CN113444827A - Grape variety specific molecular marker and screening method and application thereof - Google Patents
Grape variety specific molecular marker and screening method and application thereof Download PDFInfo
- Publication number
- CN113444827A CN113444827A CN202110711960.9A CN202110711960A CN113444827A CN 113444827 A CN113444827 A CN 113444827A CN 202110711960 A CN202110711960 A CN 202110711960A CN 113444827 A CN113444827 A CN 113444827A
- Authority
- CN
- China
- Prior art keywords
- snp
- grape varieties
- grape
- sites
- varieties
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a specific molecular marker of 11 grape varieties and a screening method and application thereof, comprising the following steps: (1) taking leaves to extract genome DNA; (2) constructing a library according to a simplified genome sequencing technology Super-GBS method, (3) filtering sequencing data, obtaining SNP sites by using GATK, and filtering SNP; (4) screening sites of at least one variety different from the other two varieties in the 11 grape varieties according to the typing result of each variety; (5) according to the screening strategy, 7532 SNP loci for identifying 11 grape varieties are finally screened, and (6) two simple, rapid and reliable methods for identifying 11 grape varieties are developed based on the locus markers. The method lays a technical foundation for accurately controlling the grape varieties from the source, and the tissue culture seedlings and the grafted seedlings of the 11 grape varieties can be accurately distinguished, so that the control of a breeding enterprise on the grape varieties is ensured, and the economic loss caused by variety errors is reduced.
Description
Technical Field
The invention relates to 11 grape variety specific molecular markers and a screening method and application thereof, belonging to the technical field of biology.
Background
The grape is a Vitaceae (Vitaceae) Vitis (Vitis L.). Grapes are one of the important fruit tree species in the world, and the cultivation area and the yield of the grapes are second to those of oranges and are second to the oranges. The grapes are also one of five fruit trees (grapes, apples, oranges, pears and peaches) in China, and as the grapes are short in production period, fast in effect and high in yield, the grape industry in China develops rapidly after 1990, and the grape planting area and yield in China are the first world stably since 2010. From the source analysis, most of the existing grape cultivars are European and American hybrid varieties, and in addition, part of the cultivars belong to American related species originated in North America and vitis amurensis, downy grape, spine grape and the like originated in northeast Asia; the grape wine is functionally divided into wine, dry-making and fresh-eating grapes. The selection and breeding work of the fresh grape variety is started in China from the 50 th of the 20 th century, and various scientific and research units successively breed a plurality of new varieties with excellent quality by utilizing the existing resources; the introduction of high-quality varieties also accelerates the grape planting, improvement and industrial development in China. At present, the conventional methods of conventional cross breeding, nutrient line seed selection, bud mutation seed selection and the like are mainly used for variety breeding, and although embryo rescue technology and other biotechnology breeding means are widely applied, a large gap still exists compared with developed areas such as Europe, America, Japan and the like. The technical means of variety identification and evaluation are limited to the identification and evaluation of main phenotypic traits.
The 11 grape varieties are main planting varieties in the orchard at present, and the market share is high, so the accurate identification method of the grape varieties has great significance for accurate identification and identification of the varieties, reasonable utilization of grape resources, new variety breeding in scientific research departments, resource nursery establishment, enterprise nursery stock breeding and selling, orchard nursery stock planting production and other links.
Disclosure of Invention
The invention provides a screening method of specific molecular markers of 11 grape varieties, 7532 variety specific SNP markers are screened by applying the method, two simple, convenient, rapid and reliable methods for identifying the 11 grape varieties are developed based on the markers, and a technical basis is laid for accurately controlling the grape varieties from the source.
In order to solve the technical problems, the invention adopts the following technical scheme:
firstly, the invention provides a method for screening specific molecular markers of 11 grape varieties by using a simplified genome sequencing technology Super-GBS, which comprises the following steps:
(1) extracting leaf genome DNA by using known and accurate varieties of Xiongbao, Zaishengneimasa, Heibalado, Nina queen, Moduowa, Bixiangseedless, Heila, summer sunlight, Hongbaladuo, Zitian seedless and Christmas rose as samples;
(2) constructing a library according to a simplified genome sequencing technology Super-GBS method, and performing on-machine sequencing after the quality of the library is qualified;
(3) filtering sequencing data, and then obtaining SNP loci by using GATK;
(4) filtering the SNP under the following conditions: the SNP sequencing depth is not less than 4; eliminating sites with MAF less than 0.01; eliminating the sites with SNP typing deletion rate higher than 20%; removing the sites with consistent typing in all samples;
(5) screening all sites which have completely consistent individual types and have no individual deletion and are different from other varieties in the consistent sites of the individual types according to the typing result of each variety; finally 7532 SNP sites were screened, see Table 1.
