgac ataaagtggc ccttgtttaa cgtatgaccc aaataatgga 6540

tggcttaacg tgatggtctg ttaagcaaaa cggtggtttt gggttaatgg gtttgaaatc 6600

cctccgctct cccttctgac agatagccgt tacagatagg gagaatctcc ctatcttcag 6660

ggcaacggct gctggaaaat ggatgaatat atatatattc attatggaca ttttctgggc 6720

tctctcaacc atcagagaaa agcgtaaaga acagaaaggg aagagtagga gaaaaggtaa 6780

gaagagaaaa ggtaggagga gagaagatag gagaaacaga aaggaaagcg tacagggcag 6840

gaaagagaag ttttctcatc tctactaccg gatatcagaa taatggagaa cggtatgttg 6900

ttctgatttc ctattccttt tggttttgtt acagttatat tgctagtatt cgtatcaaga 6960

taacgatcct gcatgataga gataagaaaa gtctaaca 6998

<210> 2

<211> 37

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

ataggtacct caattacccc ttaacatggt agtcagg 37

<210> 3

<211> 37

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

catgagctca cttgttgcca catagttcct tcttttg 37

<210> 4

<211> 119

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

aagcttacgt atgttatatg gactaaagga ggcttttctg caggtcgact ctagaggatc 60

cccgggtacc gagctcgaat ttttactaac aaatggtatt atttataaca gctgaattc 119

<210> 5

<211> 1484

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

ccaatactag cttgtctgta agcggatgcc gggagcagac aagcccgtca gggcgcgtca 60

gcgggtgttg gcgggtgtcg gggctggctt aactatgcgg catcagagca gattgtactg 120

agagtgcacc ataaattccc gttttaagag cttggtgagc gctaggagtc actgccaggt 180

atcgtttgaa cacggcatta gtcagggaag tcataacaca gtcctttccc gcaattttct 240

ttttctatta ctcttggcct cctctagtac actctatatt tttttatgcc tcggtaatga 300

ttttcatttt tttttttccc ctagcggatg actctttttt tttcttagcg attggcatta 360

tcacataatg aattatacat tatataaagt aatgtgattt cttcgaagaa tatactaaaa 420

aatgagcagg caagataaac gaaggcaaag atgacagagc agaaagccct agtaaagcgt 480

attacaaatg aaaccaagat tcagattgcg atctctttaa agggtggtcc cctagcgata 540

gagcactcga tcttcccaga aaaagaggca gaagcagtag cagaacaggc cacacaatcg 600

caagtgatta acgtccacac aggtataggg tttctggacc atatgataca tgctctggct 660

gttataaata ataccatttg ttagtaaaaa ttcgagctcg gtacccgggg atcctctaga 720

gtcgacctgc agaaaagcct cctttagtcc atattaacat acccaagcat tccggctggt 780

cgctaatcgt tgagtgcatt ggtgacttac acatagacga ccatcacacc actgaagact 840

gcgggattgc tctcggtcaa gcttttaaag aggccctact ggcgcgtgga gtaaaaaggt 900

ttggatcagg atttgcgcct ttggatgagg cactttccag agcggtggta gatctttcga 960

acaggccgta cgcagttgtc gaacttggtt tgcaaaggga gaaagtagga gatctctctt 1020

gcgagatgat cccgcatttt cttgaaagct ttgcagaggc tagcagaatt accctccacg 1080

ttgattgtct gcgaggcaag aatgatcatc accgtagtga gagtgcgttc aaggctcttg 1140

cggttgccat aagagaagcc acctcgccca atggtaccaa cgatgttccc tccaccaaag 1200

gtgttcttat gtagtgacac cgattattta aagctgcagc atacgatata tatacatgtg 1260

tatatatgta tacctatgaa tgtcagtaag tatgtatacg aacagtatga tactgaagat 1320

gacaaggtaa tgcatcattc tatacgtgtc attctgaacg aggcgcgctt tccttttttc 1380

tttttgcttt ttcttttttt ttctcttgaa ctcgacggat ctatgcggtg tgaaataccg 1440

cacagatgcg taaggagaaa ataccgcatc aggaaaagta ttgg 1484

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

agcttgtctg taagcggatg 20

<210> 7

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

tttcctgatg cggtattttc t 21

<210> 8

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

aaaacattca ctggacatgt tgat 24

<210> 9

<211> 27

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

aattcagaat aaccttactg agaaaca 27

<210> 10

<211> 16

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

gactgcgtac caattc 16

<210> 11

<211> 16

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

gatgagtcct gagcgc 16

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

agagcggagg gatttcaaac 20

<210> 13

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

gatgagtcct gagcgcact 19

<210> 14

<211> 30

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

gacgatgagt cctgagcgct caggactcat 30

<210> 15

<211> 35

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

ctcgtagact gcgtaccaat tggtacgcag tctac 35

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

ttgggaatcc ccgaacatcg 20

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

ccccatgtgt atcactggca 20

<210> 18

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 18

agtggccctt gtttaacgta tg 22

<210> 19

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 19

atccattttc cagcagccgt 20

<210> 20

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

caaggtggta tccccacacc 20

<210> 21

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 21

agctggcctt ttctgtctcg 20

Claims (8)

1. A retrotransposon Ra-RARE-1 having autonomous transposition activity, characterized in that it has the full-length sequence as set forth in SEQ ID NO: 1.

2. An expression cassette comprising the retrotransposon Ra-RARE-1 of claim 1.

3. The expression cassette of claim 2, further comprising a gene sequence for resistance screening and an artificially synthesized intron sequence.

4. The expression cassette of claim 3, wherein the synthetic intron sequence is an AI sequence having the sequence set forth in SEQ ID NO: 4.

5. The expression cassette of claim 3, wherein the gene sequence for resistance screening is the HIS3 gene sequence as set forth in SEQ ID NO: shown at 5.

6. A recombinant expression vector comprising the retrotransposon Ra-RARE-1 of claim 1.

7. Use of the retrotransposon Ra-RARE-1 according to claim 1 for gene function analysis or molecular breeding.

8. The use according to claim 7, characterized in that it is the use of the retrotransposon Ra-RARE-1 for the production of mutants or as transgene vectors.

Images