(6) And constructing an evolutionary tree and clustering analysis by using 7532 SNP loci or part of the SNP loci.
In table 1, the 11 grape varieties represented by numerals 1 to 11, respectively, are in the following order: xiebao, zitian seedless, christmas rose, early naesma, nigrava, nina queen, morova, bi xiang seedless, black alpha, summer sunlight, pinkish red balao.
The SNP locus marker group information and the marker amplification primer information which can accurately identify 11 grape varieties are as follows:
table 2A set of SNP site information enabling accurate identification of 11 grape varieties
TABLE 3 SNP site identifying primer information in Table 2
Table 4A set of SNP site information enabling accurate identification of 11 grape varieties
TABLE 5 SNP site identifying primer information in Table 4
TABLE 6 set of SNP site information enabling accurate identification of 11 grape varieties
TABLE 7 SNP site identifying primer information in Table 6
Secondly, the invention provides a method for identifying 11 grape varieties by using a PCR method, which comprises the following steps:
(1) selecting several SNP loci from the SNP loci in Table 1 to combine into a locus group capable of identifying 11 grape varieties;
(2) designing a specific PCR amplification primer according to the genome position of the locus;
(3) extracting genome DNA of blind sample leaves of 11 grape varieties;
(4) the SNP marker set selection method according to claim 2, wherein the three selected site sets and the specific primers corresponding to the sites are shown in tables 2 to 7;
(5) carrying out PCR amplification by using a primer capable of amplifying the SNP locus;
(6) performing first-generation sequencing on the obtained PCR product;
(7) and analyzing and identifying the grape variety according to the sequencing information and the SNP site information.
The invention has the beneficial effects that: the tissue culture seedlings, the grafted seedlings and the finished seedlings of the 11 grape varieties can be accurately distinguished, the control of breeding enterprises on the varieties is ensured, and the economic loss caused by errors in the breeding process is reduced.
Drawings
The following describes embodiments of the present invention in further detail with reference to the accompanying drawings.
The figure 1 is that an evolutionary tree is constructed by utilizing 7532 specific SNP markers (the SNP markers are shown in table 1) of 11 grape varieties including screened Xiongbao, ZaosNeima, Heibalado, Nina Huang, Moduowa, Bixiang seedless, Heai, summer sunlight, Hongbaladuo, Zitian seedless and Christmas rose, and the 11 grape varieties can be accurately distinguished.
FIG. 2 is a diagram showing that the Super-GBS is used for carrying out the sequencing and SNP screening of grape samples, the finally screened SNP sites are overlapped with more than 90% of 7532 SNP sites which are determined to be effective, and 11 grape varieties can be accurately distinguished by classifying the 11 grape varieties by utilizing the overlapped sites.
In fig. 1 and 2 of the present invention, the varieties corresponding to the sample numbers are shown in the following table:
| serial number | Variety of (IV) C | Sample numbering |
| 1 | Male treasure | D-1，D-25 |
| 2 | Early-born Neimas | D-3，D-27，D-40 |
| 3 | Heibaladuo | D-2，D-11，D-15 |
| 4 | Nina queen | D-4，D-13，D-38， |
| 5 | Moldow tile | D-5，D-16，D-28，D-41， |
| 6 | Bixiang seedless tea | D-9，D-6，D-17， |
| 7 | Black alpha | D-7，D-20，D-30，D-42， |
| 8 | Sunshine in summer | D-8，D-19，D-34 |
| 9 | Hongbaladuo | D-10，D-18，D-31， |
| 10 | Purple sweet without pit | D-21，D-32，D-37， |
| 11 | Christmas rose | D-23，D-35，D-45 |
Detailed Description
Example 1
The embodiment provides a method for screening 11 grape variety-specific SNP molecular markers including male treasure, early-born Neima, Heibalado, Nina Queen, Moduowa, Bixiang seedless, Black alpha, summer sunshine, Red Ballado, Violet seedless and Christmas rose by using a simplified genome sequencing technology Super-GBS, which comprises the following steps:
(1) using 2 male treasure, 2 early-born Neima, 2 black pala, 2 Nina queen, 3 Moduowa, 2 Bixiang seedless, 3 black alpha, 2 summer sunshine, 2 red pala, 2 purple sweet seedless and 2 Christmas rose grape samples with known varieties, and taking leaves to extract genome DNA;
(2) constructing a library according to a simplified genome sequencing technology Super-GBS method, and performing on-machine sequencing after the quality of the library is qualified;
(3) filtering sequencing data, and then obtaining SNP loci by using GATK;
(4) filtering the SNP under the following conditions: the SNP sequencing depth is not less than 4; eliminating sites with MAF less than 0.01; eliminating the sites with SNP typing deletion rate higher than 20%; removing the sites with consistent typing in all samples;
(5) screening all individual types in each variety according to the typing result of each variety, wherein the typing consistent sites of all individuals in each variety are completely consistent, have no individual deletion and are different from at least one variety site in other 10 grape varieties, and finally screening 7532 SNP sites;
(6) and constructing an evolutionary tree and clustering analysis by using 7532 SNP loci.
The specific operation steps are as follows:
this example mainly comprises the following steps, i.e., digestion, ligation, purification, amplification, pooling and analysis.
1. Enzyme digestion:
Super-GBS library construction is carried out on 2 male treasure, 2 early-born Neimas, 2 black Barbado, 2 Nina queen, 2 Moova, 2 Bixiang seedless, 3 black alpha, 2 summer sunshine, 2 red Barbado, 2 purple sweet seedless and 2 Christmas roses which are accurate in variety and provided by a standard institution purchased by the company, and the specific process is as follows (the usage amount of enzyme digestion reagent of each sample is as follows):
all the components are mixed evenly and then cut for 2h at 37 ℃, and then the temperature is kept for 20min at 75 ℃ to inactivate the enzyme.
2. Connecting:
the adapter, barcode and the enzyme cutting fragment are connected in a 40 mu L system.
All the components are mixed evenly and then are cut by enzyme for 2h at the temperature of 22 ℃, and then the temperature is kept for 20min at the temperature of 65 ℃ to inactivate the enzyme.
3. Purification of
35 μ L of the ligation product was added to 0.7-fold volume of Sera-Mag beads (GE Healthcare Life Sciences) and allowed to stand at room temperature for 5min to remove small fragments of 300bp or less. The magnetic beads were recovered from the supernatant and eluted 3 times with 200. mu.L of 70% ethanol. Finally, the DNA was recovered from the beads using 40. mu.l of 10mM Tris.HCl (pH 8.0).
4. Amplification of
Mixing all the components, placing in a PCR instrument, performing amplification for 16 cycles under the reaction condition of pre-denaturation at 95 ℃ for 30s, performing annealing at 62 ℃ for 20s, performing extension at 68 ℃ for 15s, performing extension at 68 ℃ for 5min, and storing at 4 ℃.
5. Mixed warehouse
The library concentration of each sample was determined using Qubit, samples at concentrations greater than 5 ng/. mu.l were used for pool sequencing. Primers and small fragments in the library are removed by adding 0.7-fold volume of Sera-Mag beads, and then mixed sample sequencing is carried out according to the sequencing quantity requirement, wherein the sequencing platform is Illumina Nova PE 150. The linker and primer sequences used in the library construction process are detailed in Table 8 below.
TABLE 8 construction of linker and primer sequences for Super-GBS sequencing libraries
| Name (R) | Sequence (5 '-3') |
| Common adaptor top | GATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT |
| Common adaptor bot | CGAGATCGGAAGAGCGGGGACTTTAAGC |
| PstI adaptor top | CACGACGCTCTTCCGATCTAACXXXXXXTGCA |
| PstI adaptor bot | YYYYYYAGATCGGAAGAGCGTCGTG |
| Primer1 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| Primer2 | CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAA |
6. Analysis of
24 samples of 11 grape varieties are subjected to Super-GBS sequencing, and 66M high-quality reads are obtained in total. Aligning high quality reads to a reference genome with an alignment rate of 78.65-85.77% and an average sequencing depth of 37.52 x for all samples. Obtaining SNP loci by using GATK (v3.8-1) software, then screening at least one SNP locus different from other varieties among 11 varieties, finally obtaining 7532 SNP loci, analyzing by using treebest software, drawing by using R package ggtree, wherein the loci can be used for accurately identifying 11 grape varieties, and the identification result is shown in figure 1.
Example 2
This example provides the method of the present invention for identifying the varieties of 1 of 10 grape varieties (except xiubao) randomly collected from the variety nursery of agriculture ltd, da feng garden, shandong, and simultaneously adding the sequencing data of 11 grape variety samples (samples in example 1) of known varieties as controls for testing and verification, comprising the following steps:
(1) randomly collecting 1 leaf of each of early-born Neima, Heibalado, Nina queen, Modorwa, Bixiang seedless, Black alpha, summer sunshine, Hongbaladuo, purple sweet seedless and Christmas rose grape varieties from a variety garden of agriculture Limited company in Shandong Dafeng garden, and extracting genome DNA;
(2) constructing a library according to a simplified genome sequencing technology Super-GBS method, and performing on-machine sequencing after the quality of the library is qualified;
(3) filtering sequencing data, and then obtaining SNP loci by using GATK;
(4) filtering the SNP under the following conditions: the SNP sequencing depth is not less than 4; eliminating sites with MAF less than 0.01; eliminating the sites with SNP typing deletion rate higher than 20%; removing the loci with consistent typing in all samples, reserving the SNP loci which are coincided with the 7532 loci in the table 1, and finally obtaining 7082 SNP loci;
(5) and (3) constructing an evolutionary tree by utilizing the 7082 SNP loci which are finally obtained, and determining the varieties of the collected grape samples in the variety nursery.
The specific operation steps are as follows:
this example mainly comprises the following steps, i.e., digestion, ligation, purification, amplification, pooling and analysis.
1. Enzyme digestion:
performing Super-GBS library construction on 1 each of the early-growing endo-masa, black balanopus, nina queen, morova, verdant seedless, black alpha, summer sunlight, red balanopus, purple sweet seedless and Christmas rose grape varieties randomly collected from the variety gardens of agriculture Limited companies in Shandong Dafeng gardens, wherein the specific process is as follows (the using amount of each sample is as follows):
all the components are mixed evenly and then cut for 2h at 37 ℃, and then the temperature is kept for 20min at 75 ℃ to inactivate the enzyme.
2. Connecting:
the adapter, barcode and the enzyme cutting fragment are connected in a 40 mu L system.
All the components are mixed evenly and then are cut by enzyme for 2h at the temperature of 22 ℃, and then the temperature is kept for 20min at the temperature of 65 ℃ to inactivate the enzyme.
3. Purification of
35 μ L of the ligation product was added to 0.7-fold volume of Sera-Mag beads (GE Healthcare Life Sciences) and allowed to stand at room temperature for 5min to remove small fragments of 300bp or less. The magnetic beads were recovered from the supernatant and eluted 3 times with 200. mu.L of 70% ethanol. Finally, the DNA was recovered from the beads using 40. mu.l of 10mM Tris.HCl (pH 8.0).
4. Amplification of
Mixing all the components, placing in a PCR instrument, performing amplification for 16 cycles under the reaction condition of pre-denaturation at 95 ℃ for 30s, performing annealing at 62 ℃ for 20s, performing extension at 68 ℃ for 15s, performing extension at 68 ℃ for 5min, and storing at 4 ℃.
5. Mixed warehouse
The library concentration of each sample was determined using Qubit, samples at concentrations greater than 5 ng/. mu.l were used for pool sequencing. Primers and small fragments in the library are removed by adding 0.7-fold volume of Sera-Mag beads, and then mixed sample sequencing is carried out according to the sequencing quantity requirement, wherein the sequencing platform is Illumina Nova PE 150. The linker and primer sequences used in the library construction process are detailed in Table 8 below in example 1.
6. Analysis of
A total of 30M high quality reads were obtained by performing Super-GBS sequencing on 10 samples. High quality reads were aligned to the reference genome at rates of 77.38-84.63, with an average sequencing depth of 37.4X for all samples. A large number of SNP loci are obtained by utilizing GATK (v3.8-1) software, and are compared with 7532 SNP loci in a table 1, so that 7082 SNP loci in the 7532 SNP loci are finally obtained, treebest software is adopted for analysis, R package ggtree mapping is utilized, the loci can be used for accurate identification of 11 grape varieties, and identification results are shown in a figure 2.
Example 3
The embodiment provides a PCR detection primer corresponding to the SNP site design, PCR amplification is carried out on genomic DNA of a plurality of grape variety samples randomly collected from a variety garden of Shandong Dafeng garden agriculture Limited company, 11 grape varieties are identified by a sequencing method, and 11 grape varieties of known varieties are added as positive controls for test and verification. The method comprises the following steps:
(1) 2 plants of each of Xiongbao, Zaishengneimasa, Heibalado, Nina queen, Moduowa, Bixiang seedless, Heila, summer sunlight, Hongbalado, purple sweet seedless and Christmas rose which are accurate in variety and provided by a standard institution purchased by the company are extracted, and leaf genome DNA is extracted;
(2) randomly collecting 2 plants of Xiongbao, Zaoshennama, Heibalado, Nina queen, Moduowa, Bixiang seedless, Heila, summer sunshine, Hongbaladuo, purple sweet seedless and Christmas rose from a variety garden of agriculture Limited company in Shandong Dafeng garden, and extracting leaf genome DNA;
(3) selecting loci from 7532 SNP loci to form an SNP locus group capable of accurately identifying 11 grape varieties, which is shown in Table 2;
(4) designing upstream and downstream primers for PCR amplification according to the genomic position of the selected SNP locus, as shown in Table 3;
(5) performing PCR amplification by using the universal primers of 11 grape varieties in the table 3;
(6) performing a first-generation sequencing of the amplified sequence;
(7) and (4) performing typing interpretation on the grape variety according to the sequence of the corresponding site in the sequencing result by referring to the used SNP site information.
The specific operation steps are as follows:
this example comprises mainly the following steps, i.e. PCR, sequencing, alignment and analysis.
1. PCR amplification
PCR amplification primers were designed according to the positions of the sites in Table 2, and the sequences of the primers are shown in Table 3. The amplification conditions were 94 ℃ for 3min,94 ℃ for 30sec,55 ℃ for 45sec,72 ℃ for 45sec,37 cycles, 72 ℃ for 7min, and 12 ℃ for 30 min. The amplification system is as follows.
2. Sequencing
The obtained PCR amplification product is detected by using 1% agarose gel electrophoresis, and a sample of which a specific amplification band is obtained at a predicted position is sent to Shanghai Biometrics, Inc. for sequencing.
3. Sequence alignment
The sequencing result is subjected to sequence comparison by using DNMAN software or SnapGene, and 11 grape varieties are typed by using one SNP site marker group (shown in a table 2) screened from 7532 sites.
4. Analysis of
The sequence comparison identification results show that the total 24 identification results of the 11 grape varieties of Xiongbao, Zangneimasa, Heibalado, Nina queen, Moduowa, Bixiang seedless, Heila, summer sunshine, Hongbaladuo, Zisuanseedless and Christmas rose accord with the actual variety conditions.
Example 4
The embodiment provides a PCR detection primer corresponding to the SNP site design, PCR amplification is carried out on the genomic DNA of a plurality of grape variety saplings randomly collected from the variety garden of Shandong Dafeng garden agriculture Limited company, 11 grape variety varieties are identified by a sequencing method, and 11 grape varieties of known varieties are added as positive controls for test and verification. The method comprises the following steps:
(1) 2 plants of each of Xiongbao, Zaishengneimasa, Heibalado, Nina queen, Moduowa, Bixiang seedless, Heila, summer sunlight, Hongbalado, purple sweet seedless and Christmas rose which are accurate in variety and provided by a standard institution purchased by the company are extracted, and leaf genome DNA is extracted;
(2) randomly collecting 2 plants of Xiongbao, Zaoshennama, Heibalado, Nina queen, Moduowa, Bixiang seedless, Heila, summer sunshine, Hongbaladuo, purple sweet seedless and Christmas rose from a variety garden of agriculture Limited company in Shandong Dafeng garden, and extracting leaf genome DNA;
(3) selecting loci from 7532 SNP loci to form a SNP locus group capable of accurately identifying 11 grape varieties, see Table 4;
(4) designing upstream and downstream primers for PCR amplification according to the genomic position of the selected SNP locus, see Table 5;
(5) performing PCR amplification by using the universal primers of 11 grape varieties in the table 5;
(6) performing a first-generation sequencing of the amplified sequence;
(7) and (4) performing typing interpretation on the grape variety according to the sequence of the corresponding site in the sequencing result by referring to the used SNP site information.
The specific operation steps are as follows:
this example comprises mainly the following steps, i.e. PCR, sequencing, alignment and analysis.
1. PCR amplification
PCR amplification primers were designed according to the positions of the sites in Table 4, and the sequences of the primers are shown in Table 5. The amplification conditions were 94 ℃ for 3min,94 ℃ for 30sec,55 ℃ for 45sec,72 ℃ for 45sec,37 cycles, 72 ℃ for 7min, and 12 ℃ for 30 min. The amplification system is as follows.
2. Sequencing
The obtained PCR amplification product is detected by using 1% agarose gel electrophoresis, and a sample of which a specific amplification band is obtained at a predicted position is sent to Shanghai Biometrics, Inc. for sequencing.
3. Sequence alignment
The sequencing result is subjected to sequence comparison by using DNMAN software or SnapGene, and 11 grape varieties are typed by using one SNP site marker group (shown in a table 4) screened from 7532 sites.
4. Analysis of
The sequence comparison identification results show that the total 24 identification results of the 11 grape varieties of Xiongbao, Zangneimasa, Heibalado, Nina queen, Moduowa, Bixiang seedless, Heila, summer sunshine, Hongbaladuo, Zisuanseedless and Christmas rose accord with the actual variety conditions.
Example 4
The embodiment provides a PCR detection primer corresponding to the SNP site design, PCR amplification is carried out on the genomic DNA of a plurality of grape variety saplings randomly collected from the variety garden of Shandong Dafeng garden agriculture Limited company, 11 grape variety varieties are identified by a sequencing method, and 11 grape varieties of known varieties are added as positive controls for test and verification. The method comprises the following steps:
(1) 2 plants of each of Xiongbao, Zaishengneimasa, Heibalado, Nina queen, Moduowa, Bixiang seedless, Heila, summer sunlight, Hongbalado, purple sweet seedless and Christmas rose which are accurate in variety and provided by a standard institution purchased by the company are extracted, and leaf genome DNA is extracted;
(2) randomly collecting 2 plants of Xiongbao, Zaoshennama, Heibalado, Nina queen, Moduowa, Bixiang seedless, Heila, summer sunshine, Hongbaladuo, purple sweet seedless and Christmas rose from a variety garden of agriculture Limited company in Shandong Dafeng garden, and extracting leaf genome DNA;
(3) selecting loci from 7532 SNP loci to form an SNP locus group capable of accurately identifying 11 grape varieties, which is shown in Table 6;
(4) designing upstream and downstream primers for PCR amplification according to the genomic position of the selected SNP locus, see Table 7;
(5) performing PCR amplification by using the universal primers of 11 grape varieties in the table 7;
(6) performing a first-generation sequencing of the amplified sequence;
(7) and (4) performing typing interpretation on the grape variety according to the sequence of the corresponding site in the sequencing result by referring to the used SNP site information.
The specific operation steps are as follows:
this example comprises mainly the following steps, i.e. PCR, sequencing, alignment and analysis.
1. PCR amplification
PCR amplification primers were designed based on the positions of the sites in Table 6, and the primer sequences are shown in Table 7. The amplification conditions were 94 ℃ for 3min,94 ℃ for 30sec,55 ℃ for 45sec,72 ℃ for 45sec,37 cycles, 72 ℃ for 7min, and 12 ℃ for 30 min. The amplification system is as follows.
2. Sequencing
The obtained PCR amplification product is detected by using 1% agarose gel electrophoresis, and a sample of which a specific amplification band is obtained at a predicted position is sent to Shanghai Biometrics, Inc. for sequencing.
3. Sequence alignment
The results obtained by sequencing were compared with DNAMAN software or SnapGene, and 11 grape varieties were typed using one SNP site marker group (see Table 6) selected from the 7532 sites according to the present invention.
4. Analysis of
The sequence comparison identification results show that the total 24 identification results of the 11 grape varieties of Xiongbao, Zangneimasa, Heibalado, Nina queen, Moduowa, Bixiang seedless, Heila, summer sunshine, Hongbaladuo, Zisuanseedless and Christmas rose accord with the actual variety conditions.
Other SNP locus marker groups are selected from 7532 SNP loci, and 11 grape varieties of Xiongbao, ZaosNeima, Heibalado, Nina Huanghou, Moduowa, Bixiang seedless, Heila, summer sunlight, Hongbaolado, Zitian seedless and Christmas rose can be accurately identified.
The foregoing is directed to preferred embodiments of the present invention, other and further embodiments of the invention may be devised without departing from the basic scope thereof, and the scope thereof is determined by the claims that follow. However, any simple modification, equivalent change and modification of the above embodiments according to the technical essence of the present invention are within the protection scope of the technical solution of the present invention.
Table 1 of the invention is as follows:
7532 specific SNP marker loci of Table 111 grape varieties
Sequence listing
<110> agriculture Co Ltd in Dafeng Yuan Shandong
<120> grape variety specific molecular marker and screening method and application thereof
<160> 22
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ttctccattc tcgctgcgtt 20
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
<210> 13
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
<210> 14
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
<210> 15
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
acagcaaatc caggaaagcg 20
<210> 17
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
<210> 18
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
<210> 19
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
<210> 20
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
<210> 21
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
<210> 22
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
gcaggttgtc aatggctgtg 20
Claims (6)
1. The method can accurately identify the 11 grape varieties including SNP loci of Xiongbao, ZaosNeima, Heibalado, Nina queen, Moduowa, Bixiang seedless, Heila, summer sunlight, Hongbaladuo, Zishandong seedless and Christmas rose, and is characterized by comprising 7532 loci, and specific loci are shown in Table 1.
2. The SNP locus according to claim 1, wherein thousands of sets of SNP locus marker sets that accurately identify 11 grape varieties can be screened, and three sets of SNP locus marker set information and marker amplification primer information that can accurately identify 11 grape varieties are as follows:
table 2A set of SNP site information enabling accurate identification of 11 grape varieties
TABLE 3 SNP site identifying primer information in Table 2
Table 4A set of SNP site information enabling accurate identification of 11 grape varieties
TABLE 5 SNP site identifying primer information in Table 4
TABLE 6 set of SNP site information enabling accurate identification of 11 grape varieties
TABLE 7 SNP site identifying primer information in Table 6
3. The method for screening the grape variety specific molecular marker by using the simplified genome sequencing technology Super-GBS is characterized by comprising the following steps:
(1) extracting leaf genome DNA by using 11 accurate grape varieties including Xiongbao, ZaosNeima, Heibalado, Nina queen, Moduowa, Bixiang seedless, Heila, summer sunlight, Hongbaladuo, Zitian seedless and Christmas rose as samples;
(2) constructing a library according to a simplified genome sequencing technology Super-GBS method, and performing on-machine sequencing after the quality of the library is qualified;
(3) according to the typing result of each variety, firstly, sites with consistent typing in all samples are removed, then, sites with complete consistent individual typing and no individual deletion in each variety are screened to obtain SNP sites, standard samples of 11 grape varieties are utilized to filter and screen the obtained SNP sites, blind samples of the 11 grape varieties are utilized to verify the SNP sites, and finally, the SNP sites capable of accurately identifying the 11 grape varieties are obtained (see table 1).
4. The method for screening the specific molecular markers of 11 grape varieties by using the simplified genome technology Super-GBS as claimed in claim 3, wherein the SNP filtering condition is that the SNP sequencing depth is not less than 4; eliminating sites with MAF less than 0.01; eliminating the sites with SNP typing deletion rate higher than 20%.
5. The use of the SNP site of claim 1 for accurately identifying 11 grape varieties Xiongbao, Zangshengmeis, Heibalado, Nina Queen, Modolawa, Bixiang seedless, Heila, summer sunlight, Red Ballado, Violet seedless and Christmas rose.
6. A PCR method for accurately identifying 11 grape varieties is characterized by comprising the following steps:
(1) selecting several SNP sites from the SNP sites of the table 1 as claimed in claim 1 to combine into a site group capable of identifying 11 grape varieties;
(2) designing a specific PCR amplification primer according to the genome position of the locus;
(3) extracting genome DNA of 11 grape varieties;
(4) the SNP marker set screening method according to claim 2, wherein the three SNP site sets screened out and the specific primers corresponding to the sites are shown in tables 2 to 7 in claim 2;
(5) carrying out PCR amplification by using a primer capable of amplifying the SNP locus;
(6) performing first-generation sequencing on the obtained PCR product;
(7) and (4) comparing the SNP site information according to the sequence information to analyze and identify the grape variety.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110711960.9A CN113444827B (en) | 2021-06-25 | 2021-06-25 | Grape variety specific molecular marker and screening method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110711960.9A CN113444827B (en) | 2021-06-25 | 2021-06-25 | Grape variety specific molecular marker and screening method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113444827A true CN113444827A (en) | 2021-09-28 |
| CN113444827B CN113444827B (en) | 2022-09-27 |
Family
ID=77812872
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110711960.9A Active CN113444827B (en) | 2021-06-25 | 2021-06-25 | Grape variety specific molecular marker and screening method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113444827B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116024373A (en) * | 2022-12-28 | 2023-04-28 | 沈阳农业大学 | SNP molecular marker related to grape cold resistance and application thereof |
| CN117887894A (en) * | 2024-03-14 | 2024-04-16 | 南京农业大学三亚研究院 | Grape variety identification method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014129885A1 (en) * | 2013-02-21 | 2014-08-28 | Malaysian Palm Oil Board | Method for identification of molecular markers linked to height increment |
| CN107723378A (en) * | 2017-11-13 | 2018-02-23 | 中国农业科学院郑州果树研究所 | The seedless main effect QTL site SDL of grape fruit SNP marker and application |
| CN108998563A (en) * | 2018-09-21 | 2018-12-14 | 南京农业大学 | The primer of accurate identification grape pomace color and its application |
-
2021
- 2021-06-25 CN CN202110711960.9A patent/CN113444827B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014129885A1 (en) * | 2013-02-21 | 2014-08-28 | Malaysian Palm Oil Board | Method for identification of molecular markers linked to height increment |
| CN107723378A (en) * | 2017-11-13 | 2018-02-23 | 中国农业科学院郑州果树研究所 | The seedless main effect QTL site SDL of grape fruit SNP marker and application |
| CN108998563A (en) * | 2018-09-21 | 2018-12-14 | 南京农业大学 | The primer of accurate identification grape pomace color and its application |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116024373A (en) * | 2022-12-28 | 2023-04-28 | 沈阳农业大学 | SNP molecular marker related to grape cold resistance and application thereof |
| CN116024373B (en) * | 2022-12-28 | 2024-10-01 | 沈阳农业大学 | SNP molecular marker related to grape cold resistance and application thereof |
| CN117887894A (en) * | 2024-03-14 | 2024-04-16 | 南京农业大学三亚研究院 | Grape variety identification method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113444827B (en) | 2022-09-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106755482B (en) | SSR molecular marker III for identifying progeny plants of Gala apples and application thereof | |
| CN113444827B (en) | Grape variety specific molecular marker and screening method and application thereof | |
| CN111560463B (en) | Three gala apple specific molecular markers and screening method and application thereof | |
| CN108192990B (en) | SNP molecular marker related to watermelon peel background color and application thereof | |
| CN111876477B (en) | Molecular marker primer combination for identifying sex characters of holly plants and application thereof | |
| CN109486991B (en) | Molecular marker primer composition for identifying intergeneric hybrid of pear and apple and application thereof | |
| CN115141893B (en) | Molecular marker group containing 7 molecular markers for predicting dry matter content of kiwi fruits, application of molecular marker group and kit | |
| CN113584206B (en) | Cherry main cultivated variety specific molecular marker and screening method and application thereof | |
| CN113355392B (en) | Apple rootstock specific molecular marker locus, and screening method and application thereof | |
| CN108998567B (en) | Molecular marker primer and method for identifying amygdalus pedunculata pall, amygdalus mongolicus and prunus ulmaria | |
| CN113493819B (en) | Fuji series apple specific molecular marker locus, and screening method and application thereof | |
| CN107267640B (en) | Identification method of vitis amurensis germplasm resources and application thereof | |
| CN113215300B (en) | 7 apple variety specific molecular markers and screening method and application thereof | |
| CN113549705B (en) | Pear stock specific molecular marker and screening method and application thereof | |
| CN116970728B (en) | SSR (simple sequence repeat) marker primer, method and application for rapidly identifying tea plum variety | |
| CN116814837B (en) | SSR (simple sequence repeat) marker primer, method and application for rapidly identifying varieties of camellia yunnanensis | |
| CN110643728A (en) | Method for improving breeding efficiency of poplar crossbreeding | |
| CN113957167B (en) | Cherry rootstock specific molecular marker and screening method and application thereof | |
| CN113355445B (en) | Pear variety specific molecular marker and screening method and application thereof | |
| CN116574839B (en) | SSR (simple sequence repeat) marker primer, method and application for rapidly identifying camellia varieties | |
| CN112831593B (en) | SNP molecular marker primer for variety identification of red peach trees in early summer and identification and application method thereof | |
| CN117721243B (en) | SSR primer and method for identifying purity of Yunnan pine hybrid seeds | |
| CN115404282A (en) | Method for rapidly identifying populus tremuloides homozygous diploid | |
| CN117925886B (en) | SNP molecular marker related to side-by-side load character and application | |
| CN116411127B (en) | Molecular marker primer combination for rapidly identifying mature-period characters of peach fruits and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